FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2158644807> ?p ?o ?g. }

• W2158644807 endingPage "25699" @default.
• W2158644807 startingPage "25688" @default.
• W2158644807 abstract "The key gluconeogenic enzyme fructose-1,6-bisphosphatase (FBPase) is targeted to Vid vesicles when glucose-starved cells are replenished with glucose. Vid vesicles then deliver FBPase to the vacuole for degradation. A modified alkaline phosphatase assay was developed to study the trafficking of Vid vesicles to the vacuole. For this assay, FBPase was fused with a truncated form of alkaline phosphatase. Under in vivo conditions, FBPase-Δ60Pho8p was targeted to the vacuole via Vid vesicles, and it exhibited Pep4p- and Vid24p-dependent alkaline phosphatase activation. Vid vesicle-vacuole targeting was reconstituted using Vid vesicles that contained FBPase-Δ60Pho8p. These vesicles were incubated with vacuoles in the presence of cytosol and an ATP-regenerating system. Under in vitro conditions, alkaline phosphatase was also activated in a Pep4p- and Vid24p-dependent manner. The GTPase Ypt7p was identified as an essential component in Vid vesicle-vacuole trafficking. Likewise, a number of v-SNAREs (Ykt6p, Nyv1p, Vti1p) and homotypic fusion vacuole protein sorting complex family members (Vps39p and Vps41p) were required for the proper function of Vid vesicles. In contrast, the t-SNARE Vam3p was a necessary vacuolar component. Vid vesicle-vacuole trafficking exhibits characteristics similar to heterotypic membrane fusion events. The key gluconeogenic enzyme fructose-1,6-bisphosphatase (FBPase) is targeted to Vid vesicles when glucose-starved cells are replenished with glucose. Vid vesicles then deliver FBPase to the vacuole for degradation. A modified alkaline phosphatase assay was developed to study the trafficking of Vid vesicles to the vacuole. For this assay, FBPase was fused with a truncated form of alkaline phosphatase. Under in vivo conditions, FBPase-Δ60Pho8p was targeted to the vacuole via Vid vesicles, and it exhibited Pep4p- and Vid24p-dependent alkaline phosphatase activation. Vid vesicle-vacuole targeting was reconstituted using Vid vesicles that contained FBPase-Δ60Pho8p. These vesicles were incubated with vacuoles in the presence of cytosol and an ATP-regenerating system. Under in vitro conditions, alkaline phosphatase was also activated in a Pep4p- and Vid24p-dependent manner. The GTPase Ypt7p was identified as an essential component in Vid vesicle-vacuole trafficking. Likewise, a number of v-SNAREs (Ykt6p, Nyv1p, Vti1p) and homotypic fusion vacuole protein sorting complex family members (Vps39p and Vps41p) were required for the proper function of Vid vesicles. In contrast, the t-SNARE Vam3p was a necessary vacuolar component. Vid vesicle-vacuole trafficking exhibits characteristics similar to heterotypic membrane fusion events. Lysosomal protein degradation is induced when cultured cells are starved of nutrients or serum. This process recycles amino acids and allows for the synthesis of proteins that are crucial for cell survival during starvation. Several mechanisms are responsible for increased lysosomal degradation during starvation (1Dice J.F. Trends Biochem. Sci. 1990; 15: 305-309Abstract Full Text PDF PubMed Scopus (523) Google Scholar, 2Cuervo A.M. Terlecky S.R. Dice J.F. Knecht E. J. Biol. Chem. 1994; 269: 26374-26380Abstract Full Text PDF PubMed Google Scholar, 3Cuervo A.M. Dice J.F. Science. 1996; 273: 501-503Crossref PubMed Scopus (699) Google Scholar, 4Cuervo A.M. Dice J.F. J. Mol. Med. 1998; 76: 6-12Crossref PubMed Google Scholar, 5Liou W. Geuze H.J. Geelen M.J. Slot J.W. J. Cell Biol. 1997; 136: 61-70Crossref PubMed Scopus (223) Google Scholar). The macroautophagy pathway utilizes autophagosomes to deliver cytosolic proteins and organelles to lysosomes for degradation. The chaperone-mediated autophagy pathway targets cytosolic proteins containing a KFERQ motif for degradation. These proteins are recognized by the heat shock protein hsc73 and a lysosomal receptor LGP96 (1Dice J.F. Trends Biochem. Sci. 1990; 15: 305-309Abstract Full Text PDF PubMed Scopus (523) Google Scholar, 6Chiang H.-L. Terlecky S.R. Plant C.P. Dice J.F. Science. 1989; 246: 382-385Crossref PubMed Scopus (703) Google Scholar, 7Hayes S.A. Dice J.F. J. Cell Biol. 1996; 132: 255-258Crossref PubMed Scopus (163) Google Scholar, 8Terlecky S.R. Chiang H.-L. Olson T.S. Dice J.F. J. Biol. Chem. 1992; 267: 9202-9209Abstract Full Text PDF PubMed Google Scholar, 9Terlecky S.R. Dice J.F. J. Biol. Chem. 1993; 268: 23490-23495Abstract Full Text PDF PubMed Google Scholar). Overproduction of LGP96 leads to an increased lysosomal degradation of substrate proteins both in vivo and in vitro (2Cuervo A.M. Terlecky S.R. Dice J.F. Knecht E. J. Biol. Chem. 1994; 269: 26374-26380Abstract Full Text PDF PubMed Google Scholar, 3Cuervo A.M. Dice J.F. Science. 1996; 273: 501-503Crossref PubMed Scopus (699) Google Scholar). Protein degradation by the macroautophagy pathway is also induced when Saccharomyces cerevisiae are starved of nitrogen (10Takeshige K. Baba M. Tsuboi S. Noda T. Ohsumi Y. J. Cell Biol. 1992; 119: 301-311Crossref PubMed Scopus (948) Google Scholar, 11Tsukada M. Ohsumi Y. FEBS Lett. 1993; 333: 169-174Crossref PubMed Scopus (1389) Google Scholar, 12Mizushima N. Noda T. Yoshimori T. Tanaka Y. Ishii T. George M.D. Klionsky D.J. Ohsumi M. Ohsumi Y. Nature. 1998; 395: 395-398Crossref PubMed Scopus (1267) Google Scholar, 13Mizushima N. Noda T. Ohsumi Y. EMBO J. 1999; 18: 3888-3896Crossref PubMed Scopus (338) Google Scholar, 14Noda T. Ohsumi Y. J. Biol. Chem. 1998; 273: 3963-3966Abstract Full Text Full Text PDF PubMed Scopus (1030) Google Scholar, 15Shintani T. Mizushima N. Ogawa Y. Matsuura A. Noda T. Ohsumi Y. EMBO J. 1999; 18: 5234-5241Crossref PubMed Scopus (234) Google Scholar, 16Kirisako T. Baba M. Ishihara N. Miyazawa K. Ohsumi M. Yoshimori T. Noda T. Ohsumi Y. J. Cell Biol. 1999; 147: 435-446Crossref PubMed Scopus (712) Google Scholar). Interestingly, the macroautophagy pathway overlaps with the cytoplasm to vacuole (Cvt) 1The abbreviations used are: Cvt, cytoplasm to vacuole; FBPase, fructose-1,6-bisphosphatase; GTPγS, guanosine 5′-3-O-(thio)triphosphate; HOPS, homotypic fusion vacuole protein sorting; SNARE, soluble NSF attachment protein receptor.1The abbreviations used are: Cvt, cytoplasm to vacuole; FBPase, fructose-1,6-bisphosphatase; GTPγS, guanosine 5′-3-O-(thio)triphosphate; HOPS, homotypic fusion vacuole protein sorting; SNARE, soluble NSF attachment protein receptor. pathway that directs aminopeptidase I from the cytoplasm to the vacuole (17Harding T.M. Hefner-Gravink A. Thumm M. Klionsky D.J. J. Biol. Chem. 1996; 271: 17621-17624Abstract Full Text Full Text PDF PubMed Scopus (216) Google Scholar, 18Scott S.V. Hefner-Gravink A. Morano K.A. Noda T. Ohsumi Y. Klionsky D.J. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 12304-12308Crossref PubMed Scopus (213) Google Scholar, 19Scott S.V. Klionsky D.J. Curr. Opin. Cell Biol. 1998; 10: 523-529Crossref PubMed Scopus (78) Google Scholar, 20Kim J. Dalton V.M. Eggerton K.P. Scott S.V. Klionsky D.J. Mol. Biol. Cell. 1999; 10: 1337-1351Crossref PubMed Scopus (177) Google Scholar, 21Kim J. Klionsky D.J. Annu. Rev. Biochem. 2000; 69: 303-342Crossref PubMed Scopus (320) Google Scholar, 22Klionsky D.J. J. Biol. Chem. 1998; 273: 10807-10810Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar, 23Klionsky D.J. Ohsumi Y. Annu. Rev. Cell Dev. Biol. 1999; 15: 1-3Crossref PubMed Scopus (388) Google Scholar, 24Tanida I. Mizushima N. Kiyooka M. Ohsumi M. Ueno T. Ohsumi Y. Kominami E. Mol. Biol. Cell. 1999; 10: 1367-1379Crossref PubMed Scopus (324) Google Scholar, 25George M.D. Baba M. Scott S.V. Mizushima N. Garrison B.S. Ohsumi Y. Klionsky D.J. Mol. Biol. Cell. 2000; 11: 969-982Crossref PubMed Scopus (75) Google Scholar, 26Abeliovich H. Klionsky D.J. Microbiol. Mol. Biol. Rev. 2001; 65: 463-479Crossref PubMed Scopus (142) Google Scholar). Aminopeptidase I is targeted to the vacuole by Cvt vesicles during growth of cells in rich medium. However, when cells are starved of nitrogen, aminopeptidase I is targeted to the vacuole by an autophagosome-mediated process. The Cvt pathway also shares components with the pexophagy pathway that degrades peroxisomes in response to glucose (27Tuttle D.L. Dunn Jr., W.A. J. Cell Sci. 1995; 108: 25-35Crossref PubMed Google Scholar, 28Hutchins M.U. Veenhuis M. Klionsky D.J. J. Cell Sci. 1999; 112: 4079-4087Crossref PubMed Google Scholar, 29Kim J. Kamada Y. Stromhaug P.E. Guan J. Hefner-Gravink A. Baba M. Scott S.V. Ohsumi Y. Dunn W.A. Klionsky D.J. J. Cell Biol. 2001; 153: 381-396Crossref PubMed Scopus (216) Google Scholar, 30Yuan W. Stromhaug P.E. Dunn Jr., W.A. Mol. Biol. Cell. 1999; 10: 1353-1366Crossref PubMed Scopus (117) Google Scholar). The key gluconeogenic enzyme fructose-1,6-bisphosphatase (FBPase) is degraded rapidly when glucose-starved S. cerevisiae are replenished with fresh glucose (31Chiang H.-L. Schekman R. Nature. 1991; 350: 313-318Crossref PubMed Scopus (131) Google Scholar, 32Chiang H.-L. Schekman R. Hamamoto S. J. Biol. Chem. 1996; 271: 9934-9941Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar, 33Hoffman M. Chiang H.-L. Genetics. 1996; 143: 1555-1566Crossref PubMed Google Scholar, 34Huang P.-H. Chiang H.-L. J. Cell Biol. 1997; 136: 803-810Crossref PubMed Scopus (80) Google Scholar, 35Shieh H.-L. Chiang H.-L. J. Biol. Chem. 1998; 273: 3381-3387Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar). After a glucose shift, FBPase is first targeted into Vid vesicles, and these vesicles then traffic to the vacuole. Vid vesicles appear to be distinct from other types of vesicle (34Huang P.-H. Chiang H.-L. J. Cell Biol. 1997; 136: 803-810Crossref PubMed Scopus (80) Google Scholar). Although the origin of Vid vesicles has not been established, their formation requires the ubiquitin-conjugating enzyme Ubc1p (36Shieh H.-L. Chen Y. Brown C.R. Chiang H.-L. J. Biol. Chem. 2001; 276: 10396-10406Abstract Full Text Full Text PDF Scopus (33) Google Scholar). The import of FBPase into Vid vesicles has been reconstituted utilizing both a semi-intact cellular assay (35Shieh H.-L. Chiang H.-L. J. Biol. Chem. 1998; 273: 3381-3387Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar) and an isolated Vid vesicle assay (37Brown C.R. McCann J.A. Chiang H.-L. J. Cell Biol. 2000; 150: 65-76Crossref PubMed Scopus (62) Google Scholar). Via these approaches, we have identified several proteins that participate in this first trafficking step. These include the molecular chaperone Ssa2p (37Brown C.R. McCann J.A. Chiang H.-L. J. Cell Biol. 2000; 150: 65-76Crossref PubMed Scopus (62) Google Scholar), cyclophilin A (38Brown C.R. Cui D. Hung G. Chiang H.-L. J. Biol. Chem. 2001; 276: 48017-48026Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar), and Vid22p (39Brown C.R. McCann J.A. Hung G. Elco C. Chiang H.-L. J. Cell Sci. 2002; 115: 655-666Crossref PubMed Google Scholar). The molecular mechanisms for the trafficking of Vid vesicle to the vacuole are less well characterized. Although FBPase delivery to the vacuole has been reconstituted in a semi-intact cellular assay, this assay has not allowed us to identify specific molecules involved in the trafficking of Vid vesicles to the vacuole. To address this issue, we have developed an assay to quantitate the Vid vesicle to vacuole trafficking process. FBPase was fused with a form of alkaline phosphatase that lacks the N-terminal 60 amino acids. Under in vivo conditions, the resultant fusion protein was delivered to the vacuole after a glucose shift, and alkaline phosphatase was activated in a Pep4p- and Vid24p-dependent manner. An in vitro Vid vesicle-vacuole assay was developed which reproduces the activation of alkaline phosphatase, and this activation was also dependent on Pep4p and Vid24p. Using this assay, we have identified the small GTPase Ypt7p as being required for Vid vesicle trafficking. Likewise, members of the SNARE and homotypic fusion vacuole protein sorting (HOPS) families of proteins are necessary components in this step of the FBPase trafficking pathway. Yeast Strains, Plasmids, and Antibodies—S. cerevisiae strains used in this study are listed in Table I. Rabbit polyclonal antibodies directed against FBPase, Vid24p, and CPY were raised by Berkeley Antibody Company (Berkeley, CA) using purified proteins. A pho8::TRP1 knockout plasmid and rabbit alkaline phosphatase polyclonal serum were obtained from Dr. D. Klionsky (University of Michigan). A rabbit polyclonal Ypt7p antiserum and the deletion strains Δvam3, Δvam7, Δvps39, Δvps41, and Δypt7 were obtained from Dr. S. Emr (University of California San Diego). Anti-Vti1p antibody and the Δnyv1 deletion strain were obtained from Dr. T. Stevens (University of Oregon). A rabbit polyclonal Ykt6p antiserum was obtained from Dr. W. Wickner (Dartmouth Medical College).Table IYeast strains used in this studyStrainGenotypeHLY223Matα his3-Δ200 ura3-52 leu2, 3-112 lys2Δ800 trp1-1HLY915Matα his3-Δ200 ura3-52 leu2, 3-112 lys2Δ800 trp1-1 fbp1::LEU2 pho8::TRP1HLY921Matα his3-Δ200 ura3-52 leu2, 3-112 lys2Δ800 trp1-1 fbp1::FBP1-Δ60PHO8 pho8::TRP1HLY971Matα his3-Δ200 ura3-52 leu2, 3-112 lys2Δ800 trp1-1 pep4::HIS3 fbp1::LEU2 pho8::TRP1HLY959Matα his3-Δ200 ura3-52 leu2, 3-112 lys2Δ800 trp1-1 pep4::HIS3 fbp1::FBP1-Δ60PHO8 pho8::TRP1HLY897Matα his3-Δ200 ura3-52 leu2, 3-112 lys2Δ800 trp1-1 vid24::HIS3 fbp1::LEU2 pho8::TRP1HLY838Matα his3-Δ200 ura3-52 leu2, 3-112 lys2Δ800 trp1-1 vid24::HIS3 fbp1::FBP1-Δ60PHO8 pho8::TRP1SEY6210Matα his3-Δ200 ura3-52 leu2, 3-112 lys2Δ800 trp1-Δ901WSY99Matα his3-Δ200 ura3-52 leu2, 3-112 lys2Δ800 trp1-Δ901 ypt7::HIS3HLY918Matα his3-Δ200 ura3-52 leu2, 3-112 lys2Δ800 trp1-Δ901 ypt7::HIS3 fbp1::LEU2 pho8::TRP1HLY924Matα his3-Δ200 ura3-52 leu2, 3-112 lys2Δ800 trp1-Δ901 ypt7::HIS3 fbp1::FBP1-Δ60PHO8 pho8::TRP1FYMATα his3Δ200 ura3-52 trp1Δ63Δvid22MATα his3Δ200 ura3-52 trp1Δ63 vid22::kanMX4TN125Matα his3 ura3 leu2 ade2 trp1 pho8::PHO8Δ60Δvid24MATα his3Δ200 ura3-52 leu2,3-112 trp1-1 lys2 vid24::TRP1TDY2Matα his3-Δ200 ura3-52 leu2, 3-112 lys2Δ800 trp1-Δ901 vam3::LEU2HLY899Matα his3-Δ200 ura3-52 leu2, 3-112 lys2Δ800 trp1-Δ901 vam3::LEU2 fbp1::LEU2 pho8::TRP1HLY894Matα his3-Δ200 ura3-52 leu2, 3-112 lys2Δ800 trp1-Δ901 vam3::LEU2 fbp1::FBP1-Δ60PHO8 pho8::TRP1TKSY43Matα his3-Δ200 ura3-52 leu2, 3-112 lys2Δ800 trp1-Δ901 vam7::HIS3HLY919Matα his3-Δ200 ura3-52 leu2, 3-112 lys2Δ800 trp1-Δ901 vam7::HIS3 fbp1::LEU2 pho8::TRP1HLY925Matα his3-Δ200 ura3-52 leu2, 3-112 lys2Δ800 trp1-Δ901 vam7::HIS3 fbp1::FBP1-Δ60PHO8 pho8::TRP1EMY38Matα his3-Δ200 ura3-52 leu2, 3-112 lys2Δ800 trp1-Δ901 vps39::HIS3HLY917Matα his3-Δ200 ura3-52 leu2, 3-112 lys2Δ800 trp1-Δ901 vps39::HIS3 fbp1::LEU2 pho8::TRP1HLY923Matα his3-Δ200 ura3-52 leu2, 3-112 lys2Δ800 trp1-Δ901 vps39::HIS3 fbp1::FBP1-Δ60PHO8 pho8::TRP1WSY41Matα his3-Δ200 ura3-52 leu2, 3-112 lys2Δ800 trp1-Δ901 vps41::LEU2HLY916Matα his3-Δ200 ura3-52 leu2, 3-112 lys2Δ800 trp1-Δ901 vps41::LEU2 pho8::TRP1HLY922Matα his3-Δ200 ura3-52 leu2, 3-112 lys2Δ800 trp1-Δ901 vps41::LEU2 fbp1::FBP1-Δ60PHO8 pho8::TRP1Δnyv-AMatα his3 ura3 leu2 ade2 trp1 nyv1::HIS5HLY951Matα his3-Δ200 ura3-52 leu2, 3-112 lys2Δ800 trp1-Δ901 nyv1::HIS5 fbp1::LEU2 pho8::TRP1HLY960Matα his3-Δ200 ura3-52 leu2, 3-112 lys2Δ800 trp1-Δ901 nyv1::HIS5 fbp1::FBP1-Δ60PHO8 pho8::TRP Open table in a new tab The FBPase-Δ60Pho8p Fusion Protein—To produce Δ60Pho8p, the PHO8 gene was amplified by PCR using a forward primer GCGGCCGCACGTTCTGCATCACACAAG and a reverse primer CCGCGGGTTGGTCAACTCATGGTA. The FBP1 gene was PCR amplified with a forward primer GGTACCATGGGTCCAACTCTAGTAAATGGA and a reverse primer GCGGCCGCCTGTGACTTGCCAATATG. These PCR products were cloned into a pYES2.1 TOPO TA plasmid (Invitrogen), and the orientation of the inserts was confirmed by PCRs. The PHO8 gene was linearized with NotI and XbaI and ligated into NotI and XbaI sites of the FBP1 plasmid. The fusion construct was either transformed into Δfbp1Δpho8 strains or subcloned into an integration vector and integrated into the FBP1 locus. The expression of FBPase-Δ60Pho8p was examined by Western blotting with anti-FBPase antibodies. Similar results were obtained whether the fusion construct was integrated or expressed on a plasmid. The fbp1 deletion construct was produced as described previously (36Shieh H.-L. Chen Y. Brown C.R. Chiang H.-L. J. Biol. Chem. 2001; 276: 10396-10406Abstract Full Text Full Text PDF Scopus (33) Google Scholar). The deletion of fbp1 and pho8 was confirmed by Western blotting with anti-FBPase antibodies and anti-alkaline phosphatase antibodies. To examine the degradation of FBPase-Δ60Pho8p, strains were grown in medium containing low glucose. Cells were shifted to glucose-containing medium for the indicated times, and the levels of FBPase-Δ60Pho8p were determined. To examine the cellular distribution of FBPase-Δ60Pho8p, cell lysates were subjected to differential centrifugation techniques as described previously (37Brown C.R. McCann J.A. Chiang H.-L. J. Cell Biol. 2000; 150: 65-76Crossref PubMed Scopus (62) Google Scholar). Briefly, yeast strains (25 ml) were grown in low glucose medium and then shifted to medium containing 2% glucose for 0 and 60 min at 30 °C. Total lysates were subjected to differential centrifugation conditions of 1,000 × g for 10 min, 13,000 × g for 20 min, and 200,000 × g for 2 h. The 200,000 × g pellet was resuspended in 100 μl of SDS sample buffer, whereas the final 200,000 × g supernatant (S200) was precipitated with 10% trichloroacetic acid, washed three times in ice-cold acetone, and solubilized in 100 μl of SDS sample buffer. Proteins were resolved by SDS-PAGE, and the distribution of FBPase-Δ60Pho8p was determined by Western blotting with anti-FBPase antibodies. Preparation of Vid Vesicles, Vacuoles, and Cytosol—Cells (25 ml) were grown to stationary phase and shifted to glucose for 30 min. Vid vesicles and cytosolic materials were obtained using differential centrifugation techniques described above. The final 200,000 × g pellets (Vid vesicles) and supernatant (cytosol) were aliquoted and frozen at –70 °C until further use. As an additional purification step, the 200,000 × g vesicle-containing material was fractionated further on a 20–50% sucrose density gradient. The location of vesicles within this gradient was verified by electron microscopy. Samples (5 μl) were adsorbed to a Formar-coated grid for 2–3 min. Excess material was blotted away, and the samples were negatively stained with 2% phosphotungstic acid, pH 7.0. The grids were examined using a Phillips TEM400 transmission electron microscope, and micrographs were recorded at a magnification of 46,000. Fractions containing fusion competent vesicles (fractions 3–5) were collected and used in the in vitro assays. Vacuoles were isolated from Δfbp1Δpho8 strains using a protocol described previously (40Vida T. Gerhardt B. J. Cell Biol. 1999; 146: 85-98Crossref PubMed Google Scholar). Cells were subjected to glucose starvation and a 30-min glucose shift. Spheroplasts were washed and resuspended in freezing buffer (1.2 m sorbitol, 5 mm HEPES, pH 6.8, 50 mm KOAc, and 5 mm MgOAc) and then stored at –70 °C. Cells were thawed, washed once in freezing buffer, and then broken via passage through a Millipore 3.0-μm filter. Samples were centrifuged at 1,000 × g for 20 min and then 13,000 × g for 20 min. The resultant 13,000 × g pellet was resuspended in 75 μl of freezing buffer, and this enriched vacuole material was used for the in vitro assay. For homotypic vacuole fusion experiments, vacuoles were also isolated as described previously (41Haas A. Methods Cell Sci. 1995; 17: 283-294Crossref Scopus (99) Google Scholar). Protein concentrations were determined by Bio-Rad Dc protein assays. In Vitro Vid Vesicle-Vacuole Assay—In a typical experiment, the reaction mixture (100 μl) contained 20 μg of vesicle material, 20 μg of vacuolar material, 30 μg of cytosolic proteins, and an ATP-regenerating system (0.5 mm ATP, 0.2 mg/ml creatine phosphokinase, and 40 mm creatine phosphate). The reaction mixture was incubated at 30 °C for 60 min, and the reaction was terminated by a 20-min 13,000 × g centrifugation step at 4 °C. The 13,000 × g pellet was resuspended in 500 μl of alkaline phosphatase assay buffer (250 mm Tris-HCl, pH 9.0, 10 mm MgSO4, and 10 mm ZnSO4) and then examined for alkaline phosphatase activity using 55 mm α-naphthyl phosphate as a substrate. Samples were incubated at 30 °C for 20 min, and the reaction was quenched by the addition of 500 μl of 2 m glycine, pH 11. Alkaline phosphatase activity was measured using a fluorometer (Fluoro IV, Gilford) with an excitation at 345 nm and an emission at 472 nm. Homotypic vacuole fusion experiments were conducted as described previously (41Haas A. Methods Cell Sci. 1995; 17: 283-294Crossref Scopus (99) Google Scholar). For antibody blocking experiments, various amounts (5–10 μl) of polyclonal antibodies were added to the individual vesicle and vacuole components, and these were then incubated for 30 min at 25 °C. To remove unbound antibody, the Vid vesicles were reisolated using the sucrose gradient protocol described above, whereas vacuoles were reisolated by a 20-min 13,000 × g centrifugation procedure. The antibodytreated components were then mixed with other treated or untreated components and tested in the in vitro assay. Statistical Analysis—Statistical significance was determined using one-way analysis of variance followed by a Student-Newman-Keuls test. Data are presented as the mean ± S.E. * indicates mean values that are significantly different from controls at p < 0.05. A Fusion Protein for the Study of Vid Vesicle Trafficking—To identify molecules involved in the trafficking of Vid vesicle to the vacuole, we used an alkaline phosphatase assay that was originally developed by the Wickner laboratory to study homotypic vacuole-vacuole fusion (42Wickner W. Haas A. Annu. Rev. Biochem. 2000; 69: 247-275Crossref PubMed Scopus (171) Google Scholar, 47Nichols B.J. Ungermann C. Pelham H.R. Wickner W.T. Haas A. Nature. 1997; 387: 199-202Crossref PubMed Scopus (379) Google Scholar, 48Price A. Seals D. Wickner W. Ungermann C. J. Cell Biol. 2000; 148: 1231-1238Crossref PubMed Scopus (171) Google Scholar, 49Seals D.F. Eitzen G. Margolis N. Wickner W.T. Price A. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 9402-9407Crossref PubMed Scopus (359) Google Scholar, 50Ungermann C. Sato K. Wickner W. Nature. 1998; 396: 543-548Crossref PubMed Scopus (279) Google Scholar, 51Ungermann C. von Mollard G.F. Jensen O.N. Margolis N. Stevens T.H. Wickner W. J. Cell Biol. 1999; 145: 1435-1442Crossref PubMed Scopus (133) Google Scholar, 52Ungermann C. Price A. Wickner W. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 8889-8891Crossref PubMed Scopus (53) Google Scholar) and modified by the Ohsumi laboratory to study the starvation-induced autophagy pathway (12Mizushima N. Noda T. Yoshimori T. Tanaka Y. Ishii T. George M.D. Klionsky D.J. Ohsumi M. Ohsumi Y. Nature. 1998; 395: 395-398Crossref PubMed Scopus (1267) Google Scholar, 13Mizushima N. Noda T. Ohsumi Y. EMBO J. 1999; 18: 3888-3896Crossref PubMed Scopus (338) Google Scholar, 14Noda T. Ohsumi Y. J. Biol. Chem. 1998; 273: 3963-3966Abstract Full Text Full Text PDF PubMed Scopus (1030) Google Scholar, 15Shintani T. Mizushima N. Ogawa Y. Matsuura A. Noda T. Ohsumi Y. EMBO J. 1999; 18: 5234-5241Crossref PubMed Scopus (234) Google Scholar, 16Kirisako T. Baba M. Ishihara N. Miyazawa K. Ohsumi M. Yoshimori T. Noda T. Ohsumi Y. J. Cell Biol. 1999; 147: 435-446Crossref PubMed Scopus (712) Google Scholar). These assays take advantage of two key characteristics of alkaline phosphatase. First, alkaline phosphatase is translocated into the endoplasmic reticulum and then transported to the Golgi where it is sorted to the vacuole (43Klionsky D.J. Herman P.K. Emr S.D. Microbiol. Rev. 1990; 54: 266-292Crossref PubMed Google Scholar, 44Jones E.W. J. Biol. Chem. 1991; 266: 7963-7966Abstract Full Text PDF PubMed Google Scholar, 45Darsow T. Katzmann D.J. Cowles C.R. Emr S.D. Mol. Biol. Cell. 2001; 12: 37-51Crossref PubMed Scopus (69) Google Scholar, 46Rehling P. Darsow T. Katzmann D.J. Emr S.D. Nat. Cell Biol. 1999; 1: 346-353Crossref PubMed Scopus (97) Google Scholar). Once inside the vacuole, the C-terminal pro sequence of the protein is cleaved by Pep4p, and alkaline phosphatase is activated. Second, endoplasmic reticulum translocation of alkaline phosphatase is dependent upon the N-terminal 60 amino acids of the protein, and if these amino acids are removed, the resulting Δ60Pho8p remains in the cytosol in an inactive state. FBPase was fused with Δ60Pho8p and expressed in a strain in which the endogenous PHO8 gene was deleted. The 100-kDa fusion protein was recognized by both FBPase- and alkaline phosphatase-specific antibodies, but it was not present in untransformed cells (data not shown). In wild type cells, FBPase is degraded rapidly in the vacuole in a Pep4p- and Vid24p-dependent manner after the addition of glucose. Therefore, we first tested whether FBPase-Δ60Pho8p was directed to the vacuole and degraded in a similar manner. FBPase-Δ60Pho8p was induced by glucose starvation, and cells were then shifted to glucose-containing medium for various periods of time. As is shown in Fig. 1A, the addition of glucose to wild type cells resulted in a significant reduction in the levels of FBPase-Δ60Pho8p over time. In contrast, FBPase-Δ60Pho8p remained at high levels in a Δpep4 strain after a glucose shift. The levels of FBPase-Δ60Pho8p also remained high in the Δvid24 strain, a strain that blocks the trafficking of Vid vesicles to the vacuole (53Chiang M.-C. Chiang H.-L. J. Cell Biol. 1998; 140: 1347-1356Crossref PubMed Scopus (66) Google Scholar). Therefore, these results suggest that FBPase-Δ60Pho8p is degraded in a manner similar to the wild type FBPase protein. Our FBPase trafficking model predicts that FBPase-Δ60Pho8p should reside within Vid vesicles prior to its transport to the vacuole. To verify this localization, cells were glucose starved and then subjected to a glucose shift for 0 or 30 min. The distribution of the FBPase-Pho8Δ60p fusion protein in the high speed supernatant (enriched for cytosol) and high speed pellet (enriched for Vid vesicles) was then determined via differential centrifugation and Western blot analysis (Fig. 1B). FBPase-Δ60Pho8p was observed in the high speed supernatant fraction when cells were glucose starved. However, after a 30-min glucose shift, FBPase-Δ60Pho8p was found in the Vid vesicle pellet fraction (Fig. 1B), suggesting that it was transported into Vid vesicles. To examine whether FBPase-Δ60Pho8p is imported into a membrane bound organelle, lysates were treated with 0.8 mg/ml proteinase K for 15 min in the presence or absence of 2% Triton X-100. Proteinase K was inactivated via the addition of 1 ml of 15% w/v trichloroacetic acid, and trichloroacetic acid precipitants were examined for the presence of FBPase-Δ60Pho8p. FBPase-Δ60Pho8p was sensitive to proteinase K digestion when total cell lysates were obtained from cells that were glucose-starved (Fig. 1C). However, FBPase-Δ60Pho8p was resistant to proteinase K digestion when cells were shifted to glucose for 30 min. FBPase-Δ60Pho8p was imported into the lumen of a membrane-bound organelle because FBPase-Δ60Pho8p was degraded by proteinase K when cell lysates were treated with Triton X-100. If the FBPase-Δ60Pho8p fusion protein behaves in a manner similar to FBPase, it should remain in the cytosol during periods of glucose starvation and not exhibit alkaline phosphatase activity. However, after the addition of fresh glucose, FBPase-Δ60Pho8p should be targeted to the vacuole, and alkaline phosphatase should be activated by Pep4p. Wild type, Δpep4, and Δvid24 strains were transformed to express FBPase-Δ60Pho8p. These strains were shifted to glucose, and the activation of alkaline phosphatase was measured (Fig. 1D). When wild type cells were maintained in low glucose medium, alkaline phosphatase was not activated. However, when these cells were shifted to glucose-containing medium for 3 h, alkaline phosphatase activity increased. Therefore, FBPase was able to direct Δ60Pho8p to the vacuole where it was enzymatically activated. In contrast, alkaline phosphatase activity was low when either the Δpep4 or Δvid24 strain was shifted to glucose for 3 h. These results further confirm that FBPase-Δ60Pho8p is targeted to the vacuole by the Vid vesicle-mediated pathway. Autophagic processes often result in the nonselective transport of cytosolic proteins to the vacuole for degradation (23Klionsky D.J. Ohsumi Y. Annu. Rev. Cell Dev. Biol. 1999; 15: 1-3Crossref PubMed Scopus (388) Google Scholar). To determine whether FBPase-Δ60Pho8p could be targeted to vacuoles via the autophagy pathway, we subjected cells to a period of nitrogen starvation and then examined for the activation of alkaline phosphatase. A wild type strain expressing Δ60Pho8p was used as a control because Δ60Pho8p is targeted to the vacuole via the autophagy pathway after nitrogen starvation (13Mizushima N. Noda T. Ohsumi Y. EMBO J. 1999; 18: 3888-3896Crossref PubMed Scopus (338) Google Scholar, 15Shintani T. Mizushima N. Ogawa Y. Matsuura A. Noda T. Ohsumi Y. EMBO J. 1999; 18: 5234-5241Crossref PubMed Scopus (234) Google Scholar). As expected, low levels of alkaline phosphatase activity were observed when the Δ60Pho8p strain was grown under normal conditions. However, a high level of alkaline phosphatase activity was observed when these same cells were subjected to nitrogen starvation (Fig. 1E). In contrast, when FBPase was fused with Δ60Pho8p, alkaline phosphatase activity was low either before or after nitrogen starvation. Therefore, it appears that the FBPase-Δ60Pho8p fusion protein is targeted to the vacuole via the Vid-dependent pathway, but not via the autophagy pathway. Development of an In Vitro Assay—Alkaline phosphatase activity h" @default.
• W2158644807 created "2016-06-24" @default.
• W2158644807 creator A5005536359 @default.
• W2158644807 creator A5007445917 @default.
• W2158644807 creator A5030653726 @default.
• W2158644807 creator A5034975820 @default.
• W2158644807 creator A5077322975 @default.
• W2158644807 creator A5077485367 @default.
• W2158644807 date "2003-07-01" @default.
• W2158644807 modified "2023-09-26" @default.
• W2158644807 title "The Vid Vesicle to Vacuole Trafficking Event Requires Components of the SNARE Membrane Fusion Machinery" @default.
• W2158644807 cites W1502422391 @default.
• W2158644807 cites W1517182987 @default.
• W2158644807 cites W1520187505 @default.
• W2158644807 cites W1526993239 @default.
• W2158644807 cites W1537517521 @default.
• W2158644807 cites W1539881139 @default.
• W2158644807 cites W1544228065 @default.
• W2158644807 cites W1558697766 @default.
• W2158644807 cites W1585867849 @default.
• W2158644807 cites W1598680533 @default.
• W2158644807 cites W1657935059 @default.
• W2158644807 cites W1772777894 @default.
• W2158644807 cites W1968322176 @default.
• W2158644807 cites W1973130575 @default.
• W2158644807 cites W1974858639 @default.
• W2158644807 cites W1985482115 @default.
• W2158644807 cites W1999553050 @default.
• W2158644807 cites W2010766189 @default.
• W2158644807 cites W2011580247 @default.
• W2158644807 cites W2013944211 @default.
• W2158644807 cites W2014177248 @default.
• W2158644807 cites W2014703631 @default.
• W2158644807 cites W2015503148 @default.
• W2158644807 cites W2019897261 @default.
• W2158644807 cites W2022964430 @default.
• W2158644807 cites W2029758696 @default.
• W2158644807 cites W2030468686 @default.
• W2158644807 cites W2039438770 @default.
• W2158644807 cites W2040649045 @default.
• W2158644807 cites W2040792888 @default.
• W2158644807 cites W2045466386 @default.
• W2158644807 cites W2056026047 @default.
• W2158644807 cites W2057764483 @default.
• W2158644807 cites W2060941673 @default.
• W2158644807 cites W2069789629 @default.
• W2158644807 cites W2070593103 @default.
• W2158644807 cites W2071094219 @default.
• W2158644807 cites W2071651805 @default.
• W2158644807 cites W2078917390 @default.
• W2158644807 cites W2095263179 @default.
• W2158644807 cites W2095347614 @default.
• W2158644807 cites W2096054930 @default.
• W2158644807 cites W2097630079 @default.
• W2158644807 cites W2104845358 @default.
• W2158644807 cites W2108157396 @default.
• W2158644807 cites W2108305274 @default.
• W2158644807 cites W2125452667 @default.
• W2158644807 cites W2125561686 @default.
• W2158644807 cites W2126003136 @default.
• W2158644807 cites W2126801593 @default.
• W2158644807 cites W2129309643 @default.
• W2158644807 cites W2133830708 @default.
• W2158644807 cites W2134348354 @default.
• W2158644807 cites W2135954438 @default.
• W2158644807 cites W2137339435 @default.
• W2158644807 cites W2137434813 @default.
• W2158644807 cites W2137690550 @default.
• W2158644807 cites W2138871985 @default.
• W2158644807 cites W2141488468 @default.
• W2158644807 cites W2141781497 @default.
• W2158644807 cites W2141854133 @default.
• W2158644807 cites W2143358143 @default.
• W2158644807 cites W2143776452 @default.
• W2158644807 cites W2154834069 @default.
• W2158644807 cites W2158501357 @default.
• W2158644807 cites W2159424335 @default.
• W2158644807 cites W2164345143 @default.
• W2158644807 cites W2168427881 @default.
• W2158644807 cites W4239776692 @default.
• W2158644807 doi "https://doi.org/10.1074/jbc.m210549200" @default.
• W2158644807 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12730205" @default.
• W2158644807 hasPublicationYear "2003" @default.
• W2158644807 type Work @default.
• W2158644807 sameAs 2158644807 @default.
• W2158644807 citedByCount "22" @default.
• W2158644807 countsByYear W21586448072012 @default.
• W2158644807 countsByYear W21586448072013 @default.
• W2158644807 countsByYear W21586448072014 @default.
• W2158644807 countsByYear W21586448072017 @default.
• W2158644807 countsByYear W21586448072019 @default.
• W2158644807 countsByYear W21586448072020 @default.
• W2158644807 crossrefType "journal-article" @default.
• W2158644807 hasAuthorship W2158644807A5005536359 @default.
• W2158644807 hasAuthorship W2158644807A5007445917 @default.
• W2158644807 hasAuthorship W2158644807A5030653726 @default.
• W2158644807 hasAuthorship W2158644807A5034975820 @default.
• W2158644807 hasAuthorship W2158644807A5077322975 @default.

• next