FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2159133430> ?p ?o ?g. }

• W2159133430 endingPage "30834" @default.
• W2159133430 startingPage "30828" @default.
• W2159133430 abstract "T cell factor (Tcf) proteins bind β-catenin and are downstream effectors of Wnt/β-catenin signals. A recently demonstrated interaction between β-catenin and the androgen receptor (AR) ligand binding domain has suggested that AR may be a Tcf-independent Wnt/β-catenin effector. This study demonstrates that there is a direct interaction between the AR DNA binding domain (DBD) and Tcf4. Tcf4 bound specifically to a glutathione S-transferase-ARDBD fusion protein and could be coimmunoprecipitated with β-catenin and transfected AR or endogenous AR in prostate cancer cells. Transfected Tcf4 repressed the transcriptional activity of full-length AR and a VP16-ARDBD fusion protein, and this repression was only partially reversed by transfected β-catenin. AR activation by cyproterone acetate, a partial agonist that did not support β-catenin binding to the AR, was also repressed by Tcf4, further indicating that repression was not due to β-catenin sequestration. Tcf4 could recruit β-catenin to the AR DBD in vitro and to the cyproterone acetate-liganded AR in vivo. Chromatin immunoprecipitation experiments in LNCaP prostate cancer cells showed that endogenous AR was bound to a Tcf4-responsive element in the c-myc promoter. These findings indicate that AR and Tcf4 can interact directly and that this interaction may occur on the promoters or enhancers of particular genes. The direct AR-Tcf4 interaction, in conjunction AR- and Tcf4-β-catenin binding, provides a mechanism for cooperative and selective gene regulation by AR and the Wnt/β-catenin-Tcf pathway that may contribute to normal and neoplastic prostate growth. T cell factor (Tcf) proteins bind β-catenin and are downstream effectors of Wnt/β-catenin signals. A recently demonstrated interaction between β-catenin and the androgen receptor (AR) ligand binding domain has suggested that AR may be a Tcf-independent Wnt/β-catenin effector. This study demonstrates that there is a direct interaction between the AR DNA binding domain (DBD) and Tcf4. Tcf4 bound specifically to a glutathione S-transferase-ARDBD fusion protein and could be coimmunoprecipitated with β-catenin and transfected AR or endogenous AR in prostate cancer cells. Transfected Tcf4 repressed the transcriptional activity of full-length AR and a VP16-ARDBD fusion protein, and this repression was only partially reversed by transfected β-catenin. AR activation by cyproterone acetate, a partial agonist that did not support β-catenin binding to the AR, was also repressed by Tcf4, further indicating that repression was not due to β-catenin sequestration. Tcf4 could recruit β-catenin to the AR DBD in vitro and to the cyproterone acetate-liganded AR in vivo. Chromatin immunoprecipitation experiments in LNCaP prostate cancer cells showed that endogenous AR was bound to a Tcf4-responsive element in the c-myc promoter. These findings indicate that AR and Tcf4 can interact directly and that this interaction may occur on the promoters or enhancers of particular genes. The direct AR-Tcf4 interaction, in conjunction AR- and Tcf4-β-catenin binding, provides a mechanism for cooperative and selective gene regulation by AR and the Wnt/β-catenin-Tcf pathway that may contribute to normal and neoplastic prostate growth. The androgen receptor (AR) 1The abbreviations used are: AR, androgen receptor; DBD, DNA binding domain; LBD, ligand binding domain; ARE, androgen-responsive element; HMG, high mobility group; Tcf4, T cell factor 4; TLE, transducin-like enhancers of split; ER, estrogen receptor; GST, glutathione S-transferase; DHT, dihydrotestosterone; CPA, cyproterone acetate; CS-FCS, charcoal-dextran-stripped fetal calf serum; NRS, nonimmune rabbit serum; ERE, estrogen-responsive element; DMEM, Dulbecco's modified Eagle's medium; PBS, phosphate-buffered saline; CMV, cytomegalovirus. is a steroid hormone receptor member of the larger nuclear receptor superfamily and plays a central role in normal male development and prostate cancer (1Quigley C.A. De Bellis A. Marschke K.B. el Awady M.K. Wilson E.M. French F.S. Endocr. Rev. 1995; 16: 271-321Crossref PubMed Google Scholar, 2Brinkmann A.O. Blok L.J. de Ruiter P.E. Doesburg P. Steketee K. Berrevoets C.A. Trapman J. J. Steroid Biochem. Mol. Biol. 1999; 69: 307-313Crossref PubMed Scopus (257) Google Scholar). It contains a highly conserved central DNA binding domain (DBD), a C-terminal ligand binding domain (LBD), and a large N-terminal transactivation domain. AR activation by androgen binding causes a conformational change that enhances nuclear localization, homodimerization, and binding to specific sequences (androgen-responsive elements, AREs) located in androgen-regulated genes. The androgen-induced conformational change in the AR LBD also generates a binding site for a short hydrophobic motif (Leu-X-X-Leu-Leu or LXXLL) found in many transcriptional coactivator proteins, although the AR N terminus contains an LXXLL-like sequence that binds strongly to the liganded LBD and may compete for binding with other LXXLL-containing coactivators (3He B. Kemppainen J.A. Wilson E.M. J. Biol. Chem. 2000; 275: 22986-22994Abstract Full Text Full Text PDF PubMed Scopus (364) Google Scholar). Similarly to other steroid hormone and nuclear receptors, protein-protein interactions involving one or more domains of the AR mediate the recruitment of multiple transcription factors, with subsequent chromatin remodeling and transcription of androgen regulated genes (4McKenna N.J. Lanz R.B. O'Malley B.W. Endocr. Rev. 1999; 20: 321-344Crossref PubMed Scopus (1655) Google Scholar). The binding of AR and other steroid hormone receptors to DNA can be enhanced by HMG-1 and HMG-2, related nonsequence-specific DNA binding proteins characterized by a high mobility group (HMG) box DBD (5Onate S.A. Prendergast P. Wagner J.P. Nissen M. Reeves R. Pettijohn D.E. Edwards D.P. Mol. Cell. Biol. 1994; 14: 3376-3391Crossref PubMed Google Scholar, 6Verrier C.S. Roodi N. Yee C.J. Bailey L.R. Jensen R.A. Bustin M. Parl F.F. Mol. Endocrinol. 1997; 11: 1009-1019Crossref PubMed Scopus (71) Google Scholar, 7Romine L.E. Wood J.R. Lamia L.A. Prendergast P. Edwards D.P. Nardulli A.M. Mol. Endocrinol. 1998; 12: 664-674Crossref PubMed Scopus (53) Google Scholar, 8Boonyaratanakornkit V. Melvin V. Prendergast P. Altmann M. Ronfani L. Bianchi M.E. Taraseviciene L. Nordeen S.K. Allegretto E.A. Edwards D.P. Mol. Cell. Biol. 1998; 18: 4471-4487Crossref PubMed Scopus (304) Google Scholar, 9Zhang C.C. Krieg S. Shapiro D.J. Mol. Endocrinol. 1999; 13: 632-643Crossref PubMed Google Scholar, 10Melvin V.S. Edwards D.P. Steroids. 1999; 64: 576-586Crossref PubMed Scopus (71) Google Scholar). HMG box-containing proteins have an architectural function based on the ability of the HMG box to bind to the minor groove of the DNA helix and induce a sharp bend. This change in local DNA structure appears to be the major factor responsible for HMG-1 and -2 stabilization of steroid hormone receptor binding to DNA, although weak protein-protein interactions may also play a role. We recently demonstrated an interaction between the AR and the sequence-specific HMG box transcription factor SRY, the Y-chromosome encoded protein required for male sex determination and founding member of the SOX family of HMG proteins (11Yuan X. Lu M.L. Li T. Balk S.P. J. Biol. Chem. 2001; 276: 46647-46654Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar). The AR-SRY interaction was direct and mediated by the AR DBD and the HMG domain of SRY. Based on this finding, we have investigated whether the AR can interact directly with other HMG proteins. This study demonstrates such an interaction between the AR and T cell factor 4 (Tcf4), a member of the Tcf/Lef (T cell factor/lymphoid enhancer factor) family that is expressed in multiple tissues, including colon, breast, and prostate (12Korinek V. Barker N. Moerer P. van Donselaar E. Huls G. Peters P.J. Clevers H. Nat. Genet. 1998; 19: 379-383Crossref PubMed Scopus (1325) Google Scholar, 13Barker N. Huls G. Korinek V. Clevers H. Am. J. Pathol. 1999; 154: 29-35Abstract Full Text Full Text PDF PubMed Scopus (138) Google Scholar, 14Duval A. Rolland S. Tubacher E. Bui H. Thomas G. Hamelin R. Cancer Res. 2000; 60: 3872-3879PubMed Google Scholar, 15Brantjes H. Roose J. van de W.M. Clevers H. Nucleic Acids Res. 2001; 29: 1410-1419Crossref PubMed Scopus (318) Google Scholar, 16Chesire D.R. Ewing C.M. Gage W.R. Isaacs W.B. Oncogene. 2002; 21: 2679-2694Crossref PubMed Scopus (149) Google Scholar, 17Hurlstone A. Clevers H. EMBO J. 2002; 21: 2303-2311Crossref PubMed Scopus (194) Google Scholar). Tcf4 and the other human Tcf proteins (Tcf1, Tcf2/Lef1, and Tcf3) are sequence-specific HMG box transcription factors that function as the downstream effectors of Wnt/β-catenin signals (17Hurlstone A. Clevers H. EMBO J. 2002; 21: 2303-2311Crossref PubMed Scopus (194) Google Scholar, 18Giese K. Cox J. Grosschedl R. Cell. 1992; 69: 185-195Abstract Full Text PDF PubMed Scopus (558) Google Scholar, 19Behrens J. von Kries J.P. Kuhl M. Bruhn L. Wedlich D. Grosschedl R. Birchmeier W. Nature. 1996; 382: 638-642Crossref PubMed Scopus (2595) Google Scholar, 20Molenaar M. van de W.M. Oosterwegel M. Peterson-Maduro J. Godsave S. Korinek V. Roose J. Destree O. Clevers H. Cell. 1996; 86: 391-399Abstract Full Text Full Text PDF PubMed Scopus (1619) Google Scholar, 21Huber O. Korn R. McLaughlin J. Ohsugi M. Herrmann B.G. Kemler R. Mech. Dev. 1996; 59: 3-10Crossref PubMed Scopus (782) Google Scholar, 22Korinek V. Barker N. Morin P.J. van Wichen D. de Weger R. Kinzler K.W. Vogelstein B. Clevers H. Science. 1997; 275: 1784-1787Crossref PubMed Scopus (2937) Google Scholar, 23Morin P.J. Sparks A.B. Korinek V. Barker N. Clevers H. Vogelstein B. Kinzler K.W. Science. 1997; 275: 1787-1790Crossref PubMed Scopus (3505) Google Scholar, 24van de W.M. Cavallo R. Dooijes D. van Beest M. van Es J. Loureiro J. Ypma A. Hursh D. Jones T. Bejsovec A. Peifer M. Mortin M. Clevers H. Cell. 1997; 88: 789-799Abstract Full Text Full Text PDF PubMed Scopus (1062) Google Scholar, 25Brunner E. Peter O. Schweizer L. Basler K. Nature. 1997; 385: 829-833Crossref PubMed Scopus (447) Google Scholar). In the absence of nuclear β-catenin, the Tcf proteins strongly repress transcription through binding of the Groucho family of transcriptional corepressors (in humans termed transducin-like enhancers of split, TLE) (15Brantjes H. Roose J. van de W.M. Clevers H. Nucleic Acids Res. 2001; 29: 1410-1419Crossref PubMed Scopus (318) Google Scholar, 26Stifani S. Blaumueller C.M. Redhead N.J. Hill R.E. Artavanis-Tsakonas S. Nat. Genet. 1992; 2: 119-127Crossref PubMed Scopus (262) Google Scholar, 27Roose J. Molenaar M. Peterson J. Hurenkamp J. Brantjes H. Moerer P. van de W.M. Destree O. Clevers H. Nature. 1998; 395: 608-612Crossref PubMed Scopus (576) Google Scholar, 28Cavallo R.A. Cox R.T. Moline M.M. Roose J. Polevoy G.A. Clevers H. Peifer M. Bejsovec A. Nature. 1998; 395: 604-608Crossref PubMed Scopus (602) Google Scholar, 29Levanon D. Goldstein R.E. Bernstein Y. Tang H. Goldenberg D. Stifani S. Paroush Z. Groner Y. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 11590-11595Crossref PubMed Scopus (410) Google Scholar). Binding is mediated by a conserved N-terminal glutamine-rich region in the Groucho/TLE proteins and a region between the N-terminal β-catenin binding site and HMG box in the Tcf proteins. Stabilization of β-catenin by Wnt or other signals results in its nuclear accumulation and Tcf binding, mediated by sites in the Tcf N terminus and β-catenin Armadillo repeats (30Rubinfeld B. Albert I. Porfiri E. Fiol C. Munemitsu S. Polakis P. Science. 1996; 272: 1023-1026Crossref PubMed Scopus (1301) Google Scholar, 31Graham T.A. Weaver C. Mao F. Kimelman D. Xu W. Cell. 2000; 103: 885-896Abstract Full Text Full Text PDF PubMed Scopus (344) Google Scholar, 32Poy F. Lepourcelet M. Shivdasani R.A. Eck M.J. Nat. Struct. Biol. 2001; 8: 1053-1057Crossref PubMed Scopus (157) Google Scholar). β-Catenin then serves to stimulate Tcf transcriptional activity by recruiting multiple coactivator proteins such as CBP/p300, Brg1, and CARM1 (24van de W.M. Cavallo R. Dooijes D. van Beest M. van Es J. Loureiro J. Ypma A. Hursh D. Jones T. Bejsovec A. Peifer M. Mortin M. Clevers H. Cell. 1997; 88: 789-799Abstract Full Text Full Text PDF PubMed Scopus (1062) Google Scholar, 33Hecht A. Grunstein M. Methods Enzymol. 1999; 304: 399-414Crossref PubMed Scopus (151) Google Scholar, 34Hecht A. Vleminckx K. Stemmler M.P. van Roy F. Kemler R. EMBO J. 2000; 19: 1839-1850Crossref PubMed Google Scholar, 35Miyagishi M. Fujii R. Hatta M. Yoshida E. Araya N. Nagafuchi A. Ishihara S. Nakajima T. Fukamizu A. J. Biol. Chem. 2000; 275: 35170-35175Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar, 36Takemaru K.I. Moon R.T. J. Cell Biol. 2000; 149: 249-254Crossref PubMed Scopus (405) Google Scholar, 37Barker N. Hurlstone A. Musisi H. Miles A. Bienz M. Clevers H. EMBO J. 2001; 20: 4935-4943Crossref PubMed Scopus (366) Google Scholar, 38Koh S.S. Li H. Lee Y.H. Widelitz R.B. Chuong C.M. Stallcup M.R. J. Biol. Chem. 2002; 277: 26031-26035Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar). Inappropriate stabilization of β-catenin through a number of mechanisms has been observed in many cancers, with decreased β-catenin degradation due to adenomatous polyposis coli loss being a cause of familial colon cancer (22Korinek V. Barker N. Morin P.J. van Wichen D. de Weger R. Kinzler K.W. Vogelstein B. Clevers H. Science. 1997; 275: 1784-1787Crossref PubMed Scopus (2937) Google Scholar, 23Morin P.J. Sparks A.B. Korinek V. Barker N. Clevers H. Vogelstein B. Kinzler K.W. Science. 1997; 275: 1787-1790Crossref PubMed Scopus (3505) Google Scholar). Recent reports have shown that β-catenin can bind to the AR LBD and function as an AR coactivator protein (16Chesire D.R. Ewing C.M. Gage W.R. Isaacs W.B. Oncogene. 2002; 21: 2679-2694Crossref PubMed Scopus (149) Google Scholar, 39Truica C.I. Byers S. Gelmann E.P. Cancer Res. 2000; 60: 4709-4713PubMed Google Scholar, 40Yang F. Li X. Sharma M. Sasaki C.Y. Longo D.L. Lim B. Sun Z. J. Biol. Chem. 2002; 277: 11336-11344Abstract Full Text Full Text PDF PubMed Scopus (297) Google Scholar, 41Mulholland D.J. Cheng H. Reid K. Rennie P.S. Nelson C.C. J. Biol. Chem. 2002; 277: 17933-17943Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar, 42Pawlowski J.E. Ertel J.R. Allen M.P. Xu M. Butler C. Wilson E.M. Wierman M.E. J. Biol. Chem. 2002; 277: 20702-20710Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar, 43Chesire D.R. Isaacs W.B. Oncogene. 2002; 21: 8453-8469Crossref PubMed Scopus (133) Google Scholar, 44Song L.N. Herrell R. Byers S. Shah S. Wilson E.M. Gelmann E.P. Mol. Cell. Biol. 2003; 23: 1674-1687Crossref PubMed Scopus (144) Google Scholar). Direct interactions have also been described between β-catenin and retinoic acid and vitamin D receptors (45Easwaran V. Pishvaian M. Salimuddin Byers S. Curr. Biol. 1999; 9: 1415-1418Abstract Full Text Full Text PDF PubMed Google Scholar, 46Palmer H.G. Gonzalez-Sancho J.M. Espada J. Berciano M.T. Puig I. Baulida J. Quintanilla M. Cano A. de Herreros A.G. Lafarga M. Munoz A. J. Cell Biol. 2001; 154: 369-387Crossref PubMed Scopus (697) Google Scholar). These findings have suggested that AR and other nuclear receptors may be Tcf-independent effectors of Wnt/β-catenin signaling pathways and may indirectly antagonize Tcf activity by competing for nuclear β-catenin. This study demonstrates a direct (β-catenin-independent) interaction between Tcf4 and the AR mediated by the AR DBD, indicating a role for Tcf4 in Wnt/β-catenin signaling through the AR. A cooperative binding interaction between AR and Tcf4 on the regulatory elements of particular genes is a mechanism by which Wnt/β-catenin signals may selectively stimulate expression of a subset of AR-regulated genes during male development and in prostate cancer. Plasmids and Reagents—A human AR expression vector, pSVARo, was from A. Brinkmann (47Brinkmann A.O. Faber P.W. van Rooij H.C. Kuiper G.G. Ris C. Klaassen P. van der Korput J.A. Voorhorst M.M. van Laar J.H. Mulder E. J. Steroid Biochem. 1989; 34: 307-310Crossref PubMed Scopus (279) Google Scholar). VP16-ARDBD-(501–660) generated in the pACT vector (Promega, Madison, WI) and the ARE-regulated firefly luciferase reporter genes (ARE4-Luc, PSA7kb-Luc, and MMTV-Luc) generated in the pGL3 vector were described previously (11Yuan X. Lu M.L. Li T. Balk S.P. J. Biol. Chem. 2001; 276: 46647-46654Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar). An estrogen receptor α (ERα) expression vector (pcDNA3.1-ERα) and estrogen-responsive element (ERE)-regulated luciferase reporter (ERE2-Luc) were from M. Brown (Dana Farber Cancer Institute, Boston, MA). A human Tcf4 expression vector (pCMV-Tcf4, 597 amino acids) was from S. Sokol (Beth Israel Deaconess, Boston, MA) (22Korinek V. Barker N. Morin P.J. van Wichen D. de Weger R. Kinzler K.W. Vogelstein B. Clevers H. Science. 1997; 275: 1784-1787Crossref PubMed Scopus (2937) Google Scholar), and β-catenin was from H. Clevers (University Medical Center, Utrecht). Vectors encoding Renilla luciferase (pRL-CMV) and βgalactosidase (pSV-β-galactosidase) were from Promega. GST-ARDBD-(556–628) and GST-AR-(634–668) were generated by inserting a PCR-amplified fragment of AR in pGEX-2TK (Amersham Biosciences). The corresponding GST fusion proteins were purified using glutathione-agarose beads (Amersham Biosciences). Mouse anti-Tcf4 monoclonal antibodies (clone 6H5-3 specific for Tcf4 and clone 6F12-3 recognizing Tcf3 and -4) were from Upstate Biotechnology (Lake Placid, NY) and were used in combination for immunoblotting. Rabbit anti-AR antibodies generated against an N-terminal peptide (N-20) were from Santa Cruz Biotechnology (Santa Cruz, CA) or Upstate Biotechnology (immunoaffinity-purified PG-21). The mouse anti-β-catenin monoclonal antibody (clone 14) was from BD Biosciences Transduction Laboratories (Lexington, KY). Hormones were from Sigma and were diluted from 1000× stocks in ethanol. Transient Transfections and Reporter Gene Assays—CV1 cells were cultured in 24-well plates in DMEM with 5% FCS (HyClone, Logan, UT) to ∼80% confluence. Plasmid DNA and 2 μl of LipofectAMINE 2000 (Invitrogen) were combined in a final volume of 100 μl of OPTI-MEM for 30 min at room temperature, then mixed with 0.5 ml of DMEM with 10% steroid hormone-depleted FCS (charcoal-dextran-stripped FCS, CS-FCS) (HyClone), and added to each culture well. After 24 h the medium was replaced with 0.5 ml of DMEM/10% CS-FCS, with or without hormones as indicated. After another 24 h, the cells were rinsed with PBS, lysed with 100 μl of passive lysis buffer, and assayed for luciferase activities using a Dual-Luciferase reporter assay (Promega). The firefly luciferase results were divided by the control Renilla luciferase to give relative light units, and the results reflect the mean and standard deviation from triplicate samples. GST Fusion Protein Binding Assays—Equivalent amounts (5 μg) of GST or GST fusion proteins and 35S-labeled proteins generated by in vitro transcription/translation (TnT T7 or SP6 Quick Coupled Transcription/Translation System, Promega) were mixed in 0.2 ml of binding buffer (PBS, pH 7.4, 1 mm dithiothreitol, 1 mg/ml bovine serum albumin, 0.05% Triton X-100, and protease inhibitors) for 2 h at 4 °C. Beads were washed three times in binding buffer, once in PBS, eluted with SDS-PAGE sample buffer, and run on 10% SDS-PAGE gels under reducing conditions. Coimmunoprecipitations—CV1 or 293T cells grown in 10-cm plates to 80–90% confluence were transfected with 6 μg each of AR and Tcf4 plasmids. DNA in 0.75 ml of OPTI-MEM was mixed with 40 μl of LipofectAMINE 2000 in 0.75 ml of OPTI-MEM as above, and the 1.5 ml of mix was added to cells in 10 ml of DMEM/10% FCS with no antibiotics. After 24 h, the medium was replaced with DMEM/10% FCS or CS-FCS with added hormones as indicated. After another 24 h, cells from each plate were washed with cold PBS, scraped into 1.5 ml of immunoprecipitation buffer (PBS, pH 7.4, 10% glycerol, .05% Triton X-100, and protease inhibitors), and briefly sonicated, and debris was removed by centrifugation for 10 min at 12,000 × g. Lysates were precleared for 15 min using 2 μl of normal rabbit serum that was pre-absorbed to 20 μl of protein A-Sepharose beads. Lysates were then split, mixed with 5 μl of protein A-Sepharose beads and 1 μg of anti-AR (Santa Cruz N-20) or control normal rabbit serum (1 μg of IgG), and rotated for 2 h at 4 °C. The beads were then washed three times in immunoprecipitation buffer, washed once in PBS, eluted in SDS-PAGE sample buffer, and run on 10% SDS-PAGE gels under reducing conditions. LNCaP cells (obtained from the ATCC) were grown in RPMI 1640 with 10% FCS and 10 nm DHT. The LAPC4 prostate cancer cell line (kindly provided by C. Sawyers, University of California at Los Angeles, CA) (48Klein K.A. Reiter R.E. Redula J. Moradi H. Zhu X.L. Brothman A.R. Lamb D.J. Marcelli M. Belldegrun A. Witte O.N. Sawyers C.L. Nat. Med. 1997; 3: 402-408Crossref PubMed Scopus (339) Google Scholar) was grown in Iscove's modified Dulbecco's medium with 10% FCS and 10 nm DHT. Coimmunoprecipitations were carried out under the same conditions as above, or in an alternative buffer containing 0.5% Triton X-100 and no glycerol where indicated. Proteins were transferred to nitrocellulose and detected by immunoblotting with the indicated antibodies (1:1000 dilutions incubated overnight at 4 °C), followed by horseradish peroxidase-conjugated anti-mouse or rabbit Ig secondaries (Promega) and ECL (Amersham Biosciences). Chromatin Immunoprecipitation—Plates (10 cm) containing LNCaP cells were cultured for 2 days in RPMI 1640/10% FCS and then 2 days in RPMI-1640/10% CS-FCS, followed by pulsing with DHT (10 nm). Plates were then rinsed with PBS and fixed for 10 min at room temperature with 1% formaldehyde in PBS. After chromatin extraction, shearing, and preclearing steps as described previously (49Masiello D. Cheng S. Bubley G.J. Lu M.L. Balk S.P. J. Biol. Chem. 2002; 277: 26321-26326Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholar), samples were split and immunoprecipitated with 500 ng of affinity-purified rabbit anti-AR or control (rabbit anti-PDGF receptor) antibodies (Upstate Biotechnology). The conditions for immunoprecipitations, cross-link reversal, DNA purification, and PCR amplification (using 10% of the sample for each reaction) were as described previously (49Masiello D. Cheng S. Bubley G.J. Lu M.L. Balk S.P. J. Biol. Chem. 2002; 277: 26321-26326Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholar). Primers flanking Tcf4 binding element 1 in the c-myc promoter (CCTTTGATT at –1001 from the initiation ATG) (50He T.C. Sparks A.B. Rago C. Hermeking H. Zawel L. da Costa L.T. Morin P.J. Vogelstein B. Kinzler K.W. Science. 1998; 281: 1509-1512Crossref PubMed Scopus (4084) Google Scholar) were GCTCTCCACTTGCCCCTTTTA (forward) and GTTCCCAATTTCTCAGCC (reverse). Primers flanking the major PSA gene enhancer were TGAGAAACCTGAGATTAGGA and ATCTCTCTCAGATCCAGGCT, and control primers were in the CD1d gene (49Masiello D. Cheng S. Bubley G.J. Lu M.L. Balk S.P. J. Biol. Chem. 2002; 277: 26321-26326Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholar). PCR amplifications were carried out for 30 cycles, and input reflected 5% of the chromatin samples used for the immunoprecipitations. AR Binds Directly to Tcf4 —Previous data demonstrating a protein-protein interaction between AR and SRY that was mediated by their respective zinc finger and HMG box DNA binding domains suggested that AR might interact directly with other HMG box proteins (11Yuan X. Lu M.L. Li T. Balk S.P. J. Biol. Chem. 2001; 276: 46647-46654Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar). This hypothesis was tested initially in glutathione S-transferase (GST) fusion protein pull-down experiments using a GST-ARDBD fusion protein and HMG proteins that were 35S-labeled by in vitro transcription/translation. One HMG protein examined was T cell factor 4 (Tcf4), a member of the Tcf/Lef family of sequence-specific HMG box proteins that is expressed in multiple epithelial tissues, including prostate (16Chesire D.R. Ewing C.M. Gage W.R. Isaacs W.B. Oncogene. 2002; 21: 2679-2694Crossref PubMed Scopus (149) Google Scholar). Similarly to SRY, 35S-labeled Tcf4 bound specifically to a fusion protein containing the AR DBD, GST-ARDBD-(556–628), and not to GST or an AR hinge region fusion protein, GST-AR-(634–668) (Fig. 1A). It should be noted that the in vitro transcribed/translated Tcf4 migrated as two bands with the upper band being ∼68 kDa, consistent with the predicted size of the unmodified protein. The lower band, which also bound to the GST-ARDBD-(556–628) protein, may be a proteolytic product or internally initiated protein. Significantly, GST-ARDBD-(556–628) did not bind to β-catenin, consistent with previous reports showing that β-catenin binds to the AR LBD (39Truica C.I. Byers S. Gelmann E.P. Cancer Res. 2000; 60: 4709-4713PubMed Google Scholar, 40Yang F. Li X. Sharma M. Sasaki C.Y. Longo D.L. Lim B. Sun Z. J. Biol. Chem. 2002; 277: 11336-11344Abstract Full Text Full Text PDF PubMed Scopus (297) Google Scholar, 41Mulholland D.J. Cheng H. Reid K. Rennie P.S. Nelson C.C. J. Biol. Chem. 2002; 277: 17933-17943Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar, 42Pawlowski J.E. Ertel J.R. Allen M.P. Xu M. Butler C. Wilson E.M. Wierman M.E. J. Biol. Chem. 2002; 277: 20702-20710Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar, 43Chesire D.R. Isaacs W.B. Oncogene. 2002; 21: 8453-8469Crossref PubMed Scopus (133) Google Scholar, 44Song L.N. Herrell R. Byers S. Shah S. Wilson E.M. Gelmann E.P. Mol. Cell. Biol. 2003; 23: 1674-1687Crossref PubMed Scopus (144) Google Scholar) (Fig. 1A). This result indicated that the Tcf4 binding was direct and not mediated by β-catenin. Another control protein, β-galactosidase, similarly failed to bind any of the GST proteins. Coimmunoprecipitation experiments then addressed whether there was a detectable interaction between intact AR and Tcf4 in vivo. CV1 cells (which do not express endogenous AR) were transiently transfected with AR and Tcf4 expression vectors and treated for 24 h with or without androgen (5α-dihydrotestosterone (DHT)), and lysates were immunoprecipitated with an anti-AR or control antibodies. Interestingly, anti-Tcf4 immunoblotting of the input lanes showed primarily a band at ∼86 kDa and a much weaker band at the expected size of 68 kDa (Fig. 1B). The same major 86-kDa band was detected by two different anti-Tcf4 antibodies and was not found in the nontransfected cells (data not shown). A larger Tcf4 isoform of ∼86 kDa has also been found in prostate cancer cell lines and may be due to attachment of SUMO as has been described for Tcf2/Lef1 (16Chesire D.R. Ewing C.M. Gage W.R. Isaacs W.B. Oncogene. 2002; 21: 2679-2694Crossref PubMed Scopus (149) Google Scholar, 51Sachdev S. Bruhn L. Sieber H. Pichler A. Melchior F. Grosschedl R. Genes Dev. 2001; 15: 3088-3103Crossref PubMed Scopus (464) Google Scholar). In any case, both Tcf4 isoforms were coprecipitated by the anti-AR antibody in the lysate from AR- and Tcf4-cotransfected cells treated with DHT (Fig. 1B). In contrast, minimal Tcf4 was found in the control nonimmune antibody precipitates or in the anti-AR precipitate from cells that were transfected only with Tcf4. The Tcf4 coimmunoprecipitation was also markedly diminished in the absence of DHT, further indicating that it was mediated by the AR. It should be noted that this latter result does not imply a strict androgen dependence for Tcf4 binding but may reflect stabilization of AR-Tcf4 binding by β-catenin (see below). Tcf4 Represses AR Transcriptional Activity in Transient Transfections—Transient transfections with AR, Tcf4, and an AR-regulated reporter gene were carried out to determine whether there were functional interactions between intact AR and Tcf4. CV1 cells cotransfected with an AR expression vector and an AR-regulated firefly luciferase reporter gene (ARE4-Luc) showed strong DHT-dependent transcriptional activity (Fig. 2A). Cotransfection with a Tcf4 expression vector resulted in a marked and dose-dependent decrease in luciferase activity (Fig. 2A). Interestingly, the repression was somewhat less at the highest levels of Tcf4 (100–200 ng), possibly reflecting sequestration of a corepressor. The repression was specific, because activity of a cotransfected Renilla luciferase reporter gene regulated by a CMV promoter was not decreased (Fig. 2B). Anti-AR immunoblots of the same lysates used for the luciferase assays further indicated that repression, which was >50% at 5 ng of Tcf4 plasmid, was not due to decreased AR expression (Fig. 2C). These findings were consistent with recent reports that also found Tcf4 inhibition of AR in transient transfections (43Chesire D.R. Isaacs W.B. Oncogene. 2002; 21: 8453-8469Crossref PubMed Scopus (133) Google Scholar, 44Song L.N. Herrell R. Byers S. Shah S. Wilson E.M. Gelmann E.P. Mol. Cell. Biol. 2003; 23: 1674-1687Crossref PubMed Scopus (144) Google Scholar). Additional AR-regulated reporter genes were analyzed to determine whether the Tcf4 repression was general versus enhancer-specific. Tcf4 markedly repressed AR transcriptional activity on a reporter gene regulated by an androgen-dependent prostate-specific antigen (PSA) promoter/enhancer (PSA7kb-Luc), containing 7 kb upstream of the PSA coding region with multiple AREs (Fig. 3A). Tcf4 similarly repressed AR activity on an MMTV-LTR reporter (MMTV-Luc), containing two AREs (Fig. 3B). Repression of the ARE4-Luc reporter by Tcf4 was also observed in another cell line, human 293T cells (data not shown). These re" @default.
• W2159133430 created "2016-06-24" @default.
• W2159133430 creator A5033858885 @default.
• W2159133430 creator A5052669830 @default.
• W2159133430 creator A5069145942 @default.
• W2159133430 creator A5070051485 @default.
• W2159133430 creator A5086146633 @default.
• W2159133430 creator A5087350413 @default.
• W2159133430 date "2003-08-01" @default.
• W2159133430 modified "2023-10-18" @default.
• W2159133430 title "A Direct β-Catenin-independent Interaction between Androgen Receptor and T Cell Factor 4" @default.
• W2159133430 cites W1502616762 @default.
• W2159133430 cites W1511545125 @default.
• W2159133430 cites W1554815317 @default.
• W2159133430 cites W1864386522 @default.
• W2159133430 cites W1868158025 @default.
• W2159133430 cites W1904120886 @default.
• W2159133430 cites W1964064160 @default.
• W2159133430 cites W1965674043 @default.
• W2159133430 cites W1967137553 @default.
• W2159133430 cites W1970833195 @default.
• W2159133430 cites W1970919014 @default.
• W2159133430 cites W1987323136 @default.
• W2159133430 cites W1989215255 @default.
• W2159133430 cites W2001034975 @default.
• W2159133430 cites W2002404925 @default.
• W2159133430 cites W2004320731 @default.
• W2159133430 cites W2004350008 @default.
• W2159133430 cites W2007717461 @default.
• W2159133430 cites W2011598009 @default.
• W2159133430 cites W2022810442 @default.
• W2159133430 cites W2023099007 @default.
• W2159133430 cites W2026533505 @default.
• W2159133430 cites W2028263033 @default.
• W2159133430 cites W2031078038 @default.
• W2159133430 cites W2033226021 @default.
• W2159133430 cites W2033728702 @default.
• W2159133430 cites W2036054914 @default.
• W2159133430 cites W2037048972 @default.
• W2159133430 cites W2043848949 @default.
• W2159133430 cites W2043982988 @default.
• W2159133430 cites W2044259020 @default.
• W2159133430 cites W2050414776 @default.
• W2159133430 cites W2056404812 @default.
• W2159133430 cites W2072354324 @default.
• W2159133430 cites W2078591745 @default.
• W2159133430 cites W2079039801 @default.
• W2159133430 cites W2081057019 @default.
• W2159133430 cites W2082387343 @default.
• W2159133430 cites W2082610063 @default.
• W2159133430 cites W2084148944 @default.
• W2159133430 cites W2090636859 @default.
• W2159133430 cites W2098588381 @default.
• W2159133430 cites W2100070586 @default.
• W2159133430 cites W2117235109 @default.
• W2159133430 cites W2118810511 @default.
• W2159133430 cites W2138153315 @default.
• W2159133430 cites W2145303832 @default.
• W2159133430 cites W2146167376 @default.
• W2159133430 cites W2152123530 @default.
• W2159133430 cites W2158569397 @default.
• W2159133430 cites W2159416234 @default.
• W2159133430 cites W2161225294 @default.
• W2159133430 cites W2164404916 @default.
• W2159133430 cites W2171996338 @default.
• W2159133430 cites W2186856601 @default.
• W2159133430 doi "https://doi.org/10.1074/jbc.m301208200" @default.
• W2159133430 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12799378" @default.
• W2159133430 hasPublicationYear "2003" @default.
• W2159133430 type Work @default.
• W2159133430 sameAs 2159133430 @default.
• W2159133430 citedByCount "87" @default.
• W2159133430 countsByYear W21591334302012 @default.
• W2159133430 countsByYear W21591334302013 @default.
• W2159133430 countsByYear W21591334302014 @default.
• W2159133430 countsByYear W21591334302015 @default.
• W2159133430 countsByYear W21591334302016 @default.
• W2159133430 countsByYear W21591334302017 @default.
• W2159133430 countsByYear W21591334302018 @default.
• W2159133430 countsByYear W21591334302020 @default.
• W2159133430 countsByYear W21591334302023 @default.
• W2159133430 crossrefType "journal-article" @default.
• W2159133430 hasAuthorship W2159133430A5033858885 @default.
• W2159133430 hasAuthorship W2159133430A5052669830 @default.
• W2159133430 hasAuthorship W2159133430A5069145942 @default.
• W2159133430 hasAuthorship W2159133430A5070051485 @default.
• W2159133430 hasAuthorship W2159133430A5086146633 @default.
• W2159133430 hasAuthorship W2159133430A5087350413 @default.
• W2159133430 hasBestOaLocation W21591334301 @default.
• W2159133430 hasConcept C121608353 @default.
• W2159133430 hasConcept C137620995 @default.
• W2159133430 hasConcept C170493617 @default.
• W2159133430 hasConcept C185592680 @default.
• W2159133430 hasConcept C2777911890 @default.
• W2159133430 hasConcept C2780192828 @default.
• W2159133430 hasConcept C30145163 @default.
• W2159133430 hasConcept C502942594 @default.
• W2159133430 hasConcept C54355233 @default.

• next