FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2161129289> ?p ?o ?g. }

• W2161129289 endingPage "12700" @default.
• W2161129289 startingPage "12691" @default.
• W2161129289 abstract "Cell-cell contacts play a vital role in intracellular signaling, although the molecular mechanisms of these signaling pathways are not fully understood. E-cadherin, an important mediator of cell-cell adhesions, has been shown to be cleaved by γ-secretase. This cleavage releases a fragment of E-cadherin, E-cadherin C-terminal fragment 2 (E-cad/CTF2), into the cytosol. Here, we study the fate and function of this fragment. First, we show that coexpression of the cadherin-binding protein, p120 catenin (p120), enhances the nuclear translocation of E-cad/CTF2. By knocking down p120 with short interfering RNA, we also demonstrate that p120 is necessary for the nuclear localization of E-cad/CTF2. Furthermore, p120 enhances and is required for the specific binding of E-cad/CTF2 to DNA. Finally, we show that E-cad/CTF2 can regulate the p120-Kaiso-mediated signaling pathway in the nucleus. These data indicate a novel role for cleaved E-cadherin in the nucleus. Cell-cell contacts play a vital role in intracellular signaling, although the molecular mechanisms of these signaling pathways are not fully understood. E-cadherin, an important mediator of cell-cell adhesions, has been shown to be cleaved by γ-secretase. This cleavage releases a fragment of E-cadherin, E-cadherin C-terminal fragment 2 (E-cad/CTF2), into the cytosol. Here, we study the fate and function of this fragment. First, we show that coexpression of the cadherin-binding protein, p120 catenin (p120), enhances the nuclear translocation of E-cad/CTF2. By knocking down p120 with short interfering RNA, we also demonstrate that p120 is necessary for the nuclear localization of E-cad/CTF2. Furthermore, p120 enhances and is required for the specific binding of E-cad/CTF2 to DNA. Finally, we show that E-cad/CTF2 can regulate the p120-Kaiso-mediated signaling pathway in the nucleus. These data indicate a novel role for cleaved E-cadherin in the nucleus. In multicellular organisms, individual cells are often connected with each other via cell-cell adhesions to form three-dimensionally structured tissues or organs. Formation of tight and compact cell-cell adhesions suppresses free cell movement and provides cells with a positional cue for the establishment of cell polarity. In addition to the structural roles, it has been long known that cell-cell contacts play an important role in various signal transduction pathways (1Jamora C. Fuchs E. Nat. Cell Biol. 2002; 4: E101-108Crossref PubMed Scopus (491) Google Scholar, 2Fagotto F. Gumbiner B.M. Dev. Biol. 1996; 180: 445-454Crossref PubMed Scopus (188) Google Scholar). In other words, through cell-cell contacts, cells can exchange a variety of information with their neighbors to behave properly in their community. Cadherins are a family of transmembrane cell-cell adhesion proteins that can be subdivided into several groups including classical cadherins and protocadherins (3Yagi T. Takeichi M. Genes Dev. 2000; 14: 1169-1180PubMed Google Scholar). Classical cadherins, of which E-cadherin is the best characterized, play a crucial role in mediating cell-cell contacts at adherens junctions. The extracellular domains of classical cadherins form homophilic ligations. The cytoplasmic domain of cadherin includes two cadherin homology (CH) 2The abbreviations used are: CH, cadherin homology; ADAM10, a disintegrin and metalloprotease 10; CBP, CREB-binding protein; E-cad/CTF, E-cadherin C-terminal fragment; HEK, human embryonic kidney; Hmat, human matrilysin; p120, p120-catenin; siRNA, short interfering RNA; CREB, cAMP-response element-binding protein; TCF/LEF-1, T-cell factor/lymphocyte enhancer factor-1; MDCK, Madin-Darby canine kidney; GST, glutathione S-transferase; HA, hemagglutinin; NLS, nuclear localization signal. domains: CH2 domain (located at the membrane proximal region) and CH3 domain (located at the distal region). These domains are conserved between classical cadherins. The CH2 and CH3 domains of cadherins interact with p120-catenin (p120) and β-catenin, respectively (4McCrea P.D. Turck C.W. Gumbiner B. Science. 1991; 254: 1359-1361Crossref PubMed Scopus (506) Google Scholar, 5Reynolds A.B. Daniel J. McCrea P.D. Wheelock M.J. Wu J. Zhang Z. Mol. Cell. Biol. 1994; 14: 8333-8342Crossref PubMed Google Scholar). Furthermore, the CH2 domain of E-cadherin also interacts with Hakai (6Fujita Y. Krause G. Scheffner M. Zechner D. Leddy H.E. Behrens J. Sommer T. Birchmeier W. Nat. Cell Biol. 2002; 4: 222-231Crossref PubMed Scopus (687) Google Scholar, 7Tricaud N. Perrin-Tricaud C. Bruses J.L. Rutishauser U. J. Neurosci. 2005; 25: 3259-3269Crossref PubMed Scopus (61) Google Scholar). Cadherins, especially classical cadherins, have been shown to be involved in several signaling pathways regulating cell proliferation, differentiation, and survival (8Larue L. Antos C. Butz S. Huber O. Delmas V. Dominis M. Kemler R. Development. 1996; 122: 3185-3194Crossref PubMed Google Scholar, 9Wheelock M.J. Johnson K.R. Curr. Opin. Cell Biol. 2003; 15: 509-514Crossref PubMed Scopus (234) Google Scholar, 10Gumbiner B.M. Nat. Rev. Mol. Cell Biol. 2005; 6: 622-634Crossref PubMed Scopus (1216) Google Scholar, 11Perez-Moreno M. Jamora C. Fuchs E. Cell. 2003; 112: 535-548Abstract Full Text Full Text PDF PubMed Scopus (616) Google Scholar). However, the molecular mechanisms whereby cadherins regulate varied cellular processes are not fully understood. The cytoplasmic domain of cadherins does not possess any intrinsic enzymatic activity that could directly mediate signaling pathways in the cytosol. However, cadherin-binding proteins, especially β-catenin and p120, have been shown to localize in the nucleus and play a key role in signal transduction. The crucial role of β-catenin in the canonical Wnt signaling pathway has been well characterized (12Brembeck F.H. Rosario M. Birchmeier W. Curr. Opin. Genet. Dev. 2006; 16: 51-59Crossref PubMed Scopus (563) Google Scholar, 13Willert K. Jones K.A. Genes Dev. 2006; 20: 1394-1404Crossref PubMed Scopus (509) Google Scholar). When cells are stimulated with Wnt, β-catenin is translocated into the nucleus where it binds a transcription factor, T-cell factor/lymphocyte enhancer factor-1 (TCF/LEF-1), and acts as a transcriptional activator (14Molenaar M. van de Wetering M. Oosterwegel M. Peterson-Maduro J. Godsave S. Korinek V. Roose J. Destree O. Clevers H. Cell. 1996; 86: 391-399Abstract Full Text Full Text PDF PubMed Scopus (1619) Google Scholar, 15Behrens J. von Kries J.P. Kuhl M. Bruhn L. Wedlich D. Grosschedl R. Birchmeier W. Nature. 1996; 382: 638-642Crossref PubMed Scopus (2595) Google Scholar). More recently, it has been shown that p120 also has a functional role in the nucleus (16Kelly K.F. Spring C.M. Otchere A.A. Daniel J.M. J. Cell Sci. 2004; 117: 2675-2686Crossref PubMed Scopus (90) Google Scholar, 17Daniel J.M. Reynolds A.B. Mol. Cell. Biol. 1999; 19: 3614-3623Crossref PubMed Scopus (341) Google Scholar, 18Hosking C.R. Ulloa F. Hogan C. Ferber E.C. Figueroa A. Gevaert K. Birchmeier W. Briscoe J. Fujita Y. Mol. Biol. Cell. 2007; 18: 1918-1927Crossref PubMed Scopus (49) Google Scholar). A transcriptional repressor Kaiso has been characterized as a p120-binding protein (17Daniel J.M. Reynolds A.B. Mol. Cell. Biol. 1999; 19: 3614-3623Crossref PubMed Scopus (341) Google Scholar). The interaction with p120 prevents Kaiso from binding to DNA and thus suppresses the repressor activity of Kaiso (16Kelly K.F. Spring C.M. Otchere A.A. Daniel J.M. J. Cell Sci. 2004; 117: 2675-2686Crossref PubMed Scopus (90) Google Scholar, 19Daniel J.M. Spring C.M. Crawford H.C. Reynolds A.B. Baig A. Nucleic Acids Res. 2002; 30: 2911-2919Crossref PubMed Scopus (205) Google Scholar). The Kaiso-p120 complex was recently shown to regulate both canonical and non-canonical Wnt signaling pathways (20Kim S.W. Park J.I. Spring C.M. Sater A.K. Ji H. Otchere A.A. Daniel J.M. McCrea P.D. Nat. Cell Biol. 2004; 6: 1212-1220Crossref PubMed Scopus (134) Google Scholar, 21Park J.I. Kim S.W. Lyons J.P. Ji H. Nguyen T.T. Cho K. Barton M.C. Deroo T. Vleminckx K. Moon R.T. McCrea P.D. Dev. Cell. 2005; 8: 843-854Abstract Full Text Full Text PDF PubMed Scopus (188) Google Scholar). Although the functional roles of cadherin-binding proteins in the nucleus have been intensively studied, it is not clear whether the cytoplasmic domain of cadherin itself has a signaling role in the nucleus. Cadherin-based cell-cell contacts are dynamically regulated. Cadherin at cell-cell contacts can be down-regulated by transcriptional repression and endocytosis (6Fujita Y. Krause G. Scheffner M. Zechner D. Leddy H.E. Behrens J. Sommer T. Birchmeier W. Nat. Cell Biol. 2002; 4: 222-231Crossref PubMed Scopus (687) Google Scholar, 22Batlle E. Sancho E. Franci C. Dominguez D. Monfar M. Baulida J. Garcia De Herreros A. Nat. Cell Biol. 2000; 2: 84-89Crossref PubMed Scopus (2172) Google Scholar, 23Cano A. Perez-Moreno M.A. Rodrigo I. Locascio A. Blanco M.J. del Barrio M.G. Portillo F. Nieto M.A. Nat. Cell Biol. 2000; 2: 76-83Crossref PubMed Scopus (2931) Google Scholar). Moreover, cadherins are proteolytically cleaved by a number of proteases including extracellular metalloproteases, γ-secretase, and caspase (24Lochter A. Galosy S. Muschler J. Freedman N. Werb Z. Bissell M.J. J. Cell Biol. 1997; 139: 1861-1872Crossref PubMed Scopus (533) Google Scholar, 25Marambaud P. Shioi J. Serban G. Georgakopoulos A. Sarner S. Nagy V. Baki L. Wen P. Efthimiopoulos S. Shao Z. Wisniewski T. Robakis N.K. EMBO J. 2002; 21: 1948-1956Crossref PubMed Scopus (624) Google Scholar, 26Maretzky T. Reiss K. Ludwig A. Buchholz J. Scholz F. Proksch E. de Strooper B. Hartmann D. Saftig P. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 9182-9187Crossref PubMed Scopus (536) Google Scholar, 27Steinhusen U. Weiske J. Badock V. Tauber R. Bommert K. Huber O. J. Biol. Chem. 2001; 276: 4972-4980Abstract Full Text Full Text PDF PubMed Scopus (225) Google Scholar). γ-Secretase cleavage of several transmembrane molecules following initial cleavage by metalloproteases has emerged as a common mechanism for signaling to the nucleus (28Fortini M.E. Nat. Rev. Mol. Cell Biol. 2002; 3: 673-684Crossref PubMed Scopus (343) Google Scholar). This is best characterized in Notch signaling where the γ-secretase-cleaved intracellular Notch fragment translocates to the nucleus and regulates gene transcription (29Schroeter E.H. Kisslinger J.A. Kopan R. Nature. 1998; 393: 382-386Crossref PubMed Scopus (1362) Google Scholar, 30Struhl G. Adachi A. Cell. 1998; 93: 649-660Abstract Full Text Full Text PDF PubMed Scopus (635) Google Scholar). In recent years, a similar mechanism has also been described for amyloid precursor protein, ErbB4, CD44 as well as N-cadherin and γ-protocadherins (31Gao Y. Pimplikar S.W. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 14979-14984Crossref PubMed Scopus (210) Google Scholar, 32Marambaud P. Wen P.H. Dutt A. Shioi J. Takashima A. Siman R. Robakis N.K. Cell. 2003; 114: 635-645Abstract Full Text Full Text PDF PubMed Scopus (425) Google Scholar, 33Ni C.Y. Murphy M.P. Golde T.E. Carpenter G. Science. 2001; 294: 2179-2181Crossref PubMed Scopus (756) Google Scholar, 34Okamoto I. Kawano Y. Murakami D. Sasayama T. Araki N. Miki T. Wong A.J. Saya H. J. Cell Biol. 2001; 155: 755-762Crossref PubMed Scopus (309) Google Scholar, 35Uemura K. Kihara T. Kuzuya A. Okawa K. Nishimoto T. Bito H. Ninomiya H. Sugimoto H. Kinoshita A. Shimohama S. Biochem. Biophys. Res. Commun. 2006; 345: 951-958Crossref PubMed Scopus (39) Google Scholar, 36Haas I.G. Frank M. Veron N. Kemler R. J. Biol. Chem. 2005; 280: 9313-9319Abstract Full Text Full Text PDF PubMed Scopus (118) Google Scholar, 37Hambsch B. Grinevich V. Seeburg P.H. Schwarz M.K. J. Biol. Chem. 2005; 280: 15888-15897Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar, 38Shoval I. Ludwig A. Kalcheim C. Development. 2007; 134: 491-501Crossref PubMed Scopus (166) Google Scholar). For all these transmembrane molecules, intracellular domain fragments resulting from γ-secretase cleavage are translocated to the nucleus and have signaling functions. In particular, γ-secretase-mediated cleavage of N-cadherin in neural crest cells, induced by bone morphogenic protein 4, leads to nuclear translocation of the released cytoplasmic domain of N-cadherin (38Shoval I. Ludwig A. Kalcheim C. Development. 2007; 134: 491-501Crossref PubMed Scopus (166) Google Scholar). The cytoplasmic domain of γ-protocadherins also localizes in the nucleus and activates the promoter of γ-protocadherin locus (37Hambsch B. Grinevich V. Seeburg P.H. Schwarz M.K. J. Biol. Chem. 2005; 280: 15888-15897Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar). However, no signaling function for the cleaved cytoplasmic domain of E-cadherin has been described. In this study, we show that the intracellular domain of E-cadherin released by γ-secretase cleavage can localize in the nucleus and that this localization is specifically enhanced by p120. p120 also promotes the interaction of E-cadherin with DNA. We demonstrate that the cytoplasmic domain of E-cadherin in the nucleus modulates the p120-Kaiso-mediated signaling pathway. Finally, we present data suggesting a possible role of nuclear E-cadherin in the regulation of apoptosis. Antibodies, Plasmids, and Materials—Antibodies against E-cadherin, p120, N-cadherin, GM130, BiP/GRP78, and Lamp-1 were purchased from BD Biosciences. Anti-HA antibody was obtained from Roche. Anti-FLAG antibody and the peroxidase-conjugated anti-FLAG antibody were purchased from Sigma. Anti-myc antibody was from Upstate (Temecula, CA). Anti-CREB-binding protein (CBP) and anti-α-tubulin antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA) and Abcam (Cambridge, UK), respectively. Anti-cleaved caspase-3 antibody was from Cell Signaling Technology (Danvers, MA). All antibodies were used at a dilution of 1:1000 for Western blotting and 1:100 for immunofluorescence, except for anti-E-cadherin antibody, which was used at 1:3000 for Western blotting, and anti-GM130, anti-BiP/GRP78, and anti-Lamp-1 antibodies that were used at 1:250 for Western blotting. To construct pcDNA-E-cad/CTF2 and -E-cad/CTF3, the cDNAs of the cytoplasmic domain of E-cadherin were amplified by PCR from pBAT-mouse-E-cadherin using the following primers: pcDNA-E-cad/CTF2, 5′-GGAATTCGCGGCCGCGGTACCATGCGGAGGAGAACGGTGGTC and 3′-GGAATTCGGATCCTAGTCGTCCTCGCCACC; pcDNAE-cad/CTF3, 5′-ATTCGCGGCCGCGGTACCATGAATGTGTATTACTATGATGAAGAAGGAGG and 3′-GGAATTCGGATCCTAGTCGTCCTCGCCACC. Both were cloned into the NotI/BamHI sites of the pcDNA vector. To construct pcDNA-E-cad/CTF2(AAA), the cDNA of the cytoplasmic domain of E-cadherin was amplified by PCR from pLK-E-cadherin(762AAA764) using the same primers as used to construct pcDNA-E-cad/CTF2. To construct pcDNA-E-cad/CTF2(RRRR), all lysine residues were replaced for arginine by site-directed mutagenesis using pcDNA-E-cad/CTF2 as a template. Site-directed mutagenesis was performed using the QuikChange Site-directed mutagenesis kit from Stratagene (La Jolla, CA). To construct pCMV-E-cad/CTF2-NLS-myc and pCMV-E-cad/CTF2(AAA)-NLS-myc, the cytoplasmic domain of E-cadherin was amplified by PCR from pBAT-E-cadherin and pLK-E-cadherin(762AAA764), respectively, using the following primers: 5′-GAATTCGCGGCCGCAATGCGGAGGAGAACGGTGGTC and 3′-GGAATTCGCGGCCGCGTCGTCCTCGCCACCGCCG. These were cloned into a NotI site of the pCMV-myc-nuc pShooter vector (Invitrogen). To construct pcDNA/TO/GFP-E-cad/CTF2-NLS, the cDNA of E-cad/CTF2-NLS was amplified by PCR from pCMV-E-cad/CTF2-NLS-myc using the following primers: 5′-CGGCGCCTCGAGGCGGAGGAGAACGGTGGTC and 3′-CGGCGCCGAATTCCTATGCGGCCCCATTCAGATCC. This was then cloned into the EcoRI and XhoI sites of pcDNA/TO/GFP. To construct pCS2-myc-Kaiso, the cDNA of human Kaiso was amplified by PCR using pCS2-hKaiso as a template, and inserted into the EcoRI site of pCS2-myc. pcDNA-HA-Ecad/CTF2, pcDNA-FLAG-p120, pcDNA-HA-p120, pBSSR-HA-ubiquitin, pcDNA-myc-β-catenin, pcDNA-FLAG-Hakai, pLK-E-cadherin(762AAA764), pcDNA/TO/GFP, pGL3–4x KBS, and pGL3-Basic-2.3kb HMat were described previously (6Fujita Y. Krause G. Scheffner M. Zechner D. Leddy H.E. Behrens J. Sommer T. Birchmeier W. Nat. Cell Biol. 2002; 4: 222-231Crossref PubMed Scopus (687) Google Scholar, 16Kelly K.F. Spring C.M. Otchere A.A. Daniel J.M. J. Cell Sci. 2004; 117: 2675-2686Crossref PubMed Scopus (90) Google Scholar, 18Hosking C.R. Ulloa F. Hogan C. Ferber E.C. Figueroa A. Gevaert K. Birchmeier W. Briscoe J. Fujita Y. Mol. Biol. Cell. 2007; 18: 1918-1927Crossref PubMed Scopus (49) Google Scholar, 39Spring C.M. Kelly K.F. O'Kelly I. Graham M. Crawford H.C. Daniel J.M. Exp. Cell Res. 2005; 305: 253-265Crossref PubMed Scopus (104) Google Scholar, 40Hogan C. Serpente N. Cogram P. Hosking C.R. Bialucha C.U. Feller S.M. Braga V.M. Birchmeier W. Fujita Y. Mol. Cell. Biol. 2004; 24: 6690-6700Crossref PubMed Scopus (221) Google Scholar, 41Thoreson M.A. Anastasiadis P.Z. Daniel J.M. Ireton R.C. Wheelock M.J. Johnson K.R. Hummingbird D.K. Reynolds A.B. J. Cell Biol. 2000; 148: 189-202Crossref PubMed Scopus (386) Google Scholar). pME18S-FLAG-ADAM10 was kindly provided by Dr. Eiichiro Nishi (Kyoto University, Kyoto, Japan). pcH110-LacZ was a generous gift from Dr. Walter Birchmeier (Max-Delbrück-Center, Berlin, Germany). Staurosporine was obtained from Upstate. γ-Secretase inhibitor X was purchased from Calbiochem. Lipofectamine 2000 reagent was obtained from Invitrogen. Hi-PerFect® reagent was purchased from Qiagen (Crawley, UK). Cell Culture, Immunofluorescence, Immunoprecipitation, DNA Binding Assay, and GST Pull-down Assay—Human embryonic kidney (HEK) 293, Madin-Darby canine kidney (MDCK), MCF-7, COS-1, and L fibroblast cells were cultured as previously described (18Hosking C.R. Ulloa F. Hogan C. Ferber E.C. Figueroa A. Gevaert K. Birchmeier W. Briscoe J. Fujita Y. Mol. Biol. Cell. 2007; 18: 1918-1927Crossref PubMed Scopus (49) Google Scholar, 42Dupre-Crochet S. Figueroa A. Hogan C. Ferber E.C. Bialucha C.U. Adams J. Richardson E.C. Fujita Y. Mol. Cell. Biol. 2007; 27: 3804-3816Crossref PubMed Scopus (75) Google Scholar). A431 cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum and penicillin/streptomycin at 37 °C and ambient air supplemented with 5% CO2. MDCK, MCF-7, COS-1, and L fibroblast cells were transfected with Lipofectamine 2000 reagent. HEK293 cells were transfected as previously described (43Schaeper U. Gehring N.H. Fuchs K.P. Sachs M. Kempkes B. Birchmeier W. J. Cell Biol. 2000; 149: 1419-1432Crossref PubMed Scopus (292) Google Scholar). MDCK cells stably expressing E-cadherin-myc were produced and cultured as previously described (42Dupre-Crochet S. Figueroa A. Hogan C. Ferber E.C. Bialucha C.U. Adams J. Richardson E.C. Fujita Y. Mol. Cell. Biol. 2007; 27: 3804-3816Crossref PubMed Scopus (75) Google Scholar). To obtain L fibroblast cell lines stably expressing NLS-tagged E-cad/CTF2, cells were transfected with pcDNA4/TO/GFP-E-cad/CTF2-NLS, and stably transfected cells were selected in medium containing 400 μg ml–1 zeocin (Invitrogen). Immunofluorescence was performed as previously described (40Hogan C. Serpente N. Cogram P. Hosking C.R. Bialucha C.U. Feller S.M. Braga V.M. Birchmeier W. Fujita Y. Mol. Cell. Biol. 2004; 24: 6690-6700Crossref PubMed Scopus (221) Google Scholar). Images were captured using an Orca camera (Hamamatsu) and Openlab software (Improvision). To obtain epifluorescence images, we used a Zeiss Axipoplan2 microscope using a 40 × 1.3 oil immersion objective at room temperature (Zeiss). Images were captured using a C4742-95 digital camera (Hamamatsu) and Openlab software (Improvision). Confocal images were obtained with a Bio-Rad confocal mounted on a Nikon Optiphot 2 microscope using a 60 × 1.4 oil immersion objective at room temperature, or a Leica SPE confocal microscope with a 63 × 1.3 oil immersion objective at room temperature. Images were acquired using Laser Sharp software (Bio-Rad) or the Leica Application Suite, respectively. Merged images were split using Image J software (National Institutes of Health). Brightness and contrast were adjusted using Photoshop CS (Adobe). The ratio of nucleus/cytoplasm fluorescence intensity in confocal images were analyzed as described (18Hosking C.R. Ulloa F. Hogan C. Ferber E.C. Figueroa A. Gevaert K. Birchmeier W. Briscoe J. Fujita Y. Mol. Biol. Cell. 2007; 18: 1918-1927Crossref PubMed Scopus (49) Google Scholar). Secondary antibodies used were goat anti-mouse Rhodamine Red-X, goat anti-rabbit Cy2, and goat anti-rat Cy2 (Jackson ImmunoResearch Laboratories). To visualize nuclei we used Hoechst 33342 (Invitrogen). Immunoprecipitation and Western blotting were performed as described (40Hogan C. Serpente N. Cogram P. Hosking C.R. Bialucha C.U. Feller S.M. Braga V.M. Birchmeier W. Fujita Y. Mol. Cell. Biol. 2004; 24: 6690-6700Crossref PubMed Scopus (221) Google Scholar). To obtain total cell lysates, cells were washed once with phosphate-buffered saline and suspended in Triton X-100 lysis buffer (20 mm Tris-HCl, pH 7.5, 150 mm NaCl, and 1% Triton X-100) containing 5 μg ml–1 leupeptin, 50 mm phenylmethylsulfonyl fluoride, 7.2 trypsin inhibitor units ml–1 of aprotinin, and 10 mm N-ethylmaleimide. The suspended cells were directly boiled with SDS-PAGE sample buffer. To ensure equal loading, the protein concentration of lysates was quantified using the DC Protein Assay reagent from Bio-Rad (Hercules, CA) and measured on a VERSAmax microplate reader (Molecular Devices, Sunnyvale, CA). Densitometric analyses were performed with the Bio-Rad image acquisition system (Gel Doc 170) and Epson Expression 1680 Pro Scanner (Seiko Epson, Amsterdam, Netherlands), and Quantity One (Bio-Rad). The upsmear bands of E-cad/CTF2 shown in Fig. 4 were not observed in some experiments (e.g. supplemental Fig. S2B). It is highly likely that despite the addition of N-ethylmaleimide to inhibit de-ubiquitination, the de-modification of E-cad/CTF2 occurs very actively after lysing the cells, as the modified bands were frequently lost when the lysates were kept for a longer period. For DNA-cellulose binding assays, cell lysates (100 μg of protein) and/or purified GST or GST-E-cad/CTF2 protein (75 ng) were used in DNA-cellulose assays and competition assays as previously described (18Hosking C.R. Ulloa F. Hogan C. Ferber E.C. Figueroa A. Gevaert K. Birchmeier W. Briscoe J. Fujita Y. Mol. Biol. Cell. 2007; 18: 1918-1927Crossref PubMed Scopus (49) Google Scholar). Purified GST-E-cad/CTF2 and GST proteins were produced, and GST pull-down assays were performed as previously described (40Hogan C. Serpente N. Cogram P. Hosking C.R. Bialucha C.U. Feller S.M. Braga V.M. Birchmeier W. Fujita Y. Mol. Cell. Biol. 2004; 24: 6690-6700Crossref PubMed Scopus (221) Google Scholar). Nuclear Fractionation—Cells were washed twice with phosphate-buffered saline and trypsinized thoroughly until well separated. Pelleted cells were resuspended in 150 μl of 2× lysis buffer (50 mm Hepes/NaOH, pH 7.4, 10 mm EGTA, 5 mm MgCl2, 20% glycerol, and 2% Nonidet P-40) containing 5 μg ml–1 leupeptin, 50 mm phenylmethylsulfonyl fluoride, 7.2 trypsin inhibitor units ml–1 of aprotinin, and 10 mm N-ethylmaleimide. Cells were then immediately triturated with a 25-gauge needle 12 times. After centrifugation at 110 × g for 5 min at 4 °C, the supernatant was removed and the pelleted nuclei were washed twice in 1× lysis buffer. The nuclear fractions were then boiled for 10 min with SDS-PAGE sample buffer followed by Western blotting, or lysed in 1 ml of Triton X-100 lysis buffer followed by immunoprecipitation. Purity of nuclear fractions was confirmed by Western blotting with antibodies against several compartment-specific markers (supplemental Fig. S3A). RNA Interference—siRNA oligos for p120 (p120 siRNA1, CAGCAGAACUCCUCUUGGATT; p120 siRNA2, CAGCAGUCAUUCAUAUGAUTT) were transiently transfected into HEK293 cells using Hi-PerFect® reagent. 5 × 104 cells per well were plated in a 24-well dish. 1.5 μg of siRNA was used with 9 μl of Hi-PerFect reagent per well. As a negative control, we used the non-silencing control siRNA (AF 488) from Qiagen. 48 h after siRNA transfection, cells were further transfected with E-cad/CTF2. After a further 24 h, cells were lysed in Triton X-100 lysis buffer or used for nuclear fractionation. Luciferase Reporter Assays—HEK293 and COS-1 cells were transfected with pGL3–4x KBS together with FLAG-p120, E-cad/CTF2, E-cad/CTF2-NLS-myc, or E-cad/CTF2(AAA)-NLS-myc. For reporter assays using the matrilysin promoter, HEK293 cells were transfected with pGL3-Basic-2.3kb HMat together with FLAG-p120, E-cad/CTF2-NLS-myc, or E-cad/CTF2(AAA)-NLS-myc. LacZ was used as a control for transfection efficiency in all experiments. Luciferase activity was measured using the luciferase assay kit according to the manufacturer's instructions (Promega, Madison, WI) and a Turner Designs TD-20/20 luminometer. β-Galactosidase activity was measured using the β-galactosidase assay kit according to the manufacturer's instructions (Promega) and the VERSAmax microplate reader (Molecular Devices). Statistical Analysis—Student's t tests assuming equal or unequal variance and a two-tailed distribution were performed for statistical analysis. Treatment with Staurosporine Induces γ-Secretase-mediated Cleavage of E-cadherin in Epithelial Cells—First, we examined the proteolytic cleavage of E-cadherin in several epithelial cell lines. As previously reported (25Marambaud P. Shioi J. Serban G. Georgakopoulos A. Sarner S. Nagy V. Baki L. Wen P. Efthimiopoulos S. Shao Z. Wisniewski T. Robakis N.K. EMBO J. 2002; 21: 1948-1956Crossref PubMed Scopus (624) Google Scholar), treatment of the human epithelial cell line A431 with staurosporine lead to the production of cytoplasmic cleavage products, E-cadherin C-terminal fragment 2 (E-cad/CTF2) (33 kDa) and E-cadherin C-terminal fragment 3 (E-cad/CTF3) (29 kDa) (Fig. 1A). Staurosporine is a potent inhibitor of protein kinase C and other protein kinases, which strongly induces apoptosis. E-Cad/CTF2 was also observed in the human breast adenocarcinoma cell line MCF-7 and MDCK cells after treatment with staurosporine (Fig. 1A). A 38-kDa E-cadherin fragment known as E-cadherin C-terminal fragment 1 (E-cad/CTF1) was also present in all three cell lines (Fig. 1A). The identity of a number of other bands between 45 and 100 kDa, particularly in MDCK cells, is not known. The size and domain structure of E-cad/CTF1, E-cad/CTF2, and E-cad/CTF3 are shown in Fig. 1B. E-Cad/CTF1 is the cleavage product induced by extracellular metalloproteases that cleave close to the interface between the extracellular and transmembrane regions of E-cadherin (24Lochter A. Galosy S. Muschler J. Freedman N. Werb Z. Bissell M.J. J. Cell Biol. 1997; 139: 1861-1872Crossref PubMed Scopus (533) Google Scholar, 25Marambaud P. Shioi J. Serban G. Georgakopoulos A. Sarner S. Nagy V. Baki L. Wen P. Efthimiopoulos S. Shao Z. Wisniewski T. Robakis N.K. EMBO J. 2002; 21: 1948-1956Crossref PubMed Scopus (624) Google Scholar, 26Maretzky T. Reiss K. Ludwig A. Buchholz J. Scholz F. Proksch E. de Strooper B. Hartmann D. Saftig P. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 9182-9187Crossref PubMed Scopus (536) Google Scholar). E-Cad/CTF3 results from cleavage by caspase-3 after induction of apoptosis (25Marambaud P. Shioi J. Serban G. Georgakopoulos A. Sarner S. Nagy V. Baki L. Wen P. Efthimiopoulos S. Shao Z. Wisniewski T. Robakis N.K. EMBO J. 2002; 21: 1948-1956Crossref PubMed Scopus (624) Google Scholar, 27Steinhusen U. Weiske J. Badock V. Tauber R. Bommert K. Huber O. J. Biol. Chem. 2001; 276: 4972-4980Abstract Full Text Full Text PDF PubMed Scopus (225) Google Scholar). E-Cad/CTF2 is the result of γ-secretase cleavage, which occurs following removal of the extracellular region by metalloproteases (25Marambaud P. Shioi J. Serban G. Georgakopoulos A. Sarner S. Nagy V. Baki L. Wen P. Efthimiopoulos S. Shao Z. Wisniewski T. Robakis N.K. EMBO J. 2002; 21: 1948-1956Crossref PubMed Scopus (624) Google Scholar). The resulting E-cad/CTF2 fragment represents the entire intracellular domain of E-cadherin. As expected, we observed that treatment with γ-secretase inhibitor X specifically blocked staurosporine-induced production of E-cad/CTF2 in all three cell lines and lead to an accumulation of its precursor E-cad/CTF1 (Fig. 1A). p120 Enhances Nuclear Localization of E-cad/CTF2—To investigate a possible role for E-cad/CTF2 in signaling pathways, we studied whether it can localize in the nucleus, as has been observed for the γ-secretase cleavage products of N-cadherin and γ-protocadherins (35Uemura K. Kihara T. Kuzuya A. Okawa K. Nishimoto T. Bito H. Ninomiya H. Sugimoto H. Kinoshita A. Shimohama S. Biochem. Biophys. Res. Commun. 2006; 345: 951-958Crossref PubMed Scopus (39) Google Scholar, 36Haas I.G. Frank M. Veron N. Kemler R. J. Biol. Chem. 2005; 280: 9313-9319Abstract Full Text Full Text PDF PubMed Scopus (118) Google Scholar, 37Hambsch B. Grinevich V. Seeburg P.H. Schwarz M.K. J. Biol. Chem. 2005; 280: 15888-15897Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar, 38Shoval I. Ludwig A. Kalcheim C. Development. 2007; 134: 491-501Crossref PubMed Scopus (166) Google Scholar). We first expressed HA-tagged E-cad/CTF2 in epithelial cells and examined its subcellular localization. When HA-E-cad/CTF2 alone is expressed in MDCK cells, it was mainly localized in the cytoplasm (Fig. 2A). Interestingly, we found that coexpression of p120 enhanced the nuclear localization of E-cad/CTF2 (Fig. 2A). To quantify this effect of p120, we measured the ratio of pixel intensity within defined regions of the nucleus and cytoplasm. The quantification results showed that coexpression of p120 significantly increased the amount of E-cad/CTF2 in the nucleus (p < 0.002) (Fig. 2A, right). A simi" @default.
• W2161129289 created "2016-06-24" @default.
• W2161129289 creator A5000059241 @default.
• W2161129289 creator A5040414410 @default.
• W2161129289 creator A5048444573 @default.
• W2161129289 creator A5049133868 @default.
• W2161129289 creator A5051451930 @default.
• W2161129289 creator A5061000332 @default.
• W2161129289 creator A5065101315 @default.
• W2161129289 creator A5087845939 @default.
• W2161129289 date "2008-05-01" @default.
• W2161129289 modified "2023-10-02" @default.
• W2161129289 title "A Role for the Cleaved Cytoplasmic Domain of E-cadherin in the Nucleus" @default.
• W2161129289 cites W1595935608 @default.
• W2161129289 cites W1660631781 @default.
• W2161129289 cites W1744742580 @default.
• W2161129289 cites W1757054819 @default.
• W2161129289 cites W1951809136 @default.
• W2161129289 cites W1963967499 @default.
• W2161129289 cites W1966528142 @default.
• W2161129289 cites W1971775650 @default.
• W2161129289 cites W1972039621 @default.
• W2161129289 cites W1973466009 @default.
• W2161129289 cites W1977286350 @default.
• W2161129289 cites W1988597344 @default.
• W2161129289 cites W1989215255 @default.
• W2161129289 cites W1990798651 @default.
• W2161129289 cites W1991976042 @default.
• W2161129289 cites W2000550532 @default.
• W2161129289 cites W2006257247 @default.
• W2161129289 cites W2008273587 @default.
• W2161129289 cites W2012919091 @default.
• W2161129289 cites W2015887548 @default.
• W2161129289 cites W2016056829 @default.
• W2161129289 cites W2019486380 @default.
• W2161129289 cites W2032930150 @default.
• W2161129289 cites W2034191509 @default.
• W2161129289 cites W2035331118 @default.
• W2161129289 cites W2046783796 @default.
• W2161129289 cites W2059892947 @default.
• W2161129289 cites W2065131699 @default.
• W2161129289 cites W2065723711 @default.
• W2161129289 cites W2077937228 @default.
• W2161129289 cites W2087367170 @default.
• W2161129289 cites W2087762539 @default.
• W2161129289 cites W2090636859 @default.
• W2161129289 cites W2094076302 @default.
• W2161129289 cites W2094484000 @default.
• W2161129289 cites W2104310645 @default.
• W2161129289 cites W2111761019 @default.
• W2161129289 cites W2126904219 @default.
• W2161129289 cites W2127113850 @default.
• W2161129289 cites W2129668825 @default.
• W2161129289 cites W2133548880 @default.
• W2161129289 cites W2137934927 @default.
• W2161129289 cites W2138447190 @default.
• W2161129289 cites W2141759421 @default.
• W2161129289 cites W2148760132 @default.
• W2161129289 cites W2162208736 @default.
• W2161129289 cites W2165901622 @default.
• W2161129289 cites W2167971272 @default.
• W2161129289 cites W2169745186 @default.
• W2161129289 cites W2266492038 @default.
• W2161129289 cites W2789682581 @default.
• W2161129289 doi "https://doi.org/10.1074/jbc.m708887200" @default.
• W2161129289 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/2442316" @default.
• W2161129289 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/18356166" @default.
• W2161129289 hasPublicationYear "2008" @default.
• W2161129289 type Work @default.
• W2161129289 sameAs 2161129289 @default.
• W2161129289 citedByCount "151" @default.
• W2161129289 countsByYear W21611292892012 @default.
• W2161129289 countsByYear W21611292892013 @default.
• W2161129289 countsByYear W21611292892014 @default.
• W2161129289 countsByYear W21611292892015 @default.
• W2161129289 countsByYear W21611292892016 @default.
• W2161129289 countsByYear W21611292892017 @default.
• W2161129289 countsByYear W21611292892018 @default.
• W2161129289 countsByYear W21611292892019 @default.
• W2161129289 countsByYear W21611292892020 @default.
• W2161129289 countsByYear W21611292892021 @default.
• W2161129289 countsByYear W21611292892022 @default.
• W2161129289 countsByYear W21611292892023 @default.
• W2161129289 crossrefType "journal-article" @default.
• W2161129289 hasAuthorship W2161129289A5000059241 @default.
• W2161129289 hasAuthorship W2161129289A5040414410 @default.
• W2161129289 hasAuthorship W2161129289A5048444573 @default.
• W2161129289 hasAuthorship W2161129289A5049133868 @default.
• W2161129289 hasAuthorship W2161129289A5051451930 @default.
• W2161129289 hasAuthorship W2161129289A5061000332 @default.
• W2161129289 hasAuthorship W2161129289A5065101315 @default.
• W2161129289 hasAuthorship W2161129289A5087845939 @default.
• W2161129289 hasBestOaLocation W21611292891 @default.
• W2161129289 hasConcept C134306372 @default.
• W2161129289 hasConcept C1491633281 @default.
• W2161129289 hasConcept C149402561 @default.
• W2161129289 hasConcept C185592680 @default.
• W2161129289 hasConcept C190062978 @default.

• next