FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2163130355> ?p ?o ?g. }

• W2163130355 endingPage "8792" @default.
• W2163130355 startingPage "8784" @default.
• W2163130355 abstract "The functions of the mechanosensitive channels from Lactococcus lactis were determined by biochemical, physiological, and electrophysiological methods. Patch-clamp studies showed that the genes yncB and mscL encode MscS and MscL-like channels, respectively, when expressed in Escherichia coli or if the gene products were purified and reconstituted in proteoliposomes. However, unless yncB was expressed in trans, wild type membranes of L. lactis displayed only MscL activity. Membranes prepared from an mscL disruption mutant did not show any mechanosensitive channel activity, irrespective of whether the cells had been grown on low or high osmolarity medium. In osmotic downshift assays, wild type cells survived and retained 20% of the glycine betaine internalized under external high salt conditions. On the other hand, the mscL disruption mutant retained 40% of internalized glycine betaine and was significantly compromised in its survival upon osmotic downshifts. The data strongly suggest that L. lactis uses MscL as the main mechanosensitive solute release system to protect the cells under conditions of osmotic downshift. The functions of the mechanosensitive channels from Lactococcus lactis were determined by biochemical, physiological, and electrophysiological methods. Patch-clamp studies showed that the genes yncB and mscL encode MscS and MscL-like channels, respectively, when expressed in Escherichia coli or if the gene products were purified and reconstituted in proteoliposomes. However, unless yncB was expressed in trans, wild type membranes of L. lactis displayed only MscL activity. Membranes prepared from an mscL disruption mutant did not show any mechanosensitive channel activity, irrespective of whether the cells had been grown on low or high osmolarity medium. In osmotic downshift assays, wild type cells survived and retained 20% of the glycine betaine internalized under external high salt conditions. On the other hand, the mscL disruption mutant retained 40% of internalized glycine betaine and was significantly compromised in its survival upon osmotic downshifts. The data strongly suggest that L. lactis uses MscL as the main mechanosensitive solute release system to protect the cells under conditions of osmotic downshift. Mechanosensitive channels play an important role in prokaryotic cell volume regulation (1Hamill O.P. Martinac B. Physiol. Rev. 2001; 81: 685-740Crossref PubMed Scopus (928) Google Scholar). In small, single-cell organisms, this regulation can mean the difference between life and death under extreme osmotic downshift conditions. By diffusion over the semipermeable cell membrane and/or aquaporins embedded in the membrane, water can enter and leave the cell until equilibrium is established between internal and external osmolality. This allows microorganisms to adapt to changes in external osmolyte concentrations. When the external osmolyte concentrations increase (hyperosmotic stress), water will leak out of the cell, causing loss of turgor, and ultimately the cell may plasmolyse. Bacteria respond to this hyperosmotic stress by rapid uptake of ions (K+) and/or compatible solutes or increasing the intracellular osmolyte concentration through synthesis of compatible solutes. The increase in internal compatible solute concentration compensates for the high external osmolality, allowing water to diffuse back and the cell to regain its original volume and turgor (2Wood J.M. Bremer E. Csonka L.N. Kraemer R. Poolman B. van der H.T. Smith L.T. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 2001; 130: 437-460Crossref PubMed Scopus (364) Google Scholar, 3Morbach S. Kramer R. Chembiochem. 2002; 3: 384-397Crossref PubMed Scopus (86) Google Scholar, 4Poolman B. Blount P. Folgering J.H.A. Friesen R.H. Moe P.C. van der Heide T. Mol. Microbiol. 2002; 44: 889-902Crossref PubMed Scopus (111) Google Scholar). Conversely, when the external osmolyte concentration suddenly decreases, water will diffuse into the cell, causing it to swell and, in extreme conditions, lyse. This is where the mechanosensitive channels are thought to play a role by opening in response to the increased membrane tension effected by the rapid increase in cell volume. The best known example of a channel in this role is the mechanosensitive channel of large conductance from Escherichia coli (MscLEc), but homologues are present in most eubacteria (5Moe P.C. Blount P. Kung C. Mol. Microbiol. 1998; 28: 583-592Crossref PubMed Scopus (113) Google Scholar, 6Maurer J.A. Elmore D.E. Lester H.A. Dougherty D.A. J. Biol. Chem. 2000; 275: 22238-22244Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar, 7Sukharev S.I. Blount P. Martinac B. Blattner F.R. Kung C. Nature. 1994; 368: 265-268Crossref PubMed Scopus (590) Google Scholar). MscL opens near the lytic tension limit of the bacterial membrane. A second mechano-sensitive channel, that of small conductance, MscS, has been characterized in only a few organisms (8Sukharev S.I. Martinac B. Arshavsky V.Y. Kung C. Biophys. J. 1993; 65: 177-183Abstract Full Text PDF PubMed Scopus (258) Google Scholar, 9Ruffert S. Berrier C. Kramer R. Ghazi A. J. Bacteriol. 1999; 181: 1673-1676Crossref PubMed Google Scholar). MscS opens at lower membrane tensions and has a smaller conductance than MscL, making it useful for fine regulation of internal compatible solute concentration. Crystal structures of MscL and MscS are available (10Chang G. Spencer R.H. Lee A.T. Barclay M.T. Rees D.C. Science. 1998; 282: 2220-2226Crossref PubMed Scopus (859) Google Scholar, 11Bass R.B. Strop P. Barclay M. Rees D.C. Science. 2002; 298: 1582-1587Crossref PubMed Scopus (497) Google Scholar). The electrophysiological characteristics of MscS from E. coli (12Levina N. Totemeyer S. Stokes N.R. Louis P. Jones M.A. Booth I.R. EMBO J. 1999; 18: 1730-1737Crossref PubMed Scopus (553) Google Scholar) and of a number of MscL homologues (5Moe P.C. Blount P. Kung C. Mol. Microbiol. 1998; 28: 583-592Crossref PubMed Scopus (113) Google Scholar) have been described. So far, their physiological roles in osmoprotection are not fully understood. Previously, we have established the mechanism of the osmotic regulation of the upshift-activated glycine betaine transporter OpuA from Lactococcus lactis (13van der Heide T. Poolman B. J. Bacteriol. 2000; 182: 203-206Crossref PubMed Scopus (57) Google Scholar, 14van der Heide T. Stuart M.C. Poolman B. EMBO J. 2001; 20: 7022-7032Crossref PubMed Scopus (126) Google Scholar). Although the physicochemical properties of the membrane and lipid-protein interactions also play a critical role in the osmotic activation of OpuA, the mechanism is entirely different from that underlying the gating of MS 1The abbreviations used are: MS, mechanosensitive; GUV, giant unilamellar vesicle; MTSET, [2-(trimethylammonium)ethyl] methanethiosulfonate; CFU, colony-forming units; CDM, chemically defined medium; RT, reverse transcription; MALDI-TOF, matrix-assisted laser desorption ionization time-of-flight. channels. We have shown that increasing internal ionic strength, a consequence of osmotic upshift, activates OpuA by altering the electrostatic interactions between anionic lipids and charged residues at the cytoplasmatic face of the protein (15Poolman B. Spitzer J.J. Wood J.M. Biochim. Biophys. Acta. 2004; 1666: 88-104Crossref PubMed Scopus (134) Google Scholar). For a better understanding of the total osmoregulatory response of L. lactis, we present here the electrophysiological and biochemical characterization of L. lactis MscL (MscLLl; 45.4% identity with MscLEc; Fig. 1A) and YncB (hereafter referred to as MscSLl; 24.0% identity with MscS from E. coli; Fig. 1B) and show that MscLLl is critical for protection of L. lactis against osmotic downshifts. In fact, the majority of glycine betaine, accumulated upon upshift activation of OpuA, seems to exit the cell via MscLLl upon subsequent osmotic downshift. We also examined the expression of the opuA, mscL, and yncB genes during cell growth under low and high salt conditions. Experiments were performed using the strains listed in Table I and plasmids listed in Table II. E. coli strains were grown in Luria broth, with 100 μg/ml ampicillin when required. L. lactis cells were grown in M17 broth (Difco) or chemically defined medium (27Poolman B. Konings W.N. J. Bacteriol. 1988; 170: 700-707Crossref PubMed Google Scholar) supplemented with 25 mm glucose and 365 mm KCl for high salt conditions (1050 mosmol/kg). Chloramphenicol (5 μg/ml) or erythromycin (5 μg/ml) was added when the cells were transformed with plasmids. For growth on solid medium, 1.5% (w/v) agar was added to the broth.Table IBacterial strains and their relevant genotypesStrainRelevant genotypeReferenceE. coliPB104E. coli AW405, ΔmscL::Cmres recA-16Ou X. Blount P. Hoffman R.J. Kung C. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 11471-11475Crossref PubMed Scopus (168) Google ScholarMJF465E. coli Frag1, ΔmscL::Cmres, ΔyggB, ΔkefA::kanres12Levina N. Totemeyer S. Stokes N.R. Louis P. Jones M.A. Booth I.R. EMBO J. 1999; 18: 1730-1737Crossref PubMed Scopus (553) Google ScholarJM110dam-, dcm-17Yanisch-Perron C. Vieira J. Messing J. Gene (Amst.). 1985; 33: 103-119Crossref PubMed Scopus (11465) Google ScholarL. lactisIL1403Plasmid-free strain18Chopin A. Chopin M.C. Moillo-Batt A. Langella P. Plasmid. 1984; 11: 260-263Crossref PubMed Scopus (299) Google ScholarMG1363Plasmid-free strain19Gasson M.J. J. Bacteriol. 1983; 154: 1-9Crossref PubMed Google ScholarNZ9000MG1363 pepN::nisR nisK20de Ruyter P.G. Kuipers O.P. de Vos W.M. Appl. Environ. Microbiol. 1996; 62: 3662-3667Crossref PubMed Google ScholarJIM7049IL1403 his::nisR nisK21Drouault S. Corthier G. Ehrlich S.D. Renault P. Appl. Environ. Microbiol. 2000; 66: 588-598Crossref PubMed Scopus (52) Google ScholarJIM7049ΔMscLIL1403 his::nisR nisK; MscL::EmresThis workLl108RepA+ MG1363, carrying multiple copies of pWVO1 repA in the chromosome, Cmres22Leenhouts K. Buist G. Bolhuis A. ten Berge A. Kiel J. Mierau I. Dabrowska M. Venema G. Kok J. Mol. Gen. Genet. 1996; 253: 217-224Crossref PubMed Scopus (262) Google Scholar Open table in a new tab Table IIList of plasmids used in this study and their characteristicsPlasmidRelevant characteristicsReferencepBlueScriptβ-Galactosidase α-complementation; XbaI, XhoI in multiple cloning site; Ampres23Alting-Mees M.A. Short J.M. Nucleic Acids Res. 1989; 17: 9494Crossref PubMed Scopus (276) Google ScholarpB10bpBR322 ori; lacUV5 promoter; XbaI, XhoI in multiple cloning site; Ampres16Ou X. Blount P. Hoffman R.J. Kung C. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 11471-11475Crossref PubMed Scopus (168) Google ScholarpBADpBR322 ori; PBAD promoter; NcoI, HindIII in multiple cloning site; Ampres24Guzman L.M. Belin D. Carson M.J. Beckwith J. J. Bacteriol. 1995; 177: 4121-4130Crossref PubMed Scopus (3960) Google ScholarpB10bmscLLlpB10b with L.lactis mscL inserted in XbaI, XhoIThis workpB10bmscLLl6HpB10b with L. lactis mscL, and sequence coding for a C-terminal 6-histidine tag, inserted in XbaI, XhoIThis workpB10bmscLLl6H G20CpB10BMscLLl6H G20CThis workpB10bmscLLl6H V21CpB10BMscLLl6H V21CThis workpB10bmscLLl6H I22CpB10BMscLLl6H G22CThis workpB10bmscLLl6H I23CpB10BMscLLl6H V23CThis workpBADyncB10HpBAD with L. lactis yncB, and sequence coding for a C-terminal 10-histidine tag, inserted; in NcoI, HindIIIThis workpET324pBR322 ori; lacUV5 promoter; NcoI, HindIII in multiple cloning site; Ampres25van der Does C. den Blaauwen T. de Wit J.G. Manting E.H. Groot N.A. Fekkes P. Driessen A.J. Mol. Microbiol. 1996; 22: 619-629Crossref PubMed Scopus (81) Google ScholarpET324yncB10HpET324 with L. lactis yncB, and sequence coding for a C-terminal 10 histidine tag inserted; in NcoI, HindIIIThis workpNZ8020pSH71 replicon; nisA promoter; XbaI XhoI in multiple cloning site; Cmres20de Ruyter P.G. Kuipers O.P. de Vos W.M. Appl. Environ. Microbiol. 1996; 62: 3662-3667Crossref PubMed Google ScholarpNZ8020mscLLl6HpNZ8020 with L. lactis mscL, and sequence coding for a C-terminal 6-histidine tag; inserted in XbaI, XhoIThis workpNZ8048pSH71 replicon; nisA promoter, NcoI, HindIII in multiple cloning site; Cmres26Kuipers O.P. de Ruyter P.G.G.A. Kleerebezem M. de Vos W.M. J. Biotechnol. 1998; 64: 15-21Crossref Scopus (576) Google ScholarpNZ8048yncB10HpNZ8048 with L. lactis yncB, and sequence coding for a C-terminal 10-histidine tag; inserted in NcoI, HindIIIThis workpOri280pWV01-derivative; repA-, replicates only in strains that carry repA in trans; Emres22Leenhouts K. Buist G. Bolhuis A. ten Berge A. Kiel J. Mierau I. Dabrowska M. Venema G. Kok J. Mol. Gen. Genet. 1996; 253: 217-224Crossref PubMed Scopus (262) Google ScholarpOri280ΔMscLLlpOri280 with an internal fragment of mscLLl inserted in XbaI, BamHI; EmresThis work Open table in a new tab The primers that were used for the amplification of mscL and yncB are listed in Table III. Since the yncB gene product is homologous to MscS from E. coli and functions similarly, the YcnB protein is referred to as MscSLl. The superscripts Ll and Ec will be used to denote genes or proteins from L. lactis and E. coli, respectively. For PCR amplifications, Expand High-Fidelity DNA polymerase (Roche Applied Science) was used, and reactions were performed according to the manufacturer's instructions. Chromosomal DNA of L. lactis IL1403 was used as template, the annealing temperature was 50 °C for mscLLl and 53 °C for yncB, and the elongation times were 30 and 60 s, respectively. For the histidine-tagged version of MscLLl, a two-step PCR was performed using primers LL.SD.5′ and LL.SD.4H3′ (see Table III) to introduce a 4-histidine tag, and then a second step was used to engineer another two histidines, a stop codon and a restriction site for cloning.Table IIIPrimers used in this studyNameSequenceFW WT MscLLl5′-TCTAGATCTAGATATTATATAGGATTTATGTTAAREV WT MscLLl5′-GAGCTCGAGCTCGGGCTAGAGGGAGTTTGGTTAGCLL.SD.5′5′-TCTAGATCTAGAAGGAGGAGCCATGGTAAAGGAATTTAAAAACLL.SD.4H3′5′-GTGATGGTGATGTTGTTTTTTCAATAAATCGCGAATTTCLL.SD.6H3′5′-CTCGAGCTCGAGTTAGTGATGGTGATGGTGATGTTGTTTTTTCAATAyncB FW5′-ATATATCCATGGACTTATTAAAAACAAACTGGGAAyncB REV5′-ATATATAAGCTTAATGGTGATGGTGATGGTGTTTTTCATAATATTTATCTAAAATCTCCG20C5′-GGGAACGTATTGGACTTAGCCGTTTGTGTTATCATCGGGGCAGV21C5′-GGGAACGTATTGGACTTAGCCGTTGGGTGTATCATCGGGGCAGI22C5′-GGGAACGTATTGGACTTAGCCGTTTGTGTTTGTATCGGGGCAGI23C5′-GGGAACGTATTGGACTTAGCCGTTGGGGTTATCTGTGGGGCAGDIS FW5′-CTGGCGTCTAGAGGGAACGTATTGGACTTAGCCGDIS REV5′-CCGGCCGGATCCAAGAATGAAAATAACAAAGGCRT-YncB fw5′-CTCTATCAAGCCGGCTCTCGRT-YncB rev5′-GAGGGCAGCAATATTTCGATTAGGRT-MscL fw5′-GGGAACGTATTGGACTTAGCCGRT-MscL rev5′-CGCGAATTTCTTGGAGAGTTTCCRT-Opu fw5′-CGCGCAGAGAAGGCCTTAGRT-Opu rev5′-CAGCCATTAGAGAGCTGACC Open table in a new tab The mscLLl and mscLLl6H genes were first subcloned in pBluescript, isolated from E. coli JM110, using the XhoI-XbaI restriction sites. This construct was used to transform JM110, and after plasmid isolation, the genes were excised from the pBluescript vector and ligated into pNZ8020 and pB10b again using the XhoI-XbaI restriction sites. The resulting plasmids pNZ8020mscLLl6H and pB10bmscLLl were then used to transform L. lactis JIM7049 and E. coli PB104, respectively. YncB10H was ligated directly after PCR into the vectors pNZ8048, pET324, and pBAD and used to transform L. lactis IL1403 and E. coli JM465, respectively. Finally, all constructs were midi-prepped (Qiagen), and the DNA sequence was analyzed to confirm fidelity. The primers used for the construction of the mutants of MscLLl are listed in Table III. The cysteine mutants were constructed using pB10bmscLLl6H as template. First, LL.SD.6H3′ was combined with the primer for the specific mutant to create a megaprimer, which in a second amplification step was combined with LL.SD.5′ to obtain the complete mscL sequence with the desired cysteine modification. All other conditions were as described above for the cloning of MscL6H. For the construction of the L. lactis JIM7049 mscL disruption strain, an internal gene fragment, from codon 12 to codon 86, was amplified. From earlier studies with truncation mutants of E. coli MscL, it could be predicted that a disruption with this gene fragment should lead to complete inactivation of MscL (28Blount P. Sukharev S.I. Schroeder M.J. Nagle S.K. Kung C. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 11652-11657Crossref PubMed Scopus (181) Google Scholar). The amplification was performed using the same conditions as described above for amplification of mscL6H. The internal gene fragment was ligated in pOri280, using the XbaI and BamHI restriction sites. The vector was hosted in L. lactis Ll108 for propagation of the plasmid, and, after confirmation of the DNA sequence, the plasmid was introduced into L. lactis JIM7049. The cells were grown on M17-glucose solid medium, supplemented with erythromycin (5 μg/ml) to select for colonies that harbored the plasmid DNA integrated into the chromosome (22Leenhouts K. Buist G. Bolhuis A. ten Berge A. Kiel J. Mierau I. Dabrowska M. Venema G. Kok J. Mol. Gen. Genet. 1996; 253: 217-224Crossref PubMed Scopus (262) Google Scholar). The mscL disruption strain is designated JIM7049ΔMscL. Cells were grown to the midexponential phase of growth on CDM and diluted 1:1 to CDM without NaCl or CDM plus 0.5 m NaCl (final concentration) and harvested 10 min after dilution. RNA was extracted as described (29Hamoen L.W. Smits W.K. de Jong A. Holsappel S. Kuipers O.P. Nucleic Acids Res. 2002; 30: 5517-5528Crossref PubMed Scopus (113) Google Scholar) at concentrations of 4–5 μg/μl. The RNA was used as template for the avian myeloblastosis virus reverse transcriptase, using the first strand cDNA synthesis kit for RT-PCR (Roche Applied Science), according to the manufacturer's instructions and in the presence of the supplied random hexanucleotide primers. The obtained cDNA was subsequently used as template in a PCR with Taq polymerase using the RT-MscL, RT-MscS, and RT-OpuA forward (fw) and reverse (rev) primers listed in Table III. The primers were designed to amplify internal gene fragments of 316 (bp 34–349 of mscL), 418 (bp 94–513 of yncB), and 502 (bp 430–931 of opuAA) base pairs. For PCR amplification, the annealing temperature was 50 °C, and the elongation time was 60 s. The products were analyzed on a 1.5% agarose gel after 15 and 22 cycles. As a control, the PCR was also performed on chromosomal DNA of L. lactis; as a negative control, the RNA samples were treated in exactly the same manner, except that the avian myeloblastosis virus reverse transcriptase was omitted in the reaction with RNA as template. Hybrid Proteo-GUVs—L. lactis NZ9000 containing pNZ8020mscLLl6H was grown in M17-glucose medium to an A600 of 0.8, after which mscL expression was induced for 3 h with a 1:1000 dilution of the supernatant of a culture from the nisinA-producing L. lactis NZ9700 strain (20de Ruyter P.G. Kuipers O.P. de Vos W.M. Appl. Environ. Microbiol. 1996; 62: 3662-3667Crossref PubMed Google Scholar). Inside-out membrane vesicles were prepared by lysing the bacteria (20 mg/ml protein) with a high pressure homogenizer (Kindler type NN2002; single passage at 10,000 p.s.i.), following (partial) digestion of the cell wall with 10 mg/ml lysozyme for 30 min at 30 °C. After removing unlysed cells and cell wall debris by centrifugation at 20,000 × g, the membrane vesicles were washed once by centrifugation at 150,000 × g and then resuspended in 50 mm KPi, pH 6.5. Aliquots of 0.5 ml were frozen in liquid nitrogen and stored at –80 °C. The membrane vesicles were mixed with liposomes (2:25 (w/w) total membrane protein/lipid ratio), centrifuged at 270,000 × g, and resuspended in 5% ethylene glycol and dehydrated on a glass slide. To obtain fused proteo-GUVs, rehydration was performed by placing rehydration buffer (200 mm KCl, 0.1 mm EDTA, 0.01 mm CaCl2 plus 5 mm HEPES, pH 7.2) on top of the dried membranes to obtain a final lipid concentration of 100 mg/ml as described (30Blount P. Sukharev S.I. Moe P.C. Martinac B. Kung C. Methods Enzymol. 1999; 294: 458-482Crossref PubMed Scopus (119) Google Scholar). Alternatively, after drying on glass slides coated with indium tin oxide, hybrid proteo-GUVs were obtained by rehydration in a flow chamber with 300 μl of 10 mm KCl, 2 mm MgCl2, 0.25 mm HEPES, pH 7.2, plus 320 mm sucrose (the sucrose was added to make the rehydration medium equiosmolar to the buffer for patch clamp analysis). The flow chamber was closed with a second indium tin oxide-coated glass slide. A voltage of 1.2 V at 10 Hz was applied for at least 3 h through electrodes sealed on the glass plates. The resulting giant unilamellar vesicles (GUVs), 5–50 μm in diameter, were used in patch clamp experiments (31Folgering J.H.A. Kuiper J.M. de Vries A.H. Engberts J.B.F.N. Poolman B. Langmuir. 2004; 20: 6985-6987Crossref PubMed Scopus (46) Google Scholar). Proteo-GUVs—Membrane vesicles, containing overexpressed channel protein (MscLLl or MscSLl), were solubilized in 50 mm KPi, 35 mm imidazole, 300 mm NaCl, pH 7.0, plus 3% octyl-β-d-glucoside (Anatrace) at 4 °C for 20 min and under continuous stirring of the suspension. The solubilized proteins and remaining membrane material were separated by ultracentrifugation at 270,000 × g for 20 min at 4 °C. The supernatant was then loaded onto nickel-nitrilotriacetic acid affinity resin pre-equilibrated with solubilization buffer. The column was washed with 20–30 volumes of solubilization buffer containing 0.5% Triton X-100, after which the proteins were eluted with 50 mm KPi, 300 mm NaCl, pH 7.0, plus 0.2% Triton X-100 with a step gradient of imidazole. The purified proteins were mixed with Triton X-100-destabilized preformed liposomes (10 mg/ml lipid); the lipid mixtures were composed of dioleoyl 18:1 (Δ9 cis) phospholipids (dioleoylphosphatidylcholine, dioleoylphosphatidylethanolamine, and/or dioleoylphosphatidylserine), typically at protein/lipid ratios of 1:2000–20,000 (mol of monomeric channel protein/mol of lipid), and reconstitutions were performed as described (32Knol J. Sjollema K. Poolman B. Biochemistry. 1998; 37: 16410-16415Crossref PubMed Scopus (137) Google Scholar). The proteoliposomes were converted to proteo-GUVs by dehydration and rehydration in the presence or absence of an electrical field, as described under “Hybrid Proteo-GUVs.” Spheroplasts—For determination of pressure ratios, relative to MscSEc, of MscLLl and the individual cysteine mutants, giant spheroplasts were prepared from E. coli PB104 containing pB10bmscLLl6H or its derivatives. For other channel characteristics, giant spheroplasts were prepared from E. coli MJF465 containing pB10bmscLLl, pB10bmscLLl6H, or pET324yncB10H. All spheroplasts were prepared as described (30Blount P. Sukharev S.I. Moe P.C. Martinac B. Kung C. Methods Enzymol. 1999; 294: 458-482Crossref PubMed Scopus (119) Google Scholar). Experiments were performed as described previously (30Blount P. Sukharev S.I. Moe P.C. Martinac B. Kung C. Methods Enzymol. 1999; 294: 458-482Crossref PubMed Scopus (119) Google Scholar). After preparation, an aliquot of proteo-GUVs or 1–5 μl of a spheroplast sample was transferred to a sample chamber containing a ground electrode and 300 μl of patch clamp buffer: 5 mm HEPES, pH 7.2, 200 mm KCl, 40 mm MgCl2 for proteo-GUVs; 5 mm HEPES, pH 7.2, 200 mm KCl, 90 mm MgCl2, 10 mm CaCl2 for spheroplasts. Channel activity was recorded using an Axopatch 200A amplifier together with a digital converter and Axoscope software (Axon Instruments, Foster City, CA). Data were acquired at a sampling rate of 33 kHz and filtered at 10 kHz. The presented traces were additionally filtered to decrease electronic noise, using Clampfit 8.0 software (Axon Instruments) with the low pass Boxcar filter at smoothing point 7. Offline analysis was performed using PClamp 6.0 software (Axon Instruments). Glycine betaine efflux was performed as described (13van der Heide T. Poolman B. J. Bacteriol. 2000; 182: 203-206Crossref PubMed Scopus (57) Google Scholar) with some modifications. Cells were grown overnight to late log phase in high osmolality medium (1050 mosmol/kg) and washed three times in their original volume with an equimosmolar buffer (50 mm KPi, 500 mm KCl, pH 6.5). The cells were then resuspended to a protein concentration of ∼10 mg/ml and stored on ice. For uptake of glycine betaine, the cells were diluted 10-fold in 50 mm KPi, pH 6.5, 500 mm KCl, supplemented with 10 mm glucose and 1.88 mm of [14C]glycine betaine. After 40 min of uptake at 30 °C, aliquots of the cells were subjected to no dilution or a 3-, 5-, 10-, 20-, 50-, and 100-fold dilution into 50 mm KPi, pH 6.5. This resulted in final osmolalities of 1050, 420, 295, 200, 155, 125, and 115 mosmol/kg, respectively. Samples were taken in 5-fold to determine the steady state internal glycine betaine concentrations prior to the osmotic downshift (final internal glycine betaine content) and at different time intervals (at 1 (in duplicate), 5, 10, and 30 min) after each of the downshifts. At least three independent uptake and downshift experiments were performed on three independent cultures of L. lactis IL1403 and JIM7049ΔMscL. The steady state levels of internalized glycine betaine after uptake were ∼900 nmol/mg protein for both strains. Release is plotted as a percentage of retained glycine betaine. Survival of E. coli MJF465, carrying pB10bmscLLl6H, pET324yncB10H, or empty plasmid controls, under osmotic downshift conditions, was analyzed as described (12Levina N. Totemeyer S. Stokes N.R. Louis P. Jones M.A. Booth I.R. EMBO J. 1999; 18: 1730-1737Crossref PubMed Scopus (553) Google Scholar). Because E. coli MJF465 is not able to use arabinose as an energy source and glucose represses the expression of the arabinose-inducible system, the isopropyl 1-thio-β-d-galactopyranoside-inducible construct pET324yncB10H was used here. The cysteine mutants were screened for survival with, and without, MTSET as described (33Batiza A.F. Kuo M.M. Yoshimura K. Kung C. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 5643-5648Crossref PubMed Scopus (58) Google Scholar). For survival under osmotic downshift conditions of L. lactis IL1403 or JIM7049ΔMscL, cells were grown overnight in chemically defined medium (27Poolman B. Konings W.N. J. Bacteriol. 1988; 170: 700-707Crossref PubMed Google Scholar), supplemented with 25 mm glucose and 5 μg/ml erythromycin (where applicable), and diluted 1:100 to the same medium supplemented with 365 mm KCl (1050 mosmol/kg). Cells were allowed to grow to an A600 of ∼0.8 and then diluted 100-fold into 50 mm KPi, pH 6.5, plus 500 mm KCl (1050 mosmol/kg) or into 50 mm KPi, pH 6.5 (final osmolality of 115 mosmol/kg). Prior to plating onto agar-containing media, the cells were diluted serially with sterile equimosmolar buffers, all prewarmed to 30 °C. To determine cell viability, 20-μl samples were spotted onto equimosmolar CDM agar plates and incubated for 36 h at 30 °C before the number of colony-forming units (CFU) was determined. Because L. lactis grows in chains, the number of CFU is not necessarily a quantitative indicator of the survival of cells after downshift. Therefore, metabolic activity based on the production of acid by L. lactis during fermentation of glucose was also determined. The method was adapted from Ref. 34Pearce L.E. N. Z. J. Dairy Sci. Technol. 1969; 4: 246-247Google Scholar. In brief, cells were cultured, washed, and osmotically stressed as described above for the glycine betaine efflux assay, but with 5 mm KPi, pH 6.5, and 65 mm KCl (105 mosmol/kg) instead of 50 mm KPi buffer (105 mosmol/kg) to reduce the buffering capacity. Acidification rates per mg of total protein in the presence of 10 mm glucose were determined for all samples and compared with the acidification rates of the unshocked sample (100% value). Protein Biochemistry—Purified proteins were analyzed on 15% acrylamide SDS-PAGE (35Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207233) Google Scholar). Protein concentration was determined by Amido Black 10B staining as described (36Schaffner W. Weissmann C. Anal. Biochem. 1973; 56: 502-514Crossref PubMed Scopus (1953) Google Scholar). MscL was also identified and analyzed for potential modifications or proteolysis products by MALDI-TOF mass spectrometry as described (37van Montfort B.A. Doeven M.K. Canas B. Veenhoff L.M. Poolman B. Robillard G.T. Biochim. Biophys. Acta. 2002; 1555: 111-115Crossref PubMed Scopus (59) Google Scholar). The MscL– phenotype of L. lactis JIM7049ΔMscL was checked by preparation of cell membranes and subsequent SDS-PAGE analysis. The presence or absence of MscLLl was determined by immunodetection using specific rabbit serum with polyclonal antibodies raised against MscLLl (at a titer of 1:30,000) and the Western light chemiluminescence detection kit (Tropix Inc., Bedford, MA). Determination of Osmolality—Osmolalities of media and buffers were measured by freezing point depression with an Osmostat 030 (Gonotec, Berlin). Cloning and expression of mscLLl and yncBLl was achieved in both E. coli (not shown) and L. lactis (Fig. 2A). For amplification of MscLLl and MscSLl in L. lactis, the nisin-inducible expression system was used (38Kunji E.R. Slotboom D.J. Poolman B. Biochim. Biophys. Acta. 2003; 1610: 97-108Crossref PubMed Scopus (163) Google Scholar). In E. coli, the lacUV5 promoter system was used for amplification of MscLLl, and the arabinose-inducible system was used for amplification of MscS (24Guzman L.M. Belin D. Carson M.J. Beckwith J. J. Bacteriol. 1995; 177: 4121-4130Crossref PubMed Scopus (3960) Google Scholar). MscLLl-6H and MscSLl-10H were purified by nickel-nitrilotriacetic acid chromatography. Based on the yield of purified protein, both channels were found to be amplified in L. lactis to levels between 5 an" @default.
• W2163130355 created "2016-06-24" @default.
• W2163130355 creator A5003735271 @default.
• W2163130355 creator A5015312012 @default.
• W2163130355 creator A5034416999 @default.
• W2163130355 creator A5035780015 @default.
• W2163130355 creator A5066283247 @default.
• W2163130355 date "2005-03-01" @default.
• W2163130355 modified "2023-10-14" @default.
• W2163130355 title "Lactococcus lactis Uses MscL as Its Principal Mechanosensitive Channel" @default.
• W2163130355 cites W1964338435 @default.
• W2163130355 cites W1973893063 @default.
• W2163130355 cites W1982363035 @default.
• W2163130355 cites W1983251302 @default.
• W2163130355 cites W1988064931 @default.
• W2163130355 cites W1991634127 @default.
• W2163130355 cites W1995019921 @default.
• W2163130355 cites W2003898032 @default.
• W2163130355 cites W2006904414 @default.
• W2163130355 cites W2007168806 @default.
• W2163130355 cites W2014895510 @default.
• W2163130355 cites W2018442629 @default.
• W2163130355 cites W2019931636 @default.
• W2163130355 cites W2023405416 @default.
• W2163130355 cites W2028622989 @default.
• W2163130355 cites W2032204995 @default.
• W2163130355 cites W2050824601 @default.
• W2163130355 cites W2056248793 @default.
• W2163130355 cites W2063941585 @default.
• W2163130355 cites W2070363777 @default.
• W2163130355 cites W2071686704 @default.
• W2163130355 cites W2075956033 @default.
• W2163130355 cites W2082497364 @default.
• W2163130355 cites W2088223903 @default.
• W2163130355 cites W2091198203 @default.
• W2163130355 cites W2097648928 @default.
• W2163130355 cites W2100791996 @default.
• W2163130355 cites W2100837269 @default.
• W2163130355 cites W2102978118 @default.
• W2163130355 cites W2103533712 @default.
• W2163130355 cites W2123509606 @default.
• W2163130355 cites W2123642970 @default.
• W2163130355 cites W2132644314 @default.
• W2163130355 cites W2133068735 @default.
• W2163130355 cites W2144025469 @default.
• W2163130355 cites W2147245370 @default.
• W2163130355 cites W2147869016 @default.
• W2163130355 cites W2154945333 @default.
• W2163130355 cites W2159326749 @default.
• W2163130355 cites W2159958561 @default.
• W2163130355 cites W2160084442 @default.
• W2163130355 cites W2161039496 @default.
• W2163130355 cites W2172246975 @default.
• W2163130355 cites W2320446518 @default.
• W2163130355 doi "https://doi.org/10.1074/jbc.m411732200" @default.
• W2163130355 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/15613476" @default.
• W2163130355 hasPublicationYear "2005" @default.
• W2163130355 type Work @default.
• W2163130355 sameAs 2163130355 @default.
• W2163130355 citedByCount "38" @default.
• W2163130355 countsByYear W21631303552012 @default.
• W2163130355 countsByYear W21631303552013 @default.
• W2163130355 countsByYear W21631303552014 @default.
• W2163130355 countsByYear W21631303552015 @default.
• W2163130355 countsByYear W21631303552016 @default.
• W2163130355 countsByYear W21631303552018 @default.
• W2163130355 countsByYear W21631303552019 @default.
• W2163130355 countsByYear W21631303552020 @default.
• W2163130355 countsByYear W21631303552022 @default.
• W2163130355 crossrefType "journal-article" @default.
• W2163130355 hasAuthorship W2163130355A5003735271 @default.
• W2163130355 hasAuthorship W2163130355A5015312012 @default.
• W2163130355 hasAuthorship W2163130355A5034416999 @default.
• W2163130355 hasAuthorship W2163130355A5035780015 @default.
• W2163130355 hasAuthorship W2163130355A5066283247 @default.
• W2163130355 hasBestOaLocation W21631303551 @default.
• W2163130355 hasConcept C111919701 @default.
• W2163130355 hasConcept C12554922 @default.
• W2163130355 hasConcept C144559511 @default.
• W2163130355 hasConcept C170493617 @default.
• W2163130355 hasConcept C185592680 @default.
• W2163130355 hasConcept C2775920511 @default.
• W2163130355 hasConcept C2780011460 @default.
• W2163130355 hasConcept C2780913471 @default.
• W2163130355 hasConcept C4001165 @default.
• W2163130355 hasConcept C41008148 @default.
• W2163130355 hasConcept C50254741 @default.
• W2163130355 hasConcept C523546767 @default.
• W2163130355 hasConcept C54355233 @default.
• W2163130355 hasConcept C55493867 @default.
• W2163130355 hasConcept C86803240 @default.
• W2163130355 hasConcept C89423630 @default.
• W2163130355 hasConceptScore W2163130355C111919701 @default.
• W2163130355 hasConceptScore W2163130355C12554922 @default.
• W2163130355 hasConceptScore W2163130355C144559511 @default.
• W2163130355 hasConceptScore W2163130355C170493617 @default.
• W2163130355 hasConceptScore W2163130355C185592680 @default.
• W2163130355 hasConceptScore W2163130355C2775920511 @default.

• next