FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2163158796> ?p ?o ?g. }

• W2163158796 endingPage "28285" @default.
• W2163158796 startingPage "28277" @default.
• W2163158796 abstract "We have recently identified a mouse enzyme termed γ-glutamyl leukotrienase (GGL) that converts leukotriene C4 (LTC4) to leukotriene D4(LTD4). It also cleaves some other glutathione (GSH) conjugates, but not GSH itself (Carter, B. Z., Wiseman, A. L., Orkiszewski, R., Ballard, K. D., Ou, C.-N., and Lieberman, M. W. (1997) J. Biol. Chem. 272, 12305–12310). We have now cloned a full-length mouse cDNA coding for GGL activity and the corresponding gene. GGL and γ-glutamyl transpeptidase constitute a small gene family. The two cDNAs share a 57% nucleotide identity and 41% predicted amino acid sequence identity. Their corresponding genes have a similar intron-exon organization and are located 3 kilobases apart. A search of Genbank and reverse transcription-polymerase chain reaction analysis failed to identify additional family members. Mapping of the GGL transcription start site revealed that the GGL promoter is TATA-less but contains an initiator, a control element for transcription initiation. Northern blots for GGL expression were negative. As judged by ribonuclease protection,in situ hybridization, and measurement of enzyme activity, spleen had the highest level of GGL expression. GGL is also expressed in thymic lymphocytes, bronchiolar epithelial cells, pulmonary interstitial cells, renal proximal convoluted tubular cells, and crypt cells of the small intestine as well as in cerebral, cerebellar, and brain stem neurons but not in glial cells. GGL is widely distributed in mice, suggesting an important role for this enzyme. We have recently identified a mouse enzyme termed γ-glutamyl leukotrienase (GGL) that converts leukotriene C4 (LTC4) to leukotriene D4(LTD4). It also cleaves some other glutathione (GSH) conjugates, but not GSH itself (Carter, B. Z., Wiseman, A. L., Orkiszewski, R., Ballard, K. D., Ou, C.-N., and Lieberman, M. W. (1997) J. Biol. Chem. 272, 12305–12310). We have now cloned a full-length mouse cDNA coding for GGL activity and the corresponding gene. GGL and γ-glutamyl transpeptidase constitute a small gene family. The two cDNAs share a 57% nucleotide identity and 41% predicted amino acid sequence identity. Their corresponding genes have a similar intron-exon organization and are located 3 kilobases apart. A search of Genbank and reverse transcription-polymerase chain reaction analysis failed to identify additional family members. Mapping of the GGL transcription start site revealed that the GGL promoter is TATA-less but contains an initiator, a control element for transcription initiation. Northern blots for GGL expression were negative. As judged by ribonuclease protection,in situ hybridization, and measurement of enzyme activity, spleen had the highest level of GGL expression. GGL is also expressed in thymic lymphocytes, bronchiolar epithelial cells, pulmonary interstitial cells, renal proximal convoluted tubular cells, and crypt cells of the small intestine as well as in cerebral, cerebellar, and brain stem neurons but not in glial cells. GGL is widely distributed in mice, suggesting an important role for this enzyme. leukotriene A4 leukotriene C4 leukotriene D4 leukotriene E4 γ-glutamyl transpeptidase γ-glutamyl leukotrienase reverse transcription-polymerase chain reaction rapid amplification of cDNA ends kilobase(s) base pair(s) untranslated region. Glutathione conjugates play a central role in normal physiology and in responses to injury (1Meister A. Larsson A. Scriver C.R. Beaudet A.L. Sly W.S. Velle D. The Metabolic Basis of Inherited Diseases. 7th ed. McGraw-Hill, New York1995: 1461-1477Google Scholar, 2Maycock A.L. Pong S.-S. Evans J.F. Miller D.K. Rokach J. Leukotrienes and Lipoxygenase: Chemical, Biochemical and Clinical Aspects. Elsevier, Amsterdam1989: 143-208Google Scholar, 3Ishikawa T. Trends Biochem. Sci. 1992; 17: 463-468Abstract Full Text PDF PubMed Scopus (568) Google Scholar, 4Pace-Asciak C.R. Laneuville O. Su W.-G. Corey E.J. Gurevich N. Wu P. Carlen P.L. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 3037-3041Crossref PubMed Scopus (49) Google Scholar, 5Parkinson A. Klaassen C.D. Casarett & Doull's Toxicology: The Basic Science of Poisons. 5th ed. McGraw-Hill, New York1996: 113-186Google Scholar, 6Zurier R.B. Kelley W.N. Harris Jr., E.D. Ruddy S. Sledge C.B. Textbook of Rheumatology. Harcourt Brace Jovanovich, Inc., Philadelphia1993: 201-212Google Scholar). Among the more important GSH derivatives are conjugates of eicosanoids, xenobiotics, and carcinogens. At least three types of eicosanoid-GSH conjugates have been identified, including derivatives of leukotriene A4, prostaglandins, and hepoxilins. The LTA4-GSH conjugate (LTC4)1 and its cleavage products, LTD4 and LTE4, are powerful mediators of bronchoconstriction, vasoconstriction, mucus formation, and edema. As a result, they are important mediators of asthma, coronary artery spasm, and nephropathies (7Piper P.J. Physiol. Rev. 1984; 64: 744-761Crossref PubMed Scopus (260) Google Scholar, 8Samuelsson B. Science. 1983; 220: 568-575Crossref PubMed Scopus (2320) Google Scholar, 9Lewis R.A. Austen K.F. J. Clin. Invest. 1984; 73: 889-897Crossref PubMed Scopus (482) Google Scholar, 10Lewis R.A. Austen K.F. Soberman R.J. N. Engl. J. Med. 1990; 323: 645-655Crossref PubMed Scopus (1179) Google Scholar, 11Henderson Jr., W.R. Ann. Intern. Med. 1994; 121: 684-697Crossref PubMed Scopus (588) Google Scholar, 12Denzlinger C. Rapp S. Hagmann W. Keppler D. Science. 1985; 230: 330-332Crossref PubMed Scopus (160) Google Scholar, 13Katoh T. Lianos E.A. Fukunaga M. Takahashi K. Badr K.F. J. Clin. Invest. 1993; 91: 1507-1515Crossref PubMed Scopus (37) Google Scholar, 14Petric R. Ford-Hutchinson A.W. Kidney Int. 1994; 46: 1322-1329Abstract Full Text PDF PubMed Scopus (22) Google Scholar, 15Nassar G.M. Badr K.F. Miner. Electrolyte Metab. 1995; 21: 262-270PubMed Google Scholar). Prostaglandins play diverse biological roles and are involved in the development of the inflammatory response, inhibition of platelet aggregation, and regulation of immune responses (6Zurier R.B. Kelley W.N. Harris Jr., E.D. Ruddy S. Sledge C.B. Textbook of Rheumatology. Harcourt Brace Jovanovich, Inc., Philadelphia1993: 201-212Google Scholar). Prostaglandins are inactivated and cleared by conjugation to GSH (3Ishikawa T. Trends Biochem. Sci. 1992; 17: 463-468Abstract Full Text PDF PubMed Scopus (568) Google Scholar, 6Zurier R.B. Kelley W.N. Harris Jr., E.D. Ruddy S. Sledge C.B. Textbook of Rheumatology. Harcourt Brace Jovanovich, Inc., Philadelphia1993: 201-212Google Scholar). Hepoxilin A3 forms a GSH conjugate, hepoxilin A3-C, that is known to be a potent regulator of hippocampal neurons (4Pace-Asciak C.R. Laneuville O. Su W.-G. Corey E.J. Gurevich N. Wu P. Carlen P.L. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 3037-3041Crossref PubMed Scopus (49) Google Scholar). In addition, several neurotransmitters, including serotonin and dopamine, form GSH conjugates, suggesting an additional role for this pathway in the central nervous system (16Abramovitz M. Homma H. Ishigaki S. Tansey F. Cammer W. Listowsky I. J. Neurochem. 1988; 50: 50-57Crossref PubMed Scopus (98) Google Scholar, 17Cooper A.J.L. Rosenberg R.N. Prusiner S.B. DiMauro S. Barchi R.L. The Molecular and Genetic Basis of Neurological Disease. Butterworth-Heinemann, Boston1997: 1195-1230Google Scholar). GSH conjugation along with glucuronide formation is the major pathway by which toxins, drugs, and carcinogens such as CH3Hg, acetaminophen, and aflatoxin are detoxified and excreted (5Parkinson A. Klaassen C.D. Casarett & Doull's Toxicology: The Basic Science of Poisons. 5th ed. McGraw-Hill, New York1996: 113-186Google Scholar, 18Dutczak W.J. Ballatori N. J. Pharmacol. Exp. Ther. 1992; 262: 619-623PubMed Google Scholar, 19Dutczak W.J. Clarkson T.W. Ballatori N. Am. J. Physiol. 1991; 260: G873-G880PubMed Google Scholar, 20Hinchman C.A. Ballatori N. J. Toxicol. Environ. Health. 1994; 41: 387-409Crossref PubMed Scopus (132) Google Scholar, 21Eaton D.L. Gallagher E.P. Annu. Rev. Pharmacol. Toxicol. 1994; 34: 135-172Crossref PubMed Scopus (691) Google Scholar). Until recently, it was thought that the sequential cleavage of GSH conjugates and their derivative cysteinyl-glycine conjugates were catalyzed by two enzymes. GGT was known to cleave a γ-glutamyl group from GSH conjugates, and a dipeptidase, often identified as membrane-bound dipeptidase, was believed to cleave the Cys-Gly bond of conjugates to yield Cys derivatives (2Maycock A.L. Pong S.-S. Evans J.F. Miller D.K. Rokach J. Leukotrienes and Lipoxygenase: Chemical, Biochemical and Clinical Aspects. Elsevier, Amsterdam1989: 143-208Google Scholar). We have recently developed mice deficient in GGT and have shown that tissues from these mice will not cleave GSH, but they retain the ability to metabolize LTC4 to LTD4, its Cys-Gly derivative (22Lieberman M.W. Wiseman A.L. Shi Z-Z. Carter B.Z. Barrios R. Ou C-N. Chevez-Barrios P. Wang Y. Habib G.M. Goodman J.C. Huang S.L. Lebovitz R.M. Matzuk M.M. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 7923-7926Crossref PubMed Scopus (303) Google Scholar, 23Carter B.Z. Wiseman A.L. Orkiszewski R. Ballard K.D. Ou C.-N. Lieberman M.W. J. Biol. Chem. 1997; 272: 12305-12310Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). We have partially purified this activity and termed it γ-glutamyl leukotrienase (GGL) to reflect this fact (23Carter B.Z. Wiseman A.L. Orkiszewski R. Ballard K.D. Ou C.-N. Lieberman M.W. J. Biol. Chem. 1997; 272: 12305-12310Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar); however, the enzyme will also cleave S-decyl GSH, other alkyl GSH derivatives, and S-nitrosyl GSH (23Carter B.Z. Wiseman A.L. Orkiszewski R. Ballard K.D. Ou C.-N. Lieberman M.W. J. Biol. Chem. 1997; 272: 12305-12310Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar, 24Lieberman M.W. Shields J.E. Will Y. Reed D.J. Carter B.Z. Eicosanoids and Other Bioactive Lipids in Cancer, Inflammation and Related Diseases 4.in: Honn K.V. Nigam S. Marnett L.J. Dennis E. Plenum Publishing Corp., New York1998Google Scholar). A human cDNA coding for an enzyme termed GGT-rel shares at least some properties with GGL (25Heisterkamp N. Rajpert-De Meyts E. Uribe L. Forman H.J. Groffen J. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 6303-6307Crossref PubMed Scopus (70) Google Scholar). While we were preparing this manuscript for publication, a report identifying the rat homologue of human GGT-rel appeared (26Potdar P.D. Andrews K.L. Nettesheim P. Ostrowski L.E. Am. J. Physiol. 1997; 273: L1082-L1089Crossref PubMed Google Scholar). In other experiments, we have produced membrane-bound dipeptidase-deficient mice and found that tissues from these mice are capable of metabolizing LTD4 to LTE4, the Cys derivative (27Habib G.M. Shi Z.-Z. Cuevas A.A. Guo Q.-X. Matzuk M.M. Lieberman M.W. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 4859-4863Crossref PubMed Scopus (37) Google Scholar). Thus, like the cleavage of GSH conjugates, more than one enzyme is capable of catalyzing the second step of this pathway. A new picture is emerging in which a variety of enzymes participate in the biotransformation of GSH conjugates. At present, it is unknown how many enzymes are involved in each step and what role each plays in the regulation of these important biological molecules. To begin to examine this pathway in more detail, we have cloned a full-length mouse GGL cDNA and the corresponding gene and examined its expression in mouse tissues. GGT-deficient mice were developed in our laboratory (22Lieberman M.W. Wiseman A.L. Shi Z-Z. Carter B.Z. Barrios R. Ou C-N. Chevez-Barrios P. Wang Y. Habib G.M. Goodman J.C. Huang S.L. Lebovitz R.M. Matzuk M.M. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 7923-7926Crossref PubMed Scopus (303) Google Scholar). All restriction enzymes were purchased from Boehringer Mannheim, and [α-32P]UTP and [γ-32P]ATP were from NEN Life Science Products. Primers and Dullbecco's modified Eagle's medium were from Life Technologies, Inc. Fetal bovine serum, geneticin, LTC4, LTD4, LTE4, and other chemicals were purchased from Sigma unless otherwise indicated. Total RNAs were isolated from various GGT-deficient mouse tissues following the acid guanidinium thiocyanate procedure described by Chomczynski and Sacchi (28Chomczynski P. Sacchi N. Anal. Biochem. 1987; 162: 156-159Crossref PubMed Scopus (63148) Google Scholar). Poly(A)+ RNA was isolated using a Poly(A)Ttract mRNA isolation System III (Promega) or mRNA isolation kits from Ambion. Spleen poly(A)+ RNA from GGT-deficient mice was reverse transcribed by human GGT-rel primers GGTR1–4, four partially overlapping 21-mers corresponding to bases 1537–1565 (5′GTTGATGGTGCTGGTGGCAGCCACGGCGC3′) of human GGT-rel cDNA (25Heisterkamp N. Rajpert-De Meyts E. Uribe L. Forman H.J. Groffen J. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 6303-6307Crossref PubMed Scopus (70) Google Scholar). The resulting cDNA was amplified by PCR using primers AP1 and GGTR5–8, four partially overlapping 21-mers corresponding to bases 1500–1552 (5′GTGGCAGCCACGGCGCTGCCATCCTCCCCCAGCACAGACACATGGGACGTGCC3′) of human GGT-rel cDNA (25Heisterkamp N. Rajpert-De Meyts E. Uribe L. Forman H.J. Groffen J. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 6303-6307Crossref PubMed Scopus (70) Google Scholar). AP1, a primer pairing with a 5′ adaptor, was ligated to the 5′ cDNA after reverse transcription. The cDNA was further amplified by PCR using primers GGTR9 (5′ACAGGGAAGGTGGAGGTCATC3′) corresponding to bases 642–662 of human GGT-rel cDNA and GGTR10 (5′GTCTCTACAAGGTGGTGGTAC3′) corresponding to bases 1295–1315 of human GGT-rel cDNA. A cDNA fragment of 680 bp (cDNA I) was obtained, cloned into pT7Blue(R)T-Vector (Novagen), and sequenced. The fragment shared 80% nucleotide sequence identity with the corresponding human GGT-rel sequence. To obtain the GGL cDNA sequence further downstream of cDNA I, spleen poly(A)+ RNA from GGT-deficient mice was reverse transcribed using a lock-docking cDNA synthesis primer obtained from the Marathon cDNA amplification kit (CLONTECH). 3′-RACE fragments were obtained by PCR amplification of the cDNA using primers AP1 and GGL1 (Fig. 1). The products were then cloned into pT7Blue(R)T-Vector and sequenced. The clone containing the polyadenylation signal was selected and further amplified using primers GGL2 and GGL3 (Fig. 1) to obtain GGL cDNA II. To obtain the GGL cDNA sequence further upstream of cDNA I, spleen poly(A)+ RNA from GGT-deficient mice was reverse transcribed using primer GGL4 (Fig. 1). 5′-RACE fragments were amplified using AP2 from the Marathon cDNA amplification kit and GGL4. The products were then cloned and sequenced as above. The clone with the longest 5′ end was chosen and further amplified by PCR using primers GGL5 (Fig. 1) and GGL4 to obtain GGL cDNA III. To obtain a full-length GGL cDNA, GGL cDNA II and cDNA III were fused and amplified by PCR using primers GGL5 and GGL3 (Marathon cDNA amplification kit as described by the manufacturer). A full-length GGL cDNA was cloned into pT7Blue(R)T-Vector, and six clones were sequenced. The sequence of GGL cDNA was chosen by comparing six GGL cDNA sequences (derived from PCR cloning) and the exon sequence of the gene (isolated from genomic library, see below). All sequencing was carried out by an automated Applied Biosystems 373 DNA sequencer using a Dye Terminator Cycle Sequencing Ready Reaction DNA sequencing kit (ABI-Perkin Elmer). Comparison and alignment of GGL cDNA with other cDNAs and homology analyses of DNA and amino acid sequences were accomplished with the IntelliGenetics (IG) Suite (IntelliGenetics Inc., Palo Alto, CA). Murine NIH/3T3 cells were maintained in Dullbecco's modified Eagle's medium with 10% fetal bovine serum. Full-length GGL cDNA was released from pT7Blue(R)T-Vector and subcloned into a pCMV vector (CLONTECH). The construct was cotransfected into NIH/3T3 cells with pGK-neo using the calcium phosphate precipitation method, and the stable transfectants were selected in the presence of geneticin as described (29Kingston R.E. Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. Wiley Interscience, New York1994: 9.1.1-9.5.6Google Scholar). LTC4 to LTD4 converting activity (GGL activity) and GSH cleavage were assayed by high performance liquid chromatography methods (23Carter B.Z. Wiseman A.L. Orkiszewski R. Ballard K.D. Ou C.-N. Lieberman M.W. J. Biol. Chem. 1997; 272: 12305-12310Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). The GGL enzyme activities for organs presented in this paper (Table I) are higher than those presented earlier (23Carter B.Z. Wiseman A.L. Orkiszewski R. Ballard K.D. Ou C.-N. Lieberman M.W. J. Biol. Chem. 1997; 272: 12305-12310Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar) for which we used material frozen at −80 °C. All assays reported in this paper are carried out on homogenates of fresh organs. γ-Glutamyl-p-nitroanilide cleaving activity was assayed as described previously (22Lieberman M.W. Wiseman A.L. Shi Z-Z. Carter B.Z. Barrios R. Ou C-N. Chevez-Barrios P. Wang Y. Habib G.M. Goodman J.C. Huang S.L. Lebovitz R.M. Matzuk M.M. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 7923-7926Crossref PubMed Scopus (303) Google Scholar).Table ICellular distribution of γ-glutamyl leukotrienase (GGL) by in situ hybridization and enzymatic assay of GGL activityOrganGGLGGL activitySpleen4.86 ± 0.235 (5)1-bNumbers of mice analyzed (± S.E.M. for data from more than two mice and ± range for data from two mice). White pulp (lymphocytes)+++ Red pulp (lymphocytes)++Thymus0.82 ± 0.077 (5) Medullary thymic lymphocytes+++ Paracortical thymic lymphocytes+++Lung0.23 ± 0.035 (2) Interstitial cells+++ Bronchiolar epithelium+++ Bronchiolar smooth muscle+ Vascular smooth muscle0Kidney0.62 ± 0.045 (2) Proximal tubules+++ Distal tubules++ Collecting ducts+1-aFocally positive. Glomeruli0Small intestine1.24 ± 0.025 (2) Crypt cells+++ Smooth muscle0 Villous cells+1-aFocally positive.Heart (myocardium)+0.46 ± 0.030 (5)Liver0.55 ± 0.025 (2) Periportal hepatocytes+ Periportal lymphocytes+Brain0.14 ± 0.023 (4) Cerebral cortex neurons+++ Brain stem neurons+++ Purkinje cells+++ Granular neurons+ Glial cells0 Endothelial cells0Intensity for GGL in situ hybridization is graded from 0 (no reaction product) to +++ (greatest intensity) and GGL activity is expressed as μmol/g protein/h (duplicate determination).1-a Focally positive.1-b Numbers of mice analyzed (± S.E.M. for data from more than two mice and ± range for data from two mice). Open table in a new tab Intensity for GGL in situ hybridization is graded from 0 (no reaction product) to +++ (greatest intensity) and GGL activity is expressed as μmol/g protein/h (duplicate determination). GGL genomic clones were isolated from a mouse λ FixII genomic library (Stratagene) screened with GGL cDNA containing the full-length coding region as described previously (30Shi Z.-Z. Habib G.M. Lebovitz R.M. Lieberman M.W. Gene (Amst.). 1995; 167: 233-237Crossref PubMed Scopus (17) Google Scholar, 31Shi Z.-Z. Carter B.Z. Habib G.M. He X. Sazer S. Lebovitz R.M. Lieberman M.W. Arch. Biochem. Biophys. 1996; 331: 215-224Crossref PubMed Scopus (20) Google Scholar). The intron-exon organization of the gene was determined by the same procedures as used for the mouse GGT gene (30Shi Z.-Z. Habib G.M. Lebovitz R.M. Lieberman M.W. Gene (Amst.). 1995; 167: 233-237Crossref PubMed Scopus (17) Google Scholar) and mouse GSH synthetase gene (31Shi Z.-Z. Carter B.Z. Habib G.M. He X. Sazer S. Lebovitz R.M. Lieberman M.W. Arch. Biochem. Biophys. 1996; 331: 215-224Crossref PubMed Scopus (20) Google Scholar). 26 μg of mouse spleen poly(A)+ RNA was used for primer extension analysis. The primer was GGL6 (5′CTGGACAGAAAGGATGACGGACAGCCTTACAGATAGGTGG3′). The reaction was carried out essentially as described previously (32Sepulveda A.R. Carter B.Z. Habib G.M. Lebovitz R.M. Lieberman M.W. J. Biol. Chem. 1994; 269: 10699-10705Abstract Full Text PDF PubMed Google Scholar). Expression of GGL RNA in various mouse tissues was detected by Northern blot (31Shi Z.-Z. Carter B.Z. Habib G.M. He X. Sazer S. Lebovitz R.M. Lieberman M.W. Arch. Biochem. Biophys. 1996; 331: 215-224Crossref PubMed Scopus (20) Google Scholar) and ribonuclease protection assay (Ambion). To obtain the probe for ribonuclease protection, a GGL cDNA fragment stretching from base −28 to base 173 (Fig. 1) was cloned into the pT7Blue(R)T plasmid. The plasmid was linearized with BamHI and transcribed by T7 RNA polymerase in the presence of [α-32P]UTP using anin vitro transcription kit (Stratagene). 100 μg of RNA from tissues of GGT-deficient mice (spleen, small intestine, kidney, liver, lung, and brain) and 2.0 × 105 cpm of GGL probe were used for each assay following the manufacturer's instruction. Hybridization was carried out at 42 °C for 18 h followed by RNase digestion at 37 °C for 1 h with a 100-fold dilution of RNase R solution in the kit. A GGL cDNA fragment stretching from base −28 to base 254 (Fig. 1) was cloned into the pT7Blue(R)T plasmid in both orientations. To generate antisense and sense probes, the plasmids were then linearized by BamHI and transcribed by T7 RNA polymerase in the presence of digoxigenin-labeled UTP (Boehringer Mannheim). Sections of paraffin-embedded organs from wild-type and GGT-deficient mice were incubated on slides with 0.001% proteinase K for 20 min at 37 °C. After acetylation with 0.25% acetic anhydride for 5 min at room temperature (to block positive charges on tissue induced by protease digestion), the sections were dehydrated and prehybridized for 1 h at 45 °C in a hybridization buffer consisting of 50% deionized formamide, 2 × standard SSC solution, 20 mmTris(hydroxymethyl)aminomethane, pH 8.0, 1 × Denhardt's solution, 1 mm ethylenediaminetetraacetic acid, 100 mm dithiothreitol, and 0.5 mg/ml yeast tRNA. The sections were then incubated with an antisense riboprobe (or a sense probe as a negative control) at 45 °C overnight followed by successive incubations in 2 × SSC for 1 h, 1 × SSC for 30 min at room temperature, 0.5 × SSC with RNase A at 65 °C for 30 min, and 0.5 × SSC for 1 h at room temperature. The tissues were incubated with a polyclonal sheep anti-digoxigenin antibody labeled with alkaline phosphatase. No differences were seen in patterns of in situ hybridization in GGT-deficient and wild-type mice. In all cases, hybridizations with the sense strand were negative. GGT-deficient mice (22Lieberman M.W. Wiseman A.L. Shi Z-Z. Carter B.Z. Barrios R. Ou C-N. Chevez-Barrios P. Wang Y. Habib G.M. Goodman J.C. Huang S.L. Lebovitz R.M. Matzuk M.M. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 7923-7926Crossref PubMed Scopus (303) Google Scholar) and their wild-type littermates were exposed to 80% oxygen continuously for 120 h as described previously with minor modifications (33Welty S.E. Rivera J.L. Wu B. Free Radical Biol. Med. 1997; 23: 898-908Crossref PubMed Scopus (9) Google Scholar). They were sacrificed by metofane inhalation, then cervical dislocation. RNA was isolated from lungs of these mice for Northern blotting (31Shi Z.-Z. Carter B.Z. Habib G.M. He X. Sazer S. Lebovitz R.M. Lieberman M.W. Arch. Biochem. Biophys. 1996; 331: 215-224Crossref PubMed Scopus (20) Google Scholar). Lung homogenates from oxygen-exposed and air-breathing control GGT-deficient mice were used to assay GGL activity (23Carter B.Z. Wiseman A.L. Orkiszewski R. Ballard K.D. Ou C.-N. Lieberman M.W. J. Biol. Chem. 1997; 272: 12305-12310Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). As an initial step in examining the pathway(s) involved in the biotransformation of GSH conjugates, we cloned a full-length GGL cDNA by an RT-PCR strategy using poly(A)+ RNA from the spleen of GGT-deficient mice and primers for GGT-rel, a human gene product that shares some substrate specificity and properties with GGL (22Lieberman M.W. Wiseman A.L. Shi Z-Z. Carter B.Z. Barrios R. Ou C-N. Chevez-Barrios P. Wang Y. Habib G.M. Goodman J.C. Huang S.L. Lebovitz R.M. Matzuk M.M. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 7923-7926Crossref PubMed Scopus (303) Google Scholar, 23Carter B.Z. Wiseman A.L. Orkiszewski R. Ballard K.D. Ou C.-N. Lieberman M.W. J. Biol. Chem. 1997; 272: 12305-12310Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar, 25Heisterkamp N. Rajpert-De Meyts E. Uribe L. Forman H.J. Groffen J. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 6303-6307Crossref PubMed Scopus (70) Google Scholar). Although a search for genes related to human GGT-rel in the mouse by Northern blotting was negative (25Heisterkamp N. Rajpert-De Meyts E. Uribe L. Forman H.J. Groffen J. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 6303-6307Crossref PubMed Scopus (70) Google Scholar), we were able to detect LTC4 to LTD4 conversion (GGL activity) in GGT-deficient mice (23Carter B.Z. Wiseman A.L. Orkiszewski R. Ballard K.D. Ou C.-N. Lieberman M.W. J. Biol. Chem. 1997; 272: 12305-12310Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). We reasoned that because GGL and GGT-rel shared some functions, it was likely that GGL would be at least in part homologous with GGT-rel. We isolated a 2.3-kb GGL cDNA containing an open reading frame of 1719 nucleotides, a 5′ UTR of 314 nucleotides, and a 3′ UTR of 284 nucleotides followed by the polyadenylation site, which is 18 nucleotides upstream of the poly(A) tail. The GGL cDNA and its deduced amino acid sequences are shown in Fig. 1. The cDNA shares an overall 68% nucleotide sequence identity with human GGT-rel cDNA (25Heisterkamp N. Rajpert-De Meyts E. Uribe L. Forman H.J. Groffen J. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 6303-6307Crossref PubMed Scopus (70) Google Scholar) and an 89% identity with the recently identified rat homologue (26Potdar P.D. Andrews K.L. Nettesheim P. Ostrowski L.E. Am. J. Physiol. 1997; 273: L1082-L1089Crossref PubMed Google Scholar). The predicted amino acid sequence shows 77% identity with that of human GGT-rel (Fig. 2) and 88% identity with the rat sequence (26Potdar P.D. Andrews K.L. Nettesheim P. Ostrowski L.E. Am. J. Physiol. 1997; 273: L1082-L1089Crossref PubMed Google Scholar). The predicted heavy chain of mouse GGL contains 388 amino acids compared with 387 amino acids for human GGT-rel, whereas the predicted light chain contains 185 amino acids compared with 199 amino acids for human GGT-rel (Figs. 1 and 2 and Ref. 25Heisterkamp N. Rajpert-De Meyts E. Uribe L. Forman H.J. Groffen J. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 6303-6307Crossref PubMed Scopus (70) Google Scholar). Closer inspection of the two cDNAs revealed that a stretch of 48 nucleotides in the region coding for the light chain of GGT-rel (corresponding to amino acids 446–461 of human GGT-rel in Fig. 2) was missing in GGL, which would account for the somewhat smaller predicted size of the GGL protein (573 amino acids) compared with the human GGT-rel protein (586 amino acids). The deletion of 48 nucleotides compared with human GGT-rel sequence also occurred in the rat GGT-rel cDNA sequence, which predicts 572 amino acids (26Potdar P.D. Andrews K.L. Nettesheim P. Ostrowski L.E. Am. J. Physiol. 1997; 273: L1082-L1089Crossref PubMed Google Scholar). From the putative structure of the rat protein, the histidine at position 371 of mouse GGL is deleted in rat GGT-rel (Fig. 2 and Ref. 26Potdar P.D. Andrews K.L. Nettesheim P. Ostrowski L.E. Am. J. Physiol. 1997; 273: L1082-L1089Crossref PubMed Google Scholar). GGL has six putative N-glycosylation sites, all located in the putative heavy chain (Fig. 1). We also found that GGL and mouse GGT share an overall 57% cDNA sequence identity and 41% predicted amino acid sequence identity (Fig. 2). The predicted amino acid identity of mouse GGL and GGT sequence is highest in three regions (amino acids 43–111 of GGL and 39–107 of GGT; amino acids 140–176 of GGL and 133–169 of GGT; and amino acids 388–428 of GGL and 379–419 of GGT). To confirm that the cDNA we cloned from GGT-deficient mouse spleen codes for GGL activity, we transfected the cloned full-length cDNA under the regulation of the cytomegalovirus promoter into murine NIH/3T3 cells. Normally, these cells do not express either GGL or GGT. We isolated three clones with enzyme activity, thus demonstrating that this cDNA codes for GGL (Fig. 3). The specific activities of the three clones for conversion of LTC4 to LTD4 were 1.93, 3.48, and 4.10 μmol/g of protein/h, respectively. In addition to LTD4, we detected LTE4 in our reactions (Fig. 3). The appearance of this leukotriene results from the cleavage of LTD4 to LTE4 by dipeptidase(s) in NIH/3T3 cells (23Carter B.Z. Wiseman A.L. Orkiszewski R. Ballard K.D. Ou C.-N. Lieberman M.W. J. Biol. Chem. 1997; 272: 12305-12310Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar, 34Habib G.M. Barrios R. Shi Z.-Z. Lieberman W.M. J. Biol. Chem. 1996; 271: 16273-16280Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar). We were unable to demonstrate cleavage of GSH or γ-glutamyl-p-nitroanilide (a substrate used to assay GGT) by transfected 3T3 cells (data not shown); this result confirms our earlier findings with partially purified enzyme preparations from GGT-deficient mice (23Carter B.Z. Wiseman A.L. Orkiszewski R. Ballard K.D. Ou C.-N. Lieberman M.W. J. Biol. Chem. 1997; 272: 12305-12310Abstract Full Text Full Text PDF PubMed Scopus (47) Google Scholar). A Southern blot of mouse DNA digested with EcoRI, HindIII, bothEcoRI and HindIII, and BamHI and probed with a 0.37-kb GGL cDNA fragment yielded single bands (data not shown), indicating that GGL is a single copy gene. Subsequently, from 5 × 105 phages of a mouse genomic λ FixII library, we" @default.
• W2163158796 created "2016-06-24" @default.
• W2163158796 creator A5006081813 @default.
• W2163158796 creator A5007415588 @default.
• W2163158796 creator A5015056852 @default.
• W2163158796 creator A5075486072 @default.
• W2163158796 date "1998-10-01" @default.
• W2163158796 modified "2023-09-27" @default.
• W2163158796 title "γ-Glutamyl Leukotrienase, a γ-Glutamyl Transpeptidase Gene Family Member, Is Expressed Primarily in Spleen" @default.
• W2163158796 cites W1564157216 @default.
• W2163158796 cites W1595670287 @default.
• W2163158796 cites W1875958179 @default.
• W2163158796 cites W1965051773 @default.
• W2163158796 cites W1978198515 @default.
• W2163158796 cites W1979840983 @default.
• W2163158796 cites W1980617967 @default.
• W2163158796 cites W1980832959 @default.
• W2163158796 cites W2004351423 @default.
• W2163158796 cites W2006050947 @default.
• W2163158796 cites W2030763326 @default.
• W2163158796 cites W2037022310 @default.
• W2163158796 cites W2039000684 @default.
• W2163158796 cites W2043125761 @default.
• W2163158796 cites W2047215342 @default.
• W2163158796 cites W2054335437 @default.
• W2163158796 cites W2057282941 @default.
• W2163158796 cites W2060049302 @default.
• W2163158796 cites W2061561132 @default.
• W2163158796 cites W2065234246 @default.
• W2163158796 cites W2071637251 @default.
• W2163158796 cites W2072359526 @default.
• W2163158796 cites W2087019177 @default.
• W2163158796 cites W2093143336 @default.
• W2163158796 cites W2107967576 @default.
• W2163158796 cites W2131485545 @default.
• W2163158796 cites W2158449128 @default.
• W2163158796 cites W2168049797 @default.
• W2163158796 cites W2219255383 @default.
• W2163158796 cites W4294216491 @default.
• W2163158796 doi "https://doi.org/10.1074/jbc.273.43.28277" @default.
• W2163158796 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9774450" @default.
• W2163158796 hasPublicationYear "1998" @default.
• W2163158796 type Work @default.
• W2163158796 sameAs 2163158796 @default.
• W2163158796 citedByCount "54" @default.
• W2163158796 countsByYear W21631587962012 @default.
• W2163158796 countsByYear W21631587962013 @default.
• W2163158796 countsByYear W21631587962014 @default.
• W2163158796 countsByYear W21631587962015 @default.
• W2163158796 countsByYear W21631587962017 @default.
• W2163158796 countsByYear W21631587962018 @default.
• W2163158796 countsByYear W21631587962019 @default.
• W2163158796 countsByYear W21631587962020 @default.
• W2163158796 countsByYear W21631587962021 @default.
• W2163158796 crossrefType "journal-article" @default.
• W2163158796 hasAuthorship W2163158796A5006081813 @default.
• W2163158796 hasAuthorship W2163158796A5007415588 @default.
• W2163158796 hasAuthorship W2163158796A5015056852 @default.
• W2163158796 hasAuthorship W2163158796A5075486072 @default.
• W2163158796 hasBestOaLocation W21631587961 @default.
• W2163158796 hasConcept C104317684 @default.
• W2163158796 hasConcept C126322002 @default.
• W2163158796 hasConcept C153911025 @default.
• W2163158796 hasConcept C203014093 @default.
• W2163158796 hasConcept C2780931953 @default.
• W2163158796 hasConcept C54355233 @default.
• W2163158796 hasConcept C71924100 @default.
• W2163158796 hasConcept C86803240 @default.
• W2163158796 hasConceptScore W2163158796C104317684 @default.
• W2163158796 hasConceptScore W2163158796C126322002 @default.
• W2163158796 hasConceptScore W2163158796C153911025 @default.
• W2163158796 hasConceptScore W2163158796C203014093 @default.
• W2163158796 hasConceptScore W2163158796C2780931953 @default.
• W2163158796 hasConceptScore W2163158796C54355233 @default.
• W2163158796 hasConceptScore W2163158796C71924100 @default.
• W2163158796 hasConceptScore W2163158796C86803240 @default.
• W2163158796 hasIssue "43" @default.
• W2163158796 hasLocation W21631587961 @default.
• W2163158796 hasOpenAccess W2163158796 @default.
• W2163158796 hasPrimaryLocation W21631587961 @default.
• W2163158796 hasRelatedWork W1991523530 @default.
• W2163158796 hasRelatedWork W2002128513 @default.
• W2163158796 hasRelatedWork W2009966535 @default.
• W2163158796 hasRelatedWork W2020824267 @default.
• W2163158796 hasRelatedWork W2031436818 @default.
• W2163158796 hasRelatedWork W2057739827 @default.
• W2163158796 hasRelatedWork W2075354549 @default.
• W2163158796 hasRelatedWork W2088063203 @default.
• W2163158796 hasRelatedWork W2171277769 @default.
• W2163158796 hasRelatedWork W2092874662 @default.
• W2163158796 hasVolume "273" @default.
• W2163158796 isParatext "false" @default.
• W2163158796 isRetracted "false" @default.
• W2163158796 magId "2163158796" @default.
• W2163158796 workType "article" @default.