FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2163773277> ?p ?o ?g. }

• W2163773277 endingPage "19799" @default.
• W2163773277 startingPage "19792" @default.
• W2163773277 abstract "Porphobilinogen synthase (PBGS) catalyzes the condensation of two molecules of 5-aminolevulinic acid (ALA), an essential step in tetrapyrrole biosynthesis. 4-Oxosebacic acid (4-OSA) and 4,7-dioxosebacic acid (4,7-DOSA) are bisubstrate reaction intermediate analogs for PBGS. We show that 4-OSA is an active site-directed irreversible inhibitor for Escherichia coliPBGS, whereas human, pea, Pseudomonas aeruginosa, and Bradyrhizobium japonicum PBGS are insensitive to inhibition by 4-OSA. Some variants of human PBGS (engineered to resemble E. coli PBGS) have increased sensitivity to inactivation by 4-OSA, suggesting a structural basis for the specificity. The specificity of 4-OSA as a PBGS inhibitor is significantly narrower than that of 4,7-DOSA. Comparison of the crystal structures for E. coliPBGS inactivated by 4-OSA versus 4,7-DOSA shows significant variation in the half of the inhibitor that mimics the second substrate molecule (A-side ALA). Compensatory changes occur in the structure of the active site lid, which suggests that similar changes normally occur to accommodate numerous hybridization changes that must occur at C3 of A-side ALA during the PBGS-catalyzed reaction. A comparison of these with other PBGS structures identifies highly conserved active site water molecules, which are isolated from bulk solvent and implicated as proton acceptors in the PBGS-catalyzed reaction. Porphobilinogen synthase (PBGS) catalyzes the condensation of two molecules of 5-aminolevulinic acid (ALA), an essential step in tetrapyrrole biosynthesis. 4-Oxosebacic acid (4-OSA) and 4,7-dioxosebacic acid (4,7-DOSA) are bisubstrate reaction intermediate analogs for PBGS. We show that 4-OSA is an active site-directed irreversible inhibitor for Escherichia coliPBGS, whereas human, pea, Pseudomonas aeruginosa, and Bradyrhizobium japonicum PBGS are insensitive to inhibition by 4-OSA. Some variants of human PBGS (engineered to resemble E. coli PBGS) have increased sensitivity to inactivation by 4-OSA, suggesting a structural basis for the specificity. The specificity of 4-OSA as a PBGS inhibitor is significantly narrower than that of 4,7-DOSA. Comparison of the crystal structures for E. coliPBGS inactivated by 4-OSA versus 4,7-DOSA shows significant variation in the half of the inhibitor that mimics the second substrate molecule (A-side ALA). Compensatory changes occur in the structure of the active site lid, which suggests that similar changes normally occur to accommodate numerous hybridization changes that must occur at C3 of A-side ALA during the PBGS-catalyzed reaction. A comparison of these with other PBGS structures identifies highly conserved active site water molecules, which are isolated from bulk solvent and implicated as proton acceptors in the PBGS-catalyzed reaction. Porphobilinogen synthase (PBGS, 1The abbreviations used are: PBGSporphobilinogen synthaseALA5-aminolevulinic acidβME2-mercaptoethanol4-OSA4-oxosebacic acid47-DOSA, 4,7-dioxosebacic acidRMSroot mean-squaredPDBprotein data bankA-sideacetyl sideP-sidepropionyl side1The abbreviations used are: PBGSporphobilinogen synthaseALA5-aminolevulinic acidβME2-mercaptoethanol4-OSA4-oxosebacic acid47-DOSA, 4,7-dioxosebacic acidRMSroot mean-squaredPDBprotein data bankA-sideacetyl sideP-sidepropionyl side EC 4.2.1.24, also known as 5-aminolevulinate dehydratase) recently has emerged as a viable enzyme target for the development of pharmaceuticals or agricultural agents. The PBGS protein, which is highly conserved in both sequence and structure (1Jaffe E.K. Acta Crystallogr. Sect. D. 2000; 56: 115-128Crossref PubMed Scopus (90) Google Scholar), catalyzes an early essential step in the biosynthesis of the tetrapyrrole cofactors such as heme and chlorophyll (Fig. 1 A). Despite the fact that much is known about the PBGS structure, the sequence of bond-making and bond-breaking events that follow formation of the ternary complex of PBGS with the two substrate molecules is the subject of active discussion (2Erskine P.T. Norton E. Cooper J.B. Lambert R. Coker A. Lewis G. Spencer P. Sarwar M. Wood S.P. Warren M.J. Shoolingin-Jordan P.M. Biochemistry. 1999; 38: 4266-4276Crossref PubMed Scopus (81) Google Scholar, 3Kervinen J. Jaffe E.K. Stauffer F. Neier R. Wlodawer A. Zdanov A. Biochemistry. 2001; 40: 8227-8236Crossref PubMed Scopus (40) Google Scholar, 4Stauffer F. Zizzari E. Soldermann-Pissot C. Faurite J.-P. Neier R. Chimia. 2001; 55: 314-319Google Scholar, 5Erskine P.T. Coates L. Newbold R. Brindley A.A. Stauffer F. Wood S.P. Warren M.J. Cooper J.B. Shoolingin-Jordan P.M. Neier R. FEBS Lett. 2001; 503: 196-200Crossref PubMed Scopus (29) Google Scholar). Based on an extensive phylogenetic variation in the number and kinds of metal ions used for catalytic and/or allosteric roles, it is possible that the order of chemical events in the enzyme-catalyzed reaction mechanism may not be phylogenetically conserved. In order to probe the mechanism, 4,7-dioxosebacic acid (4,7-DOSA) and 4-oxosebacic acid (4-OSA), illustrated in Fig. 1 B, were designed and found to act as suicide substrates for Escherichia coli PBGS (6Jarret C. Stauffer F. Henz M.E. Marty M. Luond R.M. Bobalova J. Schurmann P. Neier R. Chem. Biol. 2000; 7: 185-196Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar). These inhibitors mimic an addition product intermediate in which the first bond formed between the two 5-aminolevulinic acid (ALA) substrate molecules creates a carbinolamine that dehydrates to a Schiff base (6Jarret C. Stauffer F. Henz M.E. Marty M. Luond R.M. Bobalova J. Schurmann P. Neier R. Chem. Biol. 2000; 7: 185-196Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar). More recently, a strong species-selective inhibition of PBGS by 4,7-DOSA has been correlated with an active site variation in metal ion usage (3Kervinen J. Jaffe E.K. Stauffer F. Neier R. Wlodawer A. Zdanov A. Biochemistry. 2001; 40: 8227-8236Crossref PubMed Scopus (40) Google Scholar). Here we have characterized a very different species selectivity for 4-OSA inhibition of PBGS and provide a 1.9-Å crystal structure of 4-OSA-inhibited E. coli PBGS. This structure was compared with an improved 1.7-Å crystal structure of E. coli PBGS inhibited by 4,7-DOSA and with analogous structures of these inhibitors bound to yeast PBGS (for which, however, there are no kinetic inhibition data) (5Erskine P.T. Coates L. Newbold R. Brindley A.A. Stauffer F. Wood S.P. Warren M.J. Cooper J.B. Shoolingin-Jordan P.M. Neier R. FEBS Lett. 2001; 503: 196-200Crossref PubMed Scopus (29) Google Scholar). porphobilinogen synthase 5-aminolevulinic acid 2-mercaptoethanol 4-oxosebacic acid 7-DOSA, 4,7-dioxosebacic acid root mean-squared protein data bank acetyl side propionyl side porphobilinogen synthase 5-aminolevulinic acid 2-mercaptoethanol 4-oxosebacic acid 7-DOSA, 4,7-dioxosebacic acid root mean-squared protein data bank acetyl side propionyl side Most chemicals and buffers were obtained from Fisher or Sigma in the purest available form. 2-Mercaptoethanol (βME) from Fluka (Buchs, Switzerland) was vacuum-distilled prior to use. 4-OSA and 4,7-DOSA were synthesized and tested (as described in Ref. 6Jarret C. Stauffer F. Henz M.E. Marty M. Luond R.M. Bobalova J. Schurmann P. Neier R. Chem. Biol. 2000; 7: 185-196Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar). All of the PBGS enzymes used in this study were cloned and expressed in E. coli, and purification and detailed characterization has been described previously (7Kervinen J. Dunbrack R.L., Jr. Litwin S. Martins J. Scarrow R.C. Volin M. Yeung A.T. Yoon E. Jaffe E.K. Biochemistry. 2000; 39: 9018-9029Crossref PubMed Scopus (37) Google Scholar, 8Petrovich R.M. Litwin S. Jaffe E.K. J. Biol. Chem. 1996; 271: 8692-8699Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar, 9Frankenberg N. Heinz D.W. Jahn D. Biochemistry. 1999; 38: 13968-13975Crossref PubMed Scopus (31) Google Scholar, 10Jaffe E.K. Volin M. Bronson-Mullins C.R. Dunbrack R.L., Jr. Kervinen J. Martins J. Quinlan J.F., Jr. Sazinsky M.H. Steinhouse E.M. Yeung A.T. J. Biol. Chem. 2000; 275: 2619-2626Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar, 11Mitchell L.W. Jaffe E.K. Arch. Biochem. Biophys. 1993; 300: 169-177Crossref PubMed Scopus (50) Google Scholar, 12Frankenberg N. Jahn D. Jaffe E.K. Biochemistry. 1999; 38: 13976-13982Crossref PubMed Scopus (24) Google Scholar). Human PBGS was the C162A variant of the natural N59 isozyme, and it has kinetic properties closely resembling the wild type (13Jaffe E.K. Martins J., Li, J. Kervinen J. Dunbrack R.L., Jr. J. Biol. Chem. 2001; 276: 1531-1537Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar). Human PBGS mutants characterized with 4-OSA were N59/C162A/H131A/C223A (called MinusZnA) (13Jaffe E.K. Martins J., Li, J. Kervinen J. Dunbrack R.L., Jr. J. Biol. Chem. 2001; 276: 1531-1537Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar) and two new chimeric proteins (HsΔALK and HsEclid) containing portions of the E. coli PBGS active site lid. The chimeric proteins were prepared from the plasmid encoding wild type human PBGS variant N59/C162A by the QuikChange method of mutagenesis. The sense strand primers were CCGTTCCGTGATGCGCTAAGTCAGCATTAAAAGGCGACCGCCGCTGC for HsΔALK and CCGTTCCGTGAAGCTGCTGGGTCAGCCTTAAAAGGCGACCGCAAAGCTATCAG for HsEclid. The enzyme assay measures the formation of porphobilinogen from ALA. The assay conditions at optimal pH and with a full complement of required and allosteric metal ions in the standard 5-min assay procedure for each of the five PBGS were performed as described previously (3Kervinen J. Jaffe E.K. Stauffer F. Neier R. Wlodawer A. Zdanov A. Biochemistry. 2001; 40: 8227-8236Crossref PubMed Scopus (40) Google Scholar). Human mutants MinusZnA, HsΔALK, and HsEclid were assayed in the same fashion as the wild type. To ensure reliable A555 values, assays of low specific activity mutants used a 30-min incubation with substrate. Enzyme concentrations were measured with Coomassie Plus protein assay reagent (Pierce) relative to a standard curve prepared with bovine serum albumin. The five species of PBGS (1 μm subunit) were preincubated under optimal assay conditions for 10 min at 37 °C prior to the addition of 4-OSA over the concentration range of 10 μm to 3 mm; preincubation was allowed to proceed for various times ranging from 90 min to 22 h at 37 °C before initiating the formation of porphobilinogen by addition of ALA-HCl to a final concentration of 10 mm. Porphobilinogen formation was allowed to proceed for 5 min. For E. coli PBGS, 4-OSA inhibition data were fitted to the equation v/vo = 1/(1+([I]/IC50)) (14Copeland R. Lombardo D. Giannaras J. Decicco C. Bioorg. Med. Chem. Lett. 1995; 5: 1947-1952Crossref Scopus (81) Google Scholar) using the program SigmaPlot (SPSS®, Chicago, IL). For other species of PBGS the apparent IC50 values for 4-OSA were well above millimolar concentrations and the 10 μm–3 mm inhibition data could not be fit well. In these cases a simple direct comparison of the five species used a 4-OSA concentration of 3 mm and a 24-h enzyme/inhibitor incubation time prior to the addition of ALA. Crystallizations were carried out with both 4-OSA and 4,7-DOSA as described previously for 4,7-DOSA (3Kervinen J. Jaffe E.K. Stauffer F. Neier R. Wlodawer A. Zdanov A. Biochemistry. 2001; 40: 8227-8236Crossref PubMed Scopus (40) Google Scholar). In both cases, E. coli PBGS (9 mg ml−1 in 50 mm Tris-HCl, pH 8.0, 10 mm βME, 20 μm ZnCl2, 10 mmMgCl2) was incubated for 24 h at 37 °C with a 16-fold molar excess of the inhibitor (∼4 mm) prior to setting up the crystallization trays. An equal volume of clarified protein was mixed with reservoir buffer containing 1–6% polyethylene glycol 3350, 10% glycerol, 0.1 m Tris-HCl, pH 8.5, and 0.02% sodium azide. The crystals with a diamond-like shape appeared in 1–3 days, and the largest crystals grew to their final size (up to 0.6 × 0.6 × 0.3 mm3) in approximately 2 weeks. Cryoprotection was carried out by transferring a crystal to reservoir solutions containing 17, 23, and 30% glycerol, respectively (3 min in each solution), and the crystal was flash-frozen in a liquid nitrogen vapor. X-ray diffraction data for both complexes were collected from one crystal at 100 K using a QUANTUM-4 CCD detector mounted at synchrotron beamline X9B at Brookhaven National Synchrotron Light Source facility. The data sets consisted of 180 frames chosen to cover at least one asymmetric unit with each frame corresponding to 0.5° oscillation exposed for 35 s. Crystals belong to a tetragonal system, space group, P4212; unit cell parameters, a = b = 129.0 Å, and c = 142.8 Å with two molecules per asymmetric unit. Diffraction intensities were processed with the HKL2000 suite of programs (15Otwinowski Z. Minor W. Methods Enzymol. 1997; 276: 307-326Crossref Scopus (38253) Google Scholar), resulting in final data sets with Rmerge(I) = 5.1 and 5.6% for 126,253 and 92,714 independent reflections and with completeness of 95.7 and 99.8% for the 40–1.7 and 40–1.9 Å resolution range for 4,7-DOSA and 4-OSA complexes, respectively. Because the crystals were in both cases isomorphous to that of E. coli PBGS complexed with 4,7-DOSA (PDB entry 1I8J), rigid body refinement of the PBGS dimer against the corresponding diffraction data was sufficient to properly orient the protein model in the respective crystal unit cell. Refinement was carried out with program package CNS (16Brunger A.T. Adams P.D. Clore G.M. DeLano W.L. Gros P. Grosse-Kunstleve R.W. Jiang J.-S. Kuszewski J. Nilges M. Pannu N.S. Read R.J. Rice L.M. Simonson T. Warren G.L. Acta Crystallogr. Sect. D. 1998; 54: 905-921Crossref PubMed Scopus (16919) Google Scholar) with weak non-crystallographic symmetry restraints corresponding to weight 25. Model building was performed with program O (17Jones T.A. Zou J.Y. Cowan S. Kjeldgaard M. Acta Crystallogr. Sect. A. 1991; 47: 110-119Crossref PubMed Scopus (12999) Google Scholar). The final models included one dimer of PBGS molecule complexed with two respective inhibitor molecules, 498 and 433 water molecules for 4,7-DOSA and 4-OSA, respectively, as well as two Zn2+ and two Mg2+ ions. Five glycerol molecules were found in the 4-OSA structure. The crystallographic R-factors were 19.5 and 20.6%, R(free) parameters were 24.3 and 26.3% for the 1.7- and 1.9-Å resolution data, and the RMS deviations for bond lengths and bond angles were 0.018 Å and 1.8° for 4,7-DOSA and 0.019 Å and 2.0° for 4-OSA, respectively. The coordinates have been deposited in the Protein Data Bank with the PDB codes 1L6S and 1L6Y for immediate release. The inactivation of PBGS by 4,7-DOSA was shown previously to be dependent both upon the concentration of the inhibitor and the preincubation time of the inhibitor and enzyme prior to addition of substrate (3Kervinen J. Jaffe E.K. Stauffer F. Neier R. Wlodawer A. Zdanov A. Biochemistry. 2001; 40: 8227-8236Crossref PubMed Scopus (40) Google Scholar). This is also true for 4-OSA, which was a less potent inactivator than 4,7-DOSA. Fig. 2 A illustrates the time and concentration dependence for the interaction of 4-OSA with E. coli PBGS using enzyme/inhibitor incubation times of 94 min and 16 h and 4-OSA concentrations from 10 μm to 3 mm. For comparison we also included data from a comparable 100-min incubation of E. coli PBGS in which 4,7-DOSA was the inhibitor (3Kervinen J. Jaffe E.K. Stauffer F. Neier R. Wlodawer A. Zdanov A. Biochemistry. 2001; 40: 8227-8236Crossref PubMed Scopus (40) Google Scholar). These data indicate that 4-OSA is far less potent against E. coli PBGS than is 4,7-DOSA, consistent with prior reports (6Jarret C. Stauffer F. Henz M.E. Marty M. Luond R.M. Bobalova J. Schurmann P. Neier R. Chem. Biol. 2000; 7: 185-196Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar). Using the approximation of Copeland et al. (14Copeland R. Lombardo D. Giannaras J. Decicco C. Bioorg. Med. Chem. Lett. 1995; 5: 1947-1952Crossref Scopus (81) Google Scholar), the IC50 values for E. coliPBGS inhibition by 4-OSA at 94 min and 16 h are 0.57 ± 0.06 mm and 0.22 ± 0.01 mm, respectively. The IC50 for 4,7-DOSA at 100 min of incubation with E. coli PBGS is 0.039 ± 0.002 mm. The reduced sensitivity to 4-OSA relative to 4,7-DOSA is also true for human,Bradyrhizobium japonicum, Pseudomonas aeruginosa, and Pisum sativum (pea) PBGS, where a similar experiment showed marginal if any inactivation by 4-OSA across the range of 10 μm to 3 mm 4-OSA. To compare the five species, Fig. 2 B illustrates a 24-h preincubation of 3 mm 4-OSA with all five PBGS and shows a high selectivity for inactivation of E. coli PBGS. The control reactions wherein inhibitor was omitted did not lose any significant activity. The high selectivity of 4-OSA inactivation for E. coli PBGS is in sharp contrast to the species selectivity of inactivation by 4,7-DOSA (3Kervinen J. Jaffe E.K. Stauffer F. Neier R. Wlodawer A. Zdanov A. Biochemistry. 2001; 40: 8227-8236Crossref PubMed Scopus (40) Google Scholar). The latter showed a marked preference for the Zn2+-utilizing PBGS and was highly effective against human PBGS, which contains two different types of Zn2+ binding sites. In that case, evaluation of an active human PBGS mutant (MinusZnA) that lacked the nonessential Zn2+ showed reduced sensitivity to 4,7-DOSA. Of the five species evaluated, only human and E. coli PBGS use a catalytic Zn2+. Because the number and types of Zn2+ sites are a significantly different between human and E. coli PBGS, this MinusZnA human PBGS was also evaluated with 4-OSA, and the results are included in Fig. 2 C. Consistent with the notion that MinusZnA is more like E. coli PBGS, MinusZnA retains only ∼65% activity after a 22-h incubation with 3 mm 4-OSA. Thus, MinusZnA is significantly more sensitive to inactivation by 4-OSA than is human PBGS, but it remains far less sensitive than E. coliPBGS. In search for the structural basis for the high selectivity of 4-OSA against E. coli PBGS, we compared the known structures (and sequences) of the PBGS to define unique features of E. coliPBGS. One significant variable feature in the PBGS family of proteins is the length and sequence of the active site lid. Based on the E. coli PBGS crystal structure, the lid is defined as the stretch from Ala196 to Gln219. The lid includes all of the residues in this region that are found to be disordered in PBGS structures 1AW5, 1B4K, and 1E51. Fig. 3 A shows a structure-based sequence alignment of the active site lid of human, yeast, E. coli, P. aeruginosa, B. japonicum, and P. sativum PBGS, which is different from previously published sequence-based alignments. Fig. 3 B shows a color-coded structural overlay of the lid region from PBGS corresponding to PDB codes 1E51 (human), 1YLV (yeast), 1I8J (E. coli), and 1B4K (P. aeruginosa). E. coliPBGS is unique among those tested with 4-OSA in that it has the shortest lid sequence. To evaluate the significance of this variable, we created, prepared, and characterized two chimeric “lid-switch” PBGS based on human PBGS using portions of the E. coli lid sequence. The minimal lid switch chimeric protein contains the small portion of the E. coli lid that varies in backbone structure. The sequence of this variant, called HsΔALK, is included in Fig. 3 A. HsΔALK is an active PBGS with a specific activity of ∼4% of wild type human PBGS and a normal Km value. Purified HsΔALK contains 3.5 Zn2+/octamer. As predicted from its increased sequence similarity with E. coli PBGS, HsΔALK has increased sensitivity to inhibition by 4-OSA (see Fig. 2 C). A less predictable result was observed when a larger portion of the lid sequence was switched. The human PBGS variant HsEclid contains the E. coli PBGS lid sequence from Arg204 to Gln219 (E. coli numbering) as illustrated in Fig. 3 A. HsEclid is also an active PBGS with a specific activity of ∼12% of wild type human PBGS and a normal Km value. HsEclid was found to purify with 4.5 Zn2+/octamer. Inconsistent with other human PBGS variants that are designed to resemble E. coli PBGS, HsEclid is insensitive to inhibition by 4-OSA (see Fig. 2 C). The human PBGS variant MinusZnA, whose behavior with 4-OSA is described above, is included in Fig. 3 because one of the mutations (C223A) is in this active site lid region. The Zn2+ stoichiometry of HsΔALK and HsEclid suggests that these human PBGS variants retain the property of half-site reactivity, a kinetic property that is well established for human PBGS but not for E. coli PBGS. The PBGS all share a common octameric structure with two monomers forming a dimer around either the non-crystallographic or crystallographic 2-fold symmetry axis and four such dimers forming a PBGS octamer around the 4-fold symmetry axis. Each monomer/subunit forms an αβ-barrel, the center of which holds the active site residues, while an N-terminal arm that varies in length between species is mutually wrapped around the neighboring subunit forming a compact dimeric structure. The N-terminal arms are involved in extensive subunit interactions within and between dimers. Some PBGS crystal structures show an individual subunit as the asymmetric crystallographic unit, and others (such as those presented here) show a dimer as the asymmetric unit. A variety of data have been interpreted to indicate that an oligomeric structure is required for activity (see Ref. 7Kervinen J. Dunbrack R.L., Jr. Litwin S. Martins J. Scarrow R.C. Volin M. Yeung A.T. Yoon E. Jaffe E.K. Biochemistry. 2000; 39: 9018-9029Crossref PubMed Scopus (37) Google Scholar). Each active site region is confined to one subunit and isolated from bulk solvent by a lid. The 4,7-DOSA-containing E. coli PBGS was the first structure to show that the lid-closed configuration involves extensive hydrogen bonding with the carboxyl group of the A-side ALA molecule, which makes up the acetyl half of porphobilinogen (see Fig. 1 A and below) (3Kervinen J. Jaffe E.K. Stauffer F. Neier R. Wlodawer A. Zdanov A. Biochemistry. 2001; 40: 8227-8236Crossref PubMed Scopus (40) Google Scholar). The structure is consistent with the notion that P-side ALA, which makes up the propionyl half of the product, binds first and that the A-side ALA binds second (see Refs. 18Jordan P.M. Seehra J.S. J. Chem. Soc. Chem. Commun. 1980; 5: 240-242Crossref Scopus (39) Google Scholar and 19Jaffe E.K. Hanes D. J. Biol. Chem. 1986; 261: 9348-9353Abstract Full Text PDF PubMed Google Scholar). Similar to other αβ-barrel enzymes, the ordering and disordering of the active site lid appears to be essential for substrate binding, isolation of the active site from bulk solvent, and product release. The current structures better define these lid motions. The lid residues seen to interact with active site ligands presented here and elsewhere are denoted in Fig. 3. Here we present the crystal structures of E. coli PBGS that has been inactivated by 4-OSA and of another one that has been inactivated by 4,7-DOSA. The latter structure is the same complex that we already published (PDB code 1I8J); however, this time resolution of the diffraction data was extended to 1.7 Å so that we were able to locate 183 extra water molecules, clarify that both Cys133Aand Cys133B are adducted with β-mercaptoethanol (see below), and generally provide a more accurate structural description of the protein and the inhibitors. A major new observation based on this structure is a significant variation in the position of the inhibitor half that mimics A-side ALA. Such a result has not been reported for the comparable complex of 4-OSA with yeast PBGS (5Erskine P.T. Coates L. Newbold R. Brindley A.A. Stauffer F. Wood S.P. Warren M.J. Cooper J.B. Shoolingin-Jordan P.M. Neier R. FEBS Lett. 2001; 503: 196-200Crossref PubMed Scopus (29) Google Scholar). Similar to the complex of 4,7-DOSA-inhibited PBGS, the 4-OSA-inhibited E. coli PBGS asymmetric unit contains a dimer, and each subunit of the 4-OSA complex contains one inhibitor molecule, one Zn2+bound at the active site, and one Mg2+ bound at the allosteric site (Fig. 4). Unlike the 4,7-DOSA-inhibited PBGS, the 4-OSA complex can form only one Schiff base linkage between each inhibitor and PBGS subunit; this linkage is observed. The RMS deviation between the Cα atoms of the two monomers forming a non-crystallographic dimer is 0.25 Å, whereas the RMS deviation between the 4,7-DOSA- and 4-OSA-inhibited PBGS dimers is 0.24 Å. Thus, we conclude that there are no significant differences between the monomers of the dimer or the dimers themselves upon binding either to 4,7-DOSA or 4-OSA (except for part of the lid near Arg204, described below), although the conformations of some side chains (mainly those located on the surface of the octamer) are occasionally different. The average temperature factors are 43.2 and 43.4 Å2 for monomers A and B of the 4-OSA-containing complex and 30.2 and 31.2 Å2 for monomers A and B of the 4,7-DOSA-containing complex. This indicates that the monomers in each complex have essentially the same degree of flexibility, although the crystals of the 4,7-DOSA complex have better internal order. The symmetry seen in E. coli PBGS dimers is in sharp contrast to the high resolution asymmetric dimer seen in P. aeruginosaPBGS (PDB code 1B4K) (20Frankenberg N. Erskine P.T. Cooper J.B. Shoolingin-Jordan P.M. Jahn D. Heinz D.W. J. Mol. Biol. 1999; 289: 591-602Crossref PubMed Scopus (72) Google Scholar) and the less well resolved human PBGS, which contains extensive disorder (PDB code 1E51, unpublished structure). The two E. coli PBGS structures presented here clarify the amino acid identity of position 133, which had previously been identified as a lysine (2Erskine P.T. Norton E. Cooper J.B. Lambert R. Coker A. Lewis G. Spencer P. Sarwar M. Wood S.P. Warren M.J. Shoolingin-Jordan P.M. Biochemistry. 1999; 38: 4266-4276Crossref PubMed Scopus (81) Google Scholar). The DNA sequence indicates Cys133 and mass spectroscopy analysis of an AspN digest was obtained herein to demonstrate the existence of a cysteine in this position. Because Cys133 is located on the surface of the protein, which has been purified and stored in the presence of mercaptoethanol, this residue appears as an adduct of βME and cysteine (S, S-2-(hydroxyethyl)thiocysteine). The adduct was first reported in a V23C variant of staphylococcal nuclease (21Wynn R. Harkins P.C. Richards F.M. Fox R.O. Protein Sci. 1996; 5: 1026-1031Crossref PubMed Scopus (33) Google Scholar), and the current electron density is an excellent fit to this model. The inhibitor molecules are clearly seen in the difference electron density maps in the area of the active site next to Lys194 and Lys246 in both monomers. In the case of 4,7-DOSA there are two covalent linkages between the protein and the inhibitor, and in the case of 4-OSA there is one covalent linkage. Fig. 5 A illustrates an electron density map of 4-OSA bound to the enzyme, and Fig. 5 B shows a comparison between the 4-OSA- and 4,7-DOSA-inhibited proteins. In both cases C1-C5 of the inhibitor are bound with a Schiff base linkage between C4 and the ε-amino group of Lys246. In these cases, as well as in related PBGS structures with inhibitors bound in the P-side ALA binding pocket (PDB codes: 1B4E, 1B4K, 1EB3, 1YLV, 1I8J,1GJP, 1H7N, 1H7P, 1H7R), the C1 carboxyl oxygens of the inhibitor make hydrogen bonds with Ser272 and Tyr311. The positions of the C2 and C3 atoms of each inhibitor are well defined but not equivalent to each other. The variation in these positions mimics the reported alternate conformations of levulinic acid bound as the P-side Schiff base to yeast PBGS (PDB code 1H7N) (22Erskine P.T. Newbold R. Brindley A.A. Wood S.P. Shoolingin-Jordan P.M. Warren M.J. Cooper J.B. J. Mol. Biol. 2001; 312: 133-141Crossref PubMed Scopus (39) Google Scholar). This variation defines the limited spatial flexibility of P-side ALA and dictates that these atoms cannot reorient much in response to required hybridization changes at C4. The position of C1-C4 of 4-OSA more closely resembles that of the product porphobilinogen. As reported previously for the 1.9-Å structure of 4,7-DOSA-inhibited E. coli PBGS, the bond between C5 and C6 of the inhibitor has a distorted cis-configuration (torsion angle of C4–C5–C6–C7 is ∼65°) to accommodate a second Schiff base linkage between C7 and the ε-amino group of Lys194. Because there is no Schiff base to Lys194 in the 4-OSA-inhibited enzyme, the conformation around the C5–C6 bond (torsion angle C4–C5–C6–C7 is ∼−88°) and the positions of C5-C10 of reacted 4-OSA are significantly different from those seen for 4,7-DOSA (Fig. 5 B). This suggests that A-side ALA has much greater positional flexibility than does P-side ALA. Positional flexibility is essential to accommodate the multiple hybridization changes required in the formation of porphobilinogen. In the case of both inhibitors, the A-side ALA half (C8–C10) extends out toward the lid where it makes extensive hydrogen-bond linkages between the C10 carboxyl oxygens and arginine residue(s). However, the hydrogen-bonding pattern is not the same for the two inhibitors, as illustrated schematically in Fig. 6. Unlike 4,7-DOSA, 4-OSA does not interact with Gln219through hydrogen bonds directly; instead it does so through a bridging water molecule. This is the same water molecule that forms similar bridging hydrogen bonds between Gln219 and Arg204 in the 4,7-DOSA-containing complex. To accommodate the different structure of the A-side half of the 4-OSA inhibitor, the side chain of Arg204 moves approximately 2.5 Å away from the position it occupied in the 4,7-DOSA complex (Fig. 5 B) and is locked in this new position by a hydrogen bond between its side chain NH1 atom and the carbonyl oxygen of Gly213. The position of Arg204 in the absence of an A-side ligand (structure 1B4E) is much" @default.
• W2163773277 created "2016-06-24" @default.
• W2163773277 creator A5011036334 @default.
• W2163773277 creator A5027980832 @default.
• W2163773277 creator A5055179810 @default.
• W2163773277 creator A5071893802 @default.
• W2163773277 creator A5081576631 @default.
• W2163773277 creator A5085398085 @default.
• W2163773277 creator A5091562604 @default.
• W2163773277 date "2002-05-01" @default.
• W2163773277 modified "2023-10-03" @default.
• W2163773277 title "Species-specific Inhibition of Porphobilinogen Synthase by 4-Oxosebacic Acid" @default.
• W2163773277 cites W1524100537 @default.
• W2163773277 cites W1539796472 @default.
• W2163773277 cites W1554023844 @default.
• W2163773277 cites W1974616082 @default.
• W2163773277 cites W1976308284 @default.
• W2163773277 cites W1981862881 @default.
• W2163773277 cites W1994827016 @default.
• W2163773277 cites W1995017064 @default.
• W2163773277 cites W1999730856 @default.
• W2163773277 cites W2000129995 @default.
• W2163773277 cites W2006621746 @default.
• W2163773277 cites W2007369154 @default.
• W2163773277 cites W2011254446 @default.
• W2163773277 cites W2013083986 @default.
• W2163773277 cites W2022330852 @default.
• W2163773277 cites W2025902568 @default.
• W2163773277 cites W2034626555 @default.
• W2163773277 cites W2043638626 @default.
• W2163773277 cites W2048139771 @default.
• W2163773277 cites W2054627528 @default.
• W2163773277 cites W2056567154 @default.
• W2163773277 cites W2086863310 @default.
• W2163773277 cites W2093420421 @default.
• W2163773277 cites W2118498357 @default.
• W2163773277 cites W2118548721 @default.
• W2163773277 cites W2162756720 @default.
• W2163773277 cites W2238669733 @default.
• W2163773277 cites W2300815036 @default.
• W2163773277 cites W2310375702 @default.
• W2163773277 cites W2346770505 @default.
• W2163773277 doi "https://doi.org/10.1074/jbc.m201486200" @default.
• W2163773277 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/11909869" @default.
• W2163773277 hasPublicationYear "2002" @default.
• W2163773277 type Work @default.
• W2163773277 sameAs 2163773277 @default.
• W2163773277 citedByCount "24" @default.
• W2163773277 countsByYear W21637732772014 @default.
• W2163773277 countsByYear W21637732772017 @default.
• W2163773277 countsByYear W21637732772020 @default.
• W2163773277 crossrefType "journal-article" @default.
• W2163773277 hasAuthorship W2163773277A5011036334 @default.
• W2163773277 hasAuthorship W2163773277A5027980832 @default.
• W2163773277 hasAuthorship W2163773277A5055179810 @default.
• W2163773277 hasAuthorship W2163773277A5071893802 @default.
• W2163773277 hasAuthorship W2163773277A5081576631 @default.
• W2163773277 hasAuthorship W2163773277A5085398085 @default.
• W2163773277 hasAuthorship W2163773277A5091562604 @default.
• W2163773277 hasBestOaLocation W21637732771 @default.
• W2163773277 hasConcept C112243037 @default.
• W2163773277 hasConcept C181199279 @default.
• W2163773277 hasConcept C185592680 @default.
• W2163773277 hasConcept C2776682811 @default.
• W2163773277 hasConcept C2781374117 @default.
• W2163773277 hasConcept C44538786 @default.
• W2163773277 hasConcept C55493867 @default.
• W2163773277 hasConceptScore W2163773277C112243037 @default.
• W2163773277 hasConceptScore W2163773277C181199279 @default.
• W2163773277 hasConceptScore W2163773277C185592680 @default.
• W2163773277 hasConceptScore W2163773277C2776682811 @default.
• W2163773277 hasConceptScore W2163773277C2781374117 @default.
• W2163773277 hasConceptScore W2163773277C44538786 @default.
• W2163773277 hasConceptScore W2163773277C55493867 @default.
• W2163773277 hasIssue "22" @default.
• W2163773277 hasLocation W21637732771 @default.
• W2163773277 hasOpenAccess W2163773277 @default.
• W2163773277 hasPrimaryLocation W21637732771 @default.
• W2163773277 hasRelatedWork W1918045784 @default.
• W2163773277 hasRelatedWork W2004021670 @default.
• W2163773277 hasRelatedWork W2019089536 @default.
• W2163773277 hasRelatedWork W2038908275 @default.
• W2163773277 hasRelatedWork W2052141035 @default.
• W2163773277 hasRelatedWork W2069269446 @default.
• W2163773277 hasRelatedWork W2073134219 @default.
• W2163773277 hasRelatedWork W2342448571 @default.
• W2163773277 hasRelatedWork W2400418602 @default.
• W2163773277 hasRelatedWork W958171835 @default.
• W2163773277 hasVolume "277" @default.
• W2163773277 isParatext "false" @default.
• W2163773277 isRetracted "false" @default.
• W2163773277 magId "2163773277" @default.
• W2163773277 workType "article" @default.