FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2167187961> ?p ?o ?g. }

• W2167187961 endingPage "37903" @default.
• W2167187961 startingPage "37896" @default.
• W2167187961 abstract "The present study was designed to elucidate the role of p38 mitogen-activated protein kinase (p38) in the pathogenesis of inflammation, using a mouse contact hypersensitivity (CHS) model induced by 2,4-dinitro-1-fluorobenzene (DNFB). Ear swelling was induced by challenge with DNFB, accompanied by infiltration of mononuclear cells, neutrophils, and eosinophils and a marked increase in mRNA levels of cytokines such as interleukin (IL)-2, interferon (IFN)-γ, IL-4, IL-5, IL-1β, IL-18, and tumor necrosis factor-α in the challenged ear skin. Both ear swelling and the number of infiltrated cells in DNFB-challenged ear skin were significantly inhibited by treatment with SB202190, a p38 inhibitor. Furthermore, the DNFB-induced expression of all cytokines except IL-4 was significantly inhibited by treatment with SB202190. Ribonuclease protection assay revealed that the mRNA levels of chemokines such as IP-10 and MCP-1 in ear skin were markedly increased at 24 h after challenge with DNFB. The induction of these chemokines was significantly inhibited by treatment with SB202190. In p38α +/− mice, both ear swelling and infiltration of cells induced by DNFB were reduced compared with those in wild-type mice. However, induction of cytokines by DNFB was also observed in p38α +/− mice, although the induction of IFN-γ, IL-5, and IL-18 was typically reduced compared with that in wild-type mice. Challenge with DNFB slightly induced IP-10 and MCP-1 mRNA in p38α +/− mice, with weaker signals than those in SB202190-treated wild-type mice. These results suggest that p38 plays a key role in CHS and is an important target for the treatment of CHS. The present study was designed to elucidate the role of p38 mitogen-activated protein kinase (p38) in the pathogenesis of inflammation, using a mouse contact hypersensitivity (CHS) model induced by 2,4-dinitro-1-fluorobenzene (DNFB). Ear swelling was induced by challenge with DNFB, accompanied by infiltration of mononuclear cells, neutrophils, and eosinophils and a marked increase in mRNA levels of cytokines such as interleukin (IL)-2, interferon (IFN)-γ, IL-4, IL-5, IL-1β, IL-18, and tumor necrosis factor-α in the challenged ear skin. Both ear swelling and the number of infiltrated cells in DNFB-challenged ear skin were significantly inhibited by treatment with SB202190, a p38 inhibitor. Furthermore, the DNFB-induced expression of all cytokines except IL-4 was significantly inhibited by treatment with SB202190. Ribonuclease protection assay revealed that the mRNA levels of chemokines such as IP-10 and MCP-1 in ear skin were markedly increased at 24 h after challenge with DNFB. The induction of these chemokines was significantly inhibited by treatment with SB202190. In p38α +/− mice, both ear swelling and infiltration of cells induced by DNFB were reduced compared with those in wild-type mice. However, induction of cytokines by DNFB was also observed in p38α +/− mice, although the induction of IFN-γ, IL-5, and IL-18 was typically reduced compared with that in wild-type mice. Challenge with DNFB slightly induced IP-10 and MCP-1 mRNA in p38α +/− mice, with weaker signals than those in SB202190-treated wild-type mice. These results suggest that p38 plays a key role in CHS and is an important target for the treatment of CHS. mitogen-activated protein kinase contact hypersensitivity dinitro-1-fluorobenzene interleukin interferon tumor necrosis factor glyceraldehyde-3-phosphate dehydrogenase c-Jun N-terminal kinase reverse transcriptase macrophage inflammatory protein IFN-γ inducible protein-10 epidermal cell phosphate-buffered saline wild type analysis of variance lymph node cells Mitogen-activated protein kinases (MAPKs)1 transduce a variety of extracellular signals to the transcriptional machinery via a cascade of protein phosphorylation. There are three genetically distinct MAPKs in mammals, consisting of extracellular signal-regulated kinase, c-Jun N-terminal kinase (JNK), and p38 MAPK (p38). All of three members are activated by dual phosphorylation of the conserved TXY motif and then phosphorylate their respective substrates on serine or threonine residues (1Minden A. Lin A. McMahon M. Lange-Carter C. Dérijard B. Davis R.J. Johnson G.L. Karin M. Science. 1994; 266: 1719-1723Crossref PubMed Scopus (1011) Google Scholar, 2Cano E. Mahadevan L.C. Trends Biochem. Sci. 1995; 20: 117-122Abstract Full Text PDF PubMed Scopus (997) Google Scholar, 3Han J. Jiang Y., Li, Z. Kravchenko V.V. Ulevitch R.J. Nature. 1997; 386: 296-299Crossref PubMed Scopus (685) Google Scholar). p38 was first identified as either a target for a group of anti-inflammatory drugs in human monocytes (cytokine-suppressive anti-inflammatory drug-binding protein (CSBP); see Ref. 4Lee J.C. Laydon J.T. McDonnell P.C. Gallagher T.F. Kumar S. Green D. McNulty D. Blumenthal M.J. Heys J.R. Landvatter S.W. Strickler J.E. MacLaughlin M.M. Siemens I.R. Fisher S.M. Livi G.P. White J.R. Adams J.L. Young P.R. Nature. 1994; 372: 739-746Crossref PubMed Scopus (3138) Google Scholar), a lipopolysaccharide-activated kinase in murine macrophage cell lines (p38; see Ref. 5Han J. Lee J.D. Bibbs L. Ulevitch R.J. Science. 1994; 265: 808-811Crossref PubMed Scopus (2413) Google Scholar), or a stress-responsive kinase that activates the protein kinase, MAPKAP kinase-2 reactivating kinase (RK; see Ref. 6Rouse J. Cohen P. Trigon S. Morange M. Llamazares A.A. Zamanillo D. Hunt T. Nebreda A.R. Cell. 1994; 78: 1027-1037Abstract Full Text PDF PubMed Scopus (1503) Google Scholar). There are four mammalian isoforms of p38 (α, β, γ, and δ). Among them, p38α and -β are expressed relatively ubiquitously, as shown by Northern blot analysis of adult tissues (7Jiang Y. Chen C., Li, Z. Guo W. Gegner J.A. Lin S. Han J. J. Biol. Chem. 1996; 271: 17920-17926Abstract Full Text Full Text PDF PubMed Scopus (658) Google Scholar), whereas p38γ is expressed only in skeletal muscle (8Li Z. Yong J. Ulevitch R.J. Han J. Biochem. Biophys. Res. Commun. 1996; 228: 334-340Crossref PubMed Scopus (353) Google Scholar), and p38δ expression is limited to the kidney and lung (9Jiang Y. Gram H. Zhao M. New L., Gu, J. Feng L. Padova F.D. Ulevitch R.J. Han J. J. Biol. Chem. 1997; 272: 30122-30128Abstract Full Text Full Text PDF PubMed Scopus (434) Google Scholar). Recent reports (10Tamura K. Sudo T. Senftleben U. Dadak A.M. Johnson R. Karin M. Cell. 2000; 102: 221-231Abstract Full Text Full Text PDF PubMed Scopus (321) Google Scholar,11Adams R.H. Porras A. Alonso G. Jones M. Vintersten K. Panelli S. Valladares A. Perez L. Klein R. Nebreda A.R. Mol. Cell. 2000; 6: 109-116Abstract Full Text Full Text PDF PubMed Scopus (450) Google Scholar) demonstrated that targeted disruption of the p38α gene results in homozygous embryonic lethality because of defects in erythropoiesis or placental organogenesis. Many groups have demonstrated that the p38 signaling pathway possibly controls inflammatory responses as follows. p38 has a role in transducing the mitogenic signal in T cells in response to interleukin (IL)-2 and IL-7 (12Crawley J.B. Rawlinson L. Lali F.V. Page T.H. Saklatvala J. Foxwell M.J. J. Biol. Chem. 1997; 272: 15023-15027Abstract Full Text Full Text PDF PubMed Scopus (215) Google Scholar). p38 mediates lipopolysaccharide-stimulated monocyte production of IL-10, IL-1β, and tumor necrosis factor (TNF)-α (13Foey A.D. Parry S.L. Williams L.M. Feldmann M. Foxwell B.M. Brennan F.M. J. Immunol. 1998; 160: 920-928PubMed Google Scholar). Interferon (IFN)-γ expression by Th1 effector T cells is mediated by p38 (14Rincón M. Enslen H. Raingeaud J. Recht M. Zapton T., Su, M.S.-S. Penix L.A. Davis R.J. Flavell R.A. EMBO J. 1998; 17: 2817-2829Crossref PubMed Scopus (358) Google Scholar). The production of IL-12 by macrophages and dendritic cells is reduced in MKK3 (a specific upstream MAPK kinase for p38)-deficient mice (15Lu H.-T Yang D.D. Wysk M. Gatti E. Mellman I. Davis R.J. Flavell R.A. EMBO J. 1999; 18: 1845-1857Crossref PubMed Scopus (328) Google Scholar). p38 regulates human T cell IL-5 synthesis and TNF-α mRNA stability (16Mori A. Kamimura O. Miyazawa K. Ogawa K. Okudaira H. Akiyama K. J. Immunol. 1999; 163: 4763-4771PubMed Google Scholar, 17Brrok M. Sully G. Clark A.R. Saklatvala J. FEBS Lett. 2000; 483: 57-61Crossref PubMed Scopus (193) Google Scholar). These findings tempt us to think that targeting of p38 might be a suitable anti-cytokine strategy for inflammatory disease. Against this notion, it was reported that inhibition of p38 activity rather leads to induction of TNF-α and IL-6 in some cases (18Zhang C. Baumgartner R.A. Yamada K. Beaven M.A. J. Biol. Chem. 1997; 272: 13397-13402Abstract Full Text Full Text PDF PubMed Scopus (190) Google Scholar, 19van den Blink B. Juffermans N.P. ten Hove T. Schultz M.J. van Deventer S.J.H. van der Poll T. Peppelenbosch M.P. J. Immunol. 2001; 166: 582-587Crossref PubMed Scopus (97) Google Scholar). In the present study, we used a murine contact hypersensitivity (CHS) model induced by 2,4-dinitro-1-fluorobenzene (DNFB) to investigate the role of p38 in inflammatory disease. First, we elucidated the inhibitory effect of SB202190, a p38 inhibitor, on DNFB-induced CHS. Second, we investigated how DNFB induces CHS in p38α heterozygous mice. The use of animal in all our experiments was in accordance with guidelines of Chiba University for animal care. Female mice heterozygous for targeted disruption of the p38α gene (10Tamura K. Sudo T. Senftleben U. Dadak A.M. Johnson R. Karin M. Cell. 2000; 102: 221-231Abstract Full Text Full Text PDF PubMed Scopus (321) Google Scholar) were crossed with C57BL/6J male mice (Saitama Experimental Animal Supply Co.) to generate p38α +/− and p38α +/+ (wild-type; Wt) mice. Offspring (>6 generations) were genotyped by PCR analysis of tail-derived DNA. Multiplex PCR with three primers per reaction was used. The primers were as follows: A, 5′-CCCTATACTCCCTCTCTGTGTAACTTTTG-3′; B, 5′-CCCAAACCCCAGAAAGAAATGATG-3′; and C, 5′-TTCAGTGACAACGTCGAGCACAGCTG-3′. Using these primers at 1 cycle at 94 °C for 5 min followed by 35 cycles at 94 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min, with an extension step of 7 min at 72 °C at the end of the last cycle, produced 800- and 450-bp fragments from the mutant and Wt alleles, respectively. Experiments were carried out by the protocol described previously (20Tomobe Y.I. Morizawa K. Tsuchida M. Hibino H. Nakano Y. Tanaka Y. Lipids. 2000; 35: 61-69Crossref PubMed Scopus (59) Google Scholar). Female mice (Wt and p38 α +/−, 8 weeks old) were sensitized on the shaved back skin with 100 μl of 0.5% DNFB diluted with a 4:1 acetone and olive oil solution (A/O). Five days after induction, 20 μl of the same DNFB mixture as used for induction was applied to both ears of the sensitized mice (challenge). As the control, 20 μl of DNFB-free A/O solution was applied to both ears of the sensitized mice. Before the challenge and 12, 24, and 48 h afterward, the thickness of the ears was measured using a thickness gauge (Ozaki Manufacturing. Co.). For determination of the effect of SB202190, 25 μl of 10−5m SB202190 diluted with A/O solution was applied to both ears of the sensitized Wt mice 30 min prior to challenge. The mice were sacrificed under deep anesthesia with an intraperitoneal injection of sodium pentobarbital 12, 24, or 48 h after challenge. Their ears were removed and immersed in 10% formaldehyde in 0.1 m sodium phosphate buffer (pH 7.4), and then embedded in paraffin and cut into sections 3 μm in thickness. The sections were placed on poly-l-lysine-coated slides and stained with hematoxylin and eosin. Individual inflammatory cell types were counted in high power fields at ×1000 and expressed as cells per high power field, with means and S.E. calculated. The ears were taken from control and challenged Wt mice with or without SB202190 treatment at various times (12 and 24 h) after the challenge. In the case of p38α +/− mice, the ears were taken from control and challenged mice 24 h after the challenge. Total RNA was prepared from the ears as described previously (21Chomczynski P. Sacchi N. Anal. Biochem. 1987; 162: 156-159Crossref PubMed Scopus (63187) Google Scholar). Single strand cDNA from prepared RNA (2 μg) was synthesized with Moloney murine leukemia virus reverse transcriptase (Invitrogen) using an oligo(dT) primer (Invitrogen) in a total volume of 40 μl. The cDNA sample (1 μl) was subjected to PCR for amplification of each cytokine cDNA. In the preliminary experiments, we confirmed the linearity of the reactions to determine the optimal number of cycles for each PCR product. The primer sequences, annealing temperature, cycle number, and size of each product are defined in Table I. Using those primers, PCR was performed at 94 °C for 5 min followed by individual cycles at 94 °C for 30 s, individual temperature for 30 s, 72 °C for 1 min with an extension step of 7 min at 72 °C at the end of the last cycle.Table IPrimer sequence, annealing temperature (A. temp.), number of cycles (Cycle no.), and size of PCR product used for detection of each cytokineGeneSequence (5′ to 3′)A. temp.Cycle no.Size°CbpIL-2SenseCAAGCTCTACAGCGGAAG5833370AntisenseTCCACCACAGTTGCTGACIFN-γSenseATCCTTTGGACCCTCTGACT6033529AntisenseCGACTCCTTTTCCGCTTCCTIL-4SenseACGGCACAGAGCTATTGATG6035454AntisenseATGGTGGCTCAGTACTACGAIL-5SenseATGTCCTGTAGTCAGTTAAACC6033733AntisenseAAGTTCAGTTACACGGAGAAGTIL1-βSenseTGGCAGCTACCTGTGTCTTT6035525AntisenseAGGCTTGTGCTCTGCTTGTGTNF-αSenseCCTCCCTCTCATCAGTTCTATG6035992AntisenseACACCCATTCCCTTCACAGAIL-18SenseACTGTACAACCGGAGTAATACGG6033319AntisenseTCCATCTTGTTGTGTCCTGGGAPDHSenseAATGTATCCGTTGTGGATCT6025262AntisenseTCCACCACCCTGTTGCTGTA Open table in a new tab Multiprobe templates, mCK-5 containing DNA templates for the chemokines lymphotactin, regulated on activation normal T cell expressed and secreted, eotaxin, macrophage inflammatory protein (MIP)-1α and β, MIP-2, IFN-γ inducible protein-10 (IP-10), monocyte chemoattractant protein-1 (MCP-1), and TCA-3, and for the housekeeping genes L32 (ribosomal RNA) and GAPDH were purchased from Pharmingen. The assay was performed according to the manufacturer's protocol. Briefly, the DNA templates were used to synthesize RNA probes, which were labeled with [32P]UTP (3000 Ci/mmol; PerkinElmer Life Sciences), in the presence of a GACU pool using a T7 polymerase. The probe was hybridized overnight with 10 μg of total RNA prepared from the ears of control and challenged mice under various conditions, followed by digestion with RNase A and T1. The samples were then treated with a proteinase K/SDS mixture, extracted with phenol/chloroform, and precipitated in the presence of ammonium acetate. The samples were loaded on an 5% acrylamide-urea sequencing gel next to undigested label probes and run at 30 watts with 0.5× Tris borate/EDTA electrophoresis buffer (TBE). The gel was dried on filter paper under a vacuum and exposed to x-ray film (Eastman Kodak Co.) for visualizing the protected signals. The ears were taken from Wt, SB202190-treated Wt, and p38α +/− mice 24 h after the challenge. Epidermal cell (EC) suspensions were prepared by the protocol described previously with some modifications (22Yoshizeki H. Ghoreishi M. Takagawa S. Takayama K. Satoh T. Katayama I. Takeda K. Akira S. Nishioka K. J. Exp. Med. 2000; 191: 995-1004Crossref PubMed Scopus (104) Google Scholar). In brief, the ears were washed with PBS and then treated with PBS containing 0.1% trypsin (Sigma) at 37 °C for 30 min. After washing the ears with PBS, epidermal sheets were peeled from the dermis using forceps. The sheets were treated with the medium (RPMI 1640 (Nissui Co., Japan) supplemented with 2 mml-glutamine and 100 units/ml penicillin) containing 0.2% collagenase (Worthington) at 37 °C for 60 min. Then the sheets were vigorously stirred, and the resulting EC suspensions were pelleted. After washing with ice-cold PBS twice, the cells were reconstituted in 42% Percoll (AmershamBiosciences) and carefully layered over 72% Percoll. The centrifugation was performed at 500 × g for 30 min at room temperature. The cells were collected from the interface and washed with ice-cold PBS twice. After suspending by gently passing through a 27-gauge needle, the cells were subjected to MACS separation with CD4 (L3T4) microbeads (Miltenyi Biotec). The isolation of CD4+ cells was performed according to the manufacturer's protocol. The number of resulting cells was counted, and each CD4+ cell with the same number (5 × 105) from Wt, SB202190-treated Wt, and p38α +/− mice challenged with DNFB was subjected to RNA preparation and RT-PCR for detection of IL-2, IFN-γ, IL-4, and IL-5 mRNA. Cell suspensions were obtained from lymph nodes from DNFB-sensitized Wt and p38α +/− littermate mice by the protocol described previously (22Yoshizeki H. Ghoreishi M. Takagawa S. Takayama K. Satoh T. Katayama I. Takeda K. Akira S. Nishioka K. J. Exp. Med. 2000; 191: 995-1004Crossref PubMed Scopus (104) Google Scholar). Cell suspensions (2 × 105 cells per 20 μl of PBS) were subcutaneously injected into the ears of naive Wt mice. The mice were immediately challenged by applying 20 μl of 0.5% DNFB in A/O solution or 20 μl of A/O solution alone on the ears. As a negative control, 20 μl of cell-free PBS was subcutaneously injected into the ears of naive Wt mice and immediately challenged with 0.5% DNFB. Ear thickness was measured as described above after 24 h. As shown in Fig. 1, DNFB induced ear swelling in mice in a time-dependent manner. The DNFB-induced ear swelling in SB202190-treated mice was significantly reduced compared with that in SB202190-untreated mice (p < 0.05). Histological analysis showed spongiosis in the challenged ear skin 24 h after challenge. Additionally, marked infiltration of inflammatory cells in the epidermis and dermis was observed in the challenged ear skin 24 and 48 h after challenge (Fig. 2, A–D). Treatment of mice with SB202190 decreased DNFB-induced pathophysiological parameters such as spongiosis and infiltration of inflammatory cells in the epidermis and dermis (Fig. 2, E–H). To characterize the inflammatory cells, sections of ear skin 24 h after challenge were examined under high power field. The infiltrated inflammatory cells were mainly mononuclear leukocytes, and significant migration of neutrophils and eosinophils was also observed (Fig.3 A). As shown in Fig.3 B, treatment of mice with SB202190 markedly reduced the number of infiltrated mononuclear cells, neutrophils, and eosinophils induced by DNFB in the challenged ear skin (p < 0.01).Figure 2Effect of SB202190 on time-dependent histopathological findings of CHS induced by DNFB. Histological features of CHS ear skin reaction were observed in control (A and E) mice and mice at 12 (B and F), 24 (C and G), and 48 h (D and H) after challenge. Time-dependent severe infiltration and hyperplasia observed in the challenged ear skin (B–D) were apparently reduced in SB202190-treated mice (F–H). Mouse ear sections were stained with hematoxylin and eosin. Bar represents 200 μm. Similar results were confirmed in eight independent experiments.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Figure 3Effect of SB202190 on histopathological findings of 24 h CHS ear skin reaction induced by DNFB challenge. A, marked infiltration of mononuclear cells (*), neutrophils (†), and eosinophils (#) was observed in the dermis of DNFB-challenged ear skin in SB202190-untreated mice (panel a) but was not typically observed in SB202190-treated mice (panel b). Barrepresents 50 μm. B, effect of SB202190 on cellular distribution of challenged skin. Bars represent number of mononuclear cells, neutrophils, and eosinophils that infiltrated the challenged ear skin of SB202190-untreated mice (open bars) and SB202190-treated mice (closed bars). Data presented are means ± S.D. of 12 mice. *, significantly different from SB202190-untreated values with p < 0.01 (Student'st test for unpaired values).View Large Image Figure ViewerDownload Hi-res image Download (PPT) The effect of SB202190 on DNFB-induced cytokine mRNA profiles in ear skin was elucidated. As shown in Fig.4, mRNA of all of cytokines was rarely detected in the control ear skin from both SB202190-untreated and -treated mice. Induction of IL-2, IFN-γ, IL-5, IL-1β, and IL-18 mRNA in ear skin challenged with DNFB was observed 12 and 24 h after challenge. Induction of IL-4 and TNF-α mRNA in ear skin challenged with DNFB was also observed 24 h after challenge. In SB202190-treated mice, the induction of cytokine mRNA of IL-2, IFN-γ, IL-5, IL-1β, IL-18, and TNF-α in the challenged ear skin was markedly suppressed compared with that in SB202190-untreated mice. On the contrary, DNFB challenge-induced IL-4 mRNA induction was not affected by SB202190 treatment. To elucidate how DNFB-induced CHS progresses in p38α +/− mice, we investigated ear swelling, expression of cytokines, and infiltration of inflammatory cells in DNFB-challenged ear skin of p38α +/− mice. In p38α +/− mice, DNFB-induced ear swelling was significantly reduced 24 h after challenge with DNFB compared with Wt mice (Fig.5 A). As shown in Fig.5 B, the mRNA levels of IL-2, IFN-γ, IL-4, IL-5, IL-1β, IL-18, and TNF-α were increased in the ear skin of p38α +/− mice 24 h after challenge with DNFB. The induction of IFN-γ, IL-5, and IL-18 mRNA by DNFB was suppressed in p38α +/− mice compared with Wt mice. On the other hand, the induction of IL-2, IL-4, IL-1β, and TNF-α mRNA by DNFB was similar in p38α +/− and Wt mice. The number of infiltrating mononuclear cells, neutrophils, and eosinophils in the challenged ear skin was calculated in p38α +/− mice and Wt mice with or without SB202190 treatment. As shown in Fig. 5 C, the number of infiltrated mononuclear cells, neutrophils, and eosinophils induced by DNFB in the challenged ear skin of p38α +/− mice was significantly reduced compared with that in Wt mice and was similar to that in SB202190-treated mice (p < 0.01). To elucidate whether the expression of chemokines was affected by DNFB, an RNase protection assay for a series of chemokines was performed with total RNA samples from Wt, SB202190-treated Wt, and p38α +/− mice. As shown in Fig. 6, low expression of MIP-1β and MIP-1α mRNA and high expression of MIP-2 mRNA were observed in control ear skin of Wt mice. Challenge with DNFB markedly increased the expression of IP-10 and MCP-1 mRNA. This typical expression of IP-10 and MCP-1 mRNA induced by DNFB was significantly inhibited by treatment with SB202190. The expression of MIP-1β, MIP-1α, and MIP-2 mRNA observed in control ear skin of Wt mice with or without SB202190 treatment was not detected in control ear skin of p38α +/− mice, although expression of internal controls, L32 and GAPDH mRNA, was clearly demonstrated. Challenge with DNFB induced IP-10, MCP-1, and MIP-2 mRNA in ear skin of p38α +/− mice with very weak signals. The profiles of cytokines mRNA in CD4+cells infiltrated into ear skin of Wt, SB202190-treated Wt, and p38α +/− mice were elucidated 24 h after DNFB challenge. As shown in Fig. 7 A, mRNA of cytokines such as Th1-like cytokines, IFN-γ and IL-2, and Th2-like cytokines, IL-4 and IL-5, was clearly detected in the infiltrated CD4+cells from Wt mice. The expression of IL-2, IL-4, and IL-5 mRNA in infiltrated CD4+ cells from SB202190-treated mice was also observed and similar to that from Wt mice, although the expression of IFN-γ mRNA was significantly decreased by SB202190 treatment. In p38α +/− mice, the expression of IFN-γ and IL-5 mRNA in infiltrated CD4+ cells was typically suppressed compared with that in Wt mice. On the other hand, the expression of IL-2 and IL-4 mRNA was similar in p38α +/− and Wt mice (Fig.7 B). To elucidate whether the reduction of CHS response to DNFB in p38α +/− mice takes place at the sensitization or elicitation phase, adoptive transfer experiments were performed. Ear swelling was measured 24 h after the challenge. As shown in Fig.8, DNFB induced ear swelling in Wt mice after the injection of lymph node cells (LNC) from the sensitized Wt mice. Also in case of injecting LNC from the sensitized p38α +/− mice into the ears of Wt mice, DNFB induced ear swelling. Even though LNC from the sensitized Wt or p38α +/− mice were injected into ears of Wt mice, application of DNFB-free A/O solution alone on the ears did not induce ear swelling. Without the injection of LNC, DNFB induced no ear swelling in naive Wt mice. The present study was designed to elucidate whether p38 is predominantly involved in the progression of CHS as a model of inflammatory disease and whether topical application of a p38 inhibitor has therapeutic utility in CHS. Here we showed that topical treatment with SB202190 significantly reduced both ear swelling and the histopathological findings induced by DNFB, indicating that p38 plays a critical role in CHS (Figs. Figure 1, Figure 2, Figure 3). The CHS model employed in the present study is based on chronic delayed type hypersensitivity (type IV hypersensitivity), because ear swelling and infiltration became worse and showed a maximum response 24 h after challenge. In the same CHS model, it has been demonstrated previously (23Yamazaki S. Kuwahara H. Kakishima H. Yakugaku Zasshi. 1997; 117: 155-161Crossref PubMed Scopus (5) Google Scholar) that expression of a Th1-like cytokine, IFN-γ, in the skin lesion is essential for the formation of CHS by analysis using an anti-IFN-γ antibody that neutralizes the bioactivity of IFN-γ. The Th1-like cytokine, IFN-γ, plays an important role in cell-mediated immunity and chronic inflammation (24O'Garra A. Immunity. 1998; 8: 275-283Abstract Full Text Full Text PDF PubMed Scopus (1344) Google Scholar). Thus, the effect of SB202190 on IFN-γ expression in the skin lesion is primarily important for understanding the mechanism of SB202190-suppressed CHS. As expected, DNFB-induced IFN-γ expression was significantly inhibited by treatment of sensitized mice with SB202190 (Fig. 4). The inhibitory effect of SB202190 on IFN-γ mRNA expression in the present study is consistent with the previous in vitro finding that expression of IFN-γ by Th1 effector cells is mediated by p38 (14Rincón M. Enslen H. Raingeaud J. Recht M. Zapton T., Su, M.S.-S. Penix L.A. Davis R.J. Flavell R.A. EMBO J. 1998; 17: 2817-2829Crossref PubMed Scopus (358) Google Scholar). IL-12, which was identified as an inducer of Th1-specific immune response, is known to promote IFN-γ production, and the p40 subunit is especially induced in CHS (25Schwarz T. Res. Immunol. 1995; 146: 494-499Crossref PubMed Scopus (16) Google Scholar, 26Robinson D. Shibuya K. Mui A. Zonin F. Murphy E. Sana T. Hartley S.B. Menon S. Kastelein R. Bazan F. O'Garra A. Immunity. 1997; 7: 571-581Abstract Full Text Full Text PDF PubMed Scopus (639) Google Scholar). Likewise, neutralization of IL-12 prevents DNFB-induced CHS (27Riemann H. Schwarz A. Grabbe S. Aragane Y. Luger T.A. Wysocka M. Kubin M. Trinchieri G. Schwarz T. J. Immunol. 1996; 156: 1799-1803PubMed Google Scholar). Furthermore, the p38 signaling pathway is crucial for IL-12 production (15Lu H.-T Yang D.D. Wysk M. Gatti E. Mellman I. Davis R.J. Flavell R.A. EMBO J. 1999; 18: 1845-1857Crossref PubMed Scopus (328) Google Scholar). However, IL-12 p40 mRNA was not detectable in control or challenged ear skin by RT-PCR with 40 cycles of amplification, although the primers used could detect IL-12 p40 mRNA in other tissues (data not shown). This might be explained by the previous investigation that IL-12 within the epidermis was detectable in human skin but not murine skin (27Riemann H. Schwarz A. Grabbe S. Aragane Y. Luger T.A. Wysocka M. Kubin M. Trinchieri G. Schwarz T. J. Immunol. 1996; 156: 1799-1803PubMed Google Scholar). Then, we investigated the expression of IL-18, another strong cofactor for Th1 cell development, in DNFB-challenged ear skin, because functional expression of IL-18 by murine keratinocytes has been reported (28Stoll S. Muller G. Kurimoto M. Saloga J. Tanimoto T. Yamauchi H. Okamura H. Knop J. Enk A.H. J. Immunol. 1997; 159: 298-302PubMed Google Scholar). The expression of IL-18 mRNA was increased in DNFB-challenged ear skin and was significantly inhibited by SB202190 (Fig. 4). As IL-18 was initially identified as an IFN-γ inducing factor and stimulated IFN-γ production in a p38 signal-dependent manner (29Okamura H. Tsutsi H. Komatsu T. Yutsudo M. Hakura A. Tanimoto T. Torigoe K. Okura T. Nukada Y. Hattori K. Akita K. Namba M. Tanabe F. Konishi K. Fukuda S. Kurimoto M. Nature. 1995; 378: 88-91Crossref PubMed Scopus (2411) Google Scholar,30Yang J. Zhu H. Murphy T.L. Ouyang W. Murphy K.M. Nat. Immunol. 2001; 2: 157-164Crossref PubMed Scopus (223) Google Scholar), the suppression of IL-18 production by SB202190 in the ear skin lesion may synergistically cause a decrease in expression of IFN-γ mRNA. On the other hand, Th1-like cytokine IL-2 also plays an important role in cell-mediated immunity and chronic inflammation through T cell growth and activation (24O'Garra A. Immunity. 1998; 8: 275-283Abstract Full Text Full Text PDF PubMed Scopus (1344) Google Scholar). The up-regulation of IL-2 mRNA in the DNFB-challenged ear skin was significantly inhibited by SB202190 (Fig. 4). This result is supported by the previous in vitro studies showing that p38 regulates the IL-2 gene (31Matsuda S. Moriguchi T. Koyasu S. Nishida E. J. Biol. Chem. 1998; 273: 12378-12382Abstract Full Text Full Text PDF PubMed Scopus (179) Google Scholar). In addition to Th1-like cytokines, recent studies demon" @default.
• W2167187961 created "2016-06-24" @default.
• W2167187961 creator A5012854197 @default.
• W2167187961 creator A5016480309 @default.
• W2167187961 creator A5018689347 @default.
• W2167187961 creator A5018804284 @default.
• W2167187961 creator A5027869563 @default.
• W2167187961 creator A5049346059 @default.
• W2167187961 creator A5054922975 @default.
• W2167187961 creator A5056315342 @default.
• W2167187961 creator A5059188729 @default.
• W2167187961 creator A5061561828 @default.
• W2167187961 creator A5065183724 @default.
• W2167187961 creator A5066456308 @default.
• W2167187961 creator A5079572703 @default.
• W2167187961 date "2002-10-01" @default.
• W2167187961 modified "2023-10-14" @default.
• W2167187961 title "Essential Role of p38 Mitogen-activated Protein Kinase in Contact Hypersensitivity" @default.
• W2167187961 cites W1637979534 @default.
• W2167187961 cites W1970581527 @default.
• W2167187961 cites W1975974673 @default.
• W2167187961 cites W1976462601 @default.
• W2167187961 cites W1982196736 @default.
• W2167187961 cites W1982785554 @default.
• W2167187961 cites W1988820544 @default.
• W2167187961 cites W2001399809 @default.
• W2167187961 cites W2004143904 @default.
• W2167187961 cites W2005293659 @default.
• W2167187961 cites W2005900169 @default.
• W2167187961 cites W2028772793 @default.
• W2167187961 cites W2029811971 @default.
• W2167187961 cites W2032731042 @default.
• W2167187961 cites W2033365840 @default.
• W2167187961 cites W2037111992 @default.
• W2167187961 cites W2038725731 @default.
• W2167187961 cites W2039627333 @default.
• W2167187961 cites W2042383304 @default.
• W2167187961 cites W2050690958 @default.
• W2167187961 cites W2057782686 @default.
• W2167187961 cites W2058556985 @default.
• W2167187961 cites W2062811432 @default.
• W2167187961 cites W2062892166 @default.
• W2167187961 cites W2072410510 @default.
• W2167187961 cites W2073541193 @default.
• W2167187961 cites W2086525709 @default.
• W2167187961 cites W2088764696 @default.
• W2167187961 cites W2096279219 @default.
• W2167187961 cites W2116493322 @default.
• W2167187961 cites W2127505361 @default.
• W2167187961 cites W2144011146 @default.
• W2167187961 cites W2148726934 @default.
• W2167187961 cites W2149070375 @default.
• W2167187961 cites W2169241566 @default.
• W2167187961 cites W2171831396 @default.
• W2167187961 cites W2310080439 @default.
• W2167187961 cites W2407863315 @default.
• W2167187961 cites W4211264883 @default.
• W2167187961 cites W425633012 @default.
• W2167187961 cites W4294216491 @default.
• W2167187961 doi "https://doi.org/10.1074/jbc.m207326200" @default.
• W2167187961 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12138127" @default.
• W2167187961 hasPublicationYear "2002" @default.
• W2167187961 type Work @default.
• W2167187961 sameAs 2167187961 @default.
• W2167187961 citedByCount "52" @default.
• W2167187961 countsByYear W21671879612012 @default.
• W2167187961 countsByYear W21671879612013 @default.
• W2167187961 countsByYear W21671879612014 @default.
• W2167187961 countsByYear W21671879612015 @default.
• W2167187961 countsByYear W21671879612016 @default.
• W2167187961 countsByYear W21671879612017 @default.
• W2167187961 countsByYear W21671879612018 @default.
• W2167187961 countsByYear W21671879612020 @default.
• W2167187961 countsByYear W21671879612021 @default.
• W2167187961 crossrefType "journal-article" @default.
• W2167187961 hasAuthorship W2167187961A5012854197 @default.
• W2167187961 hasAuthorship W2167187961A5016480309 @default.
• W2167187961 hasAuthorship W2167187961A5018689347 @default.
• W2167187961 hasAuthorship W2167187961A5018804284 @default.
• W2167187961 hasAuthorship W2167187961A5027869563 @default.
• W2167187961 hasAuthorship W2167187961A5049346059 @default.
• W2167187961 hasAuthorship W2167187961A5054922975 @default.
• W2167187961 hasAuthorship W2167187961A5056315342 @default.
• W2167187961 hasAuthorship W2167187961A5059188729 @default.
• W2167187961 hasAuthorship W2167187961A5061561828 @default.
• W2167187961 hasAuthorship W2167187961A5065183724 @default.
• W2167187961 hasAuthorship W2167187961A5066456308 @default.
• W2167187961 hasAuthorship W2167187961A5079572703 @default.
• W2167187961 hasBestOaLocation W21671879611 @default.
• W2167187961 hasConcept C132149769 @default.
• W2167187961 hasConcept C184235292 @default.
• W2167187961 hasConcept C185592680 @default.
• W2167187961 hasConcept C51551487 @default.
• W2167187961 hasConcept C86803240 @default.
• W2167187961 hasConcept C95444343 @default.
• W2167187961 hasConcept C97029542 @default.
• W2167187961 hasConceptScore W2167187961C132149769 @default.
• W2167187961 hasConceptScore W2167187961C184235292 @default.

• next