FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2167481964> ?p ?o ?g. }

• W2167481964 endingPage "34852" @default.
• W2167481964 startingPage "34846" @default.
• W2167481964 abstract "Clostridial neurotoxins potently and specifically inhibit neurotransmitter release in defined cell types. Here we report that a catalytically active derivative (termed LHN/A) of the type A neurotoxin from Clostridium botulinum has been coupled to a lectin obtained from Erythrina cristagalli to form a novel conjugate. This conjugate exhibits anin vitro selectivity for nociceptive afferents compared with the anatomically adjacent spinal neurons, as assessed usingin vitro primary neuronal culture systems to measure inhibition of release of neurotransmitters. Chemical conjugates prepared between E. cristagalli lectin and either natively sourced LHN/A or recombinant LHN/A purified from Escherichia coli are assessed, and equivalence of the recombinant material are demonstrated. Furthermore, the dependence of inhibition of neurotransmitter release on the cleavage of SNAP-25 is demonstrated through the use of an endopeptidase-deficient LHN/A conjugate variant. The duration of action of inhibition of neurotransmitter released by the conjugate in vitro is assessed and is comparable with that observed withClostridium botulinum neurotoxin. Finally, in vivo electrophysiology shows that these in vitroactions have biological relevance in that sensory transmission from nociceptive afferents through the spinal cord is significantly attenuated. These data demonstrate that the potent endopeptidase activity of clostridial neurotoxins can be selectively retargeted to cells of interest and that inhibition of release of neurotransmitters from a neuronal population of therapeutic relevance to the treatment of pain can be achieved. Clostridial neurotoxins potently and specifically inhibit neurotransmitter release in defined cell types. Here we report that a catalytically active derivative (termed LHN/A) of the type A neurotoxin from Clostridium botulinum has been coupled to a lectin obtained from Erythrina cristagalli to form a novel conjugate. This conjugate exhibits anin vitro selectivity for nociceptive afferents compared with the anatomically adjacent spinal neurons, as assessed usingin vitro primary neuronal culture systems to measure inhibition of release of neurotransmitters. Chemical conjugates prepared between E. cristagalli lectin and either natively sourced LHN/A or recombinant LHN/A purified from Escherichia coli are assessed, and equivalence of the recombinant material are demonstrated. Furthermore, the dependence of inhibition of neurotransmitter release on the cleavage of SNAP-25 is demonstrated through the use of an endopeptidase-deficient LHN/A conjugate variant. The duration of action of inhibition of neurotransmitter released by the conjugate in vitro is assessed and is comparable with that observed withClostridium botulinum neurotoxin. Finally, in vivo electrophysiology shows that these in vitroactions have biological relevance in that sensory transmission from nociceptive afferents through the spinal cord is significantly attenuated. These data demonstrate that the potent endopeptidase activity of clostridial neurotoxins can be selectively retargeted to cells of interest and that inhibition of release of neurotransmitters from a neuronal population of therapeutic relevance to the treatment of pain can be achieved. The clostridial neurotoxin (CNT) 1The abbreviations used are: CNT, clostridial neurotoxin; HC, heavy chain C terminus; HN, heavy chain N terminus; SNARE, soluble NSF attachment protein receptors; SNAP, synaptosome-associated protein-25; eDRG, embryonic dorsal root ganglia; ECL, Erythrina cristagalli lectin; eSCN, embryonic spinal cord neuron; BSS, balanced salt solution. family includes tetanus toxin (TeNT), produced by Clostridium tetani, and the seven antigenically distinct botulinum neurotoxins produced from strains of Clostridium botulinum (BoNTs). These proteins are responsible for the conditions of tetanus and botulism, respectively, that develop as a direct result of inhibition of Ca2+-dependent neurotransmitter release, a mechanism of action common to all the CNTs. In the case of BoNTs, intoxication of the neuromuscular junction is thought to occur in at least three phases: an initial binding phase, an internalization phase, and finally a neurotransmitter blockade phase (1Simpson L.L. Pharmacol. Rev. 1981; 33: 155-188PubMed Google Scholar). All CNTs have a similar structure and consist of a heavy chain (∼100 kDa) covalently joined to a light chain (∼50 kDa) by a single disulfide bond. Proteolytic cleavage of the heavy chain ofC. botulinum neurotoxin type A (BoNT/A) generates two fragments of ∼50 kDa each. The C-terminal domain (HC) is required for target cell binding, with the N-terminal domain (HN) being proposed to be involved in intracellular membrane translocation (2Shone C.C. Hambleton P. Melling J. Eur. J. Biochem. 1987; 167: 175-180Crossref PubMed Scopus (99) Google Scholar). Under conditions in which the disulfide bond between the light and heavy chains is maintained, trypsin cleavage results in a 100-kDa species termed LHN/A (light chain plus N-terminal heavy chain domain) representing a catalytically active, non-cell binding, non-toxic derivative of BoNT/A. In addition to obtaining LHN/A from BoNT/A, we have recently reported that LHN/A can be expressed and purified from a heterologous expression host (3Chaddock J. Prot. Exp. Purif. 2002; 25: 219-228Crossref PubMed Scopus (59) Google Scholar). It is proposed that CNTs bind to their target cell by a combination of specific high affinity binding events, possibly involving more than one ganglioside and glycoprotein component (4Halpern J.L. Neale E.A. Curr. Top. Microbiol. Immunol. 1995; 195: 221-241PubMed Google Scholar). The proposal that BoNT/B binds to synaptotagmin and the gangliosides GT1b and GD1a (5Nishiki T. Kamata Y. Nemoto Y. Omori A. Ito T. Takahashi M. Kozaki S. J. Biol. Chem. 1994; 269: 10498-10503Abstract Full Text PDF PubMed Google Scholar) and that BoNT/A and BoNT/E may also bind to synaptotagmin (6Li L. Singh B.R. J. Nat. Toxins. 1998; 7: 215-226PubMed Google Scholar) has supported this concept. Having accomplished the first cell intoxication stage of binding, CNTs require mechanisms to facilitate internalization into, and intracellular routing within, the target cell. Although the definitive mechanisms remain unclear, the role of an acidic compartment has been proposed (7Hoch D.H. Romero-Mira M. Ehrlich B.E. Finkelstein A. DasGupta B.R. Simpson L.L. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 1692-1696Crossref PubMed Scopus (254) Google Scholar) in common with a number of other bacterial protein toxins (8Sandvig K. Olsnes S. J. Cell Biol. 1980; 87: 828-832Crossref PubMed Scopus (282) Google Scholar). It is proposed that it is the role of the HN domain to facilitate translocation of the endopeptidase into the cytosol, and the successful retargeting of functional LHN/A into model cell lines (9Chaddock J.A. Purkiss J.R. Friis L.M. Broadbridge J.D. Duggan M.J. Fooks S.J. Shone C.C. Quinn C.P. Foster K.A. Infect. Immun. 2000; 68: 2587-2593Crossref PubMed Scopus (65) Google Scholar) has excluded the obligatory requirement of the HC domain for intracellular trafficking mechanisms. Once the CNT (or fragment) has gained access to the cytosol, the proteolytic light chains specifically hydrolyze key components of the SNARE protein complex (10Sollner T. Whiteheart S.W. Brunner M. Erdjument-Bromage H. Geromanos S. Tempst P. Rothman J.E. Nature. 1993; 362: 318-324Crossref PubMed Scopus (2637) Google Scholar) required for synaptic vesicle docking, fusion, and neurotransmitter release. In the case of BoNT/A and BoNT/E the substrate is synaptosome-associated protein-25 (SNAP-25), whereas the vesicle-associated membrane protein and syntaxin families of proteins are substrates for neurotoxin types B, D, F, G, and type C, respectively (11Blasi J. Chapman E.R. Link E. Binz T. Yamasaki S., De Camilli P. Sudhof T.C. Niemann H. Jahn R. Nature. 1993; 365: 160-163Crossref PubMed Scopus (1050) Google Scholar, 12Montecucco C. Schiavo G. Mol. Microbiol. 1994; 13: 1-8Crossref PubMed Scopus (496) Google Scholar). It has been demonstrated that cleavage of these components of the SNARE complex by CNTs results in inhibition of transmitter release from a variety of neuronal cell systems. It is also known that formation of the SNARE complex is a universal mechanism of vesicle fusion and secretion, not limited to neuronal cell types. To circumvent the limited availability of the requisite toxin receptor(s) on the target cell of interest, we have previously reported the replacement of the HC domain with a variety of ligands and retargeting of the LHN/A fragment into a range of neuronal and non-neuronal cells (9Chaddock J.A. Purkiss J.R. Friis L.M. Broadbridge J.D. Duggan M.J. Fooks S.J. Shone C.C. Quinn C.P. Foster K.A. Infect. Immun. 2000; 68: 2587-2593Crossref PubMed Scopus (65) Google Scholar, 13Chaddock J.A. Purkiss J.R. Duggan M.J. Quinn C.P. Shone C.C. Foster K.A. Growth Factors. 2000; 18: 147-155Crossref PubMed Scopus (54) Google Scholar). In this study we have further developed the technology of retargeting clostridial endopeptidases with a view to endowing the conjugate with an ability to selectively target cells of potential therapeutic interest relative to anatomically and functionally closely related cells. Furthermore, we have investigated aspects of the duration of action of retargeted endopeptidases because a number of reports (14Brashear A. Watts M.W. Marchetti A. Magar R. Lau H. Wang L. Clin. Ther. 2000; 22: 1516-1524Abstract Full Text PDF PubMed Scopus (43) Google Scholar,15Johnson E.A. Annu. Rev. Microbiol. 1999; 53: 551-575Crossref PubMed Scopus (144) Google Scholar) highlight the significant longevity of action of BoNT/A when used therapeutically. As a model system we have chosen to study the effects of selectively targeting the endopeptidase domain to nociceptive afferents. In vivo, the role of nociceptive afferents is to sense noxious stimuli at the periphery and to transmit this information to the central nervous system where it is perceived as pain. Transmission of this signal is dependent on release of a number of transmitters (including glutamate, substance P, and calcitonin gene-related peptide) from synaptic vesicles (16Dray A. Urban L. Dickenson A. Trends Pharmacol. Sci. 1994; 15: 190-197Abstract Full Text PDF PubMed Scopus (210) Google Scholar). Though these transmitters are found in the same terminals of small-diameter primary afferents, glutamate is released from a different population of synaptic vesicles to the neuropeptides (substance P and calcitonin gene-related peptide) (17De Biasi S. Rustioni A. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 7820-7824Crossref PubMed Scopus (533) Google Scholar). We have previously reported that release of substance P from a rat embryonic dorsal root ganglia (eDRG) neuronal culture system (an in vitro system representative of nociceptive afferents) is sensitive to inhibition by BoNT/A (18Welch M.J. Purkiss J.R. Foster K.A. Toxicon. 2000; 38: 245-258Crossref PubMed Scopus (424) Google Scholar), indicating that release of substance P is SNARE-mediated. We theorized that if clostridial endopeptidases could be selectively targeted to the nociceptive afferents in preference to anatomically adjacent neurons inhibition of the transmission of noxious stimuli may be specifically prevented. In the search for suitable targeting ligands we observed that lectins (non-immunoglobulin proteins that recognize and bind to carbohydrates) (19Lis H. Sharon N. Annu. Rev. Biochem. 1986; 55: 35-67Crossref PubMed Scopus (621) Google Scholar, 20Sharon N. Trends Biochem. Sci. 1993; 18: 221-226Abstract Full Text PDF PubMed Scopus (255) Google Scholar) had the potential to selectively bind to extracellular moieties and thus be used to differentiate between cell types. It has been reported that galactose-containing carbohydrates are selectively present on nociceptive neurons in the central and peripheral nervous system relative to other neurons (21Streit W.J. Schulte B.A. Balentine D.J. Spicer S.S. J. Histochem. Cytochem. 1985; 33: 1042-1052Crossref PubMed Scopus (144) Google Scholar, 22Streit W.J. Schulte B.A. Balentine J.D. Spicer S.S. Brain Res. 1986; 377: 1-17Crossref PubMed Scopus (115) Google Scholar). From these reports, and experiments to identify binding of fluorescent-labeled lectins, we identified Erythrina cristagalli lectin (ECL) as a suitable ligand for selectively targeting LHN/A endopeptidase to nociceptive afferents. Here we report that LHN/A-ECL conjugate binds to, internalizes into, and inhibits stimulated neurotransmitter release from cultured eDRG neuronal cell types in preference to spinal cord neurons. Through the use of an endopeptidase-deficient conjugate variant, effects on neurotransmitter release are correlated to cleavage of the natural BoNT/A substrate SNAP-25. This ability to achieve cell-selective inhibition of secretion by retargeted LHNpoints to the potential future therapeutic use of retargeted clostridial endopeptidases and, specifically in this instance, to the treatment of pain. Recombinant and “native” (i.e. prepared by trypsin treatment of BoNT/A) LHN/A were prepared as described elsewhere (3Chaddock J. Prot. Exp. Purif. 2002; 25: 219-228Crossref PubMed Scopus (59) Google Scholar). Derivatization of ECL (Sigma; reconstituted to 10 mg/ml in phosphate-buffered saline) and LHN/A (5 mg/ml in phosphate-buffered saline) was based on methodology described previously (9Chaddock J.A. Purkiss J.R. Friis L.M. Broadbridge J.D. Duggan M.J. Fooks S.J. Shone C.C. Quinn C.P. Foster K.A. Infect. Immun. 2000; 68: 2587-2593Crossref PubMed Scopus (65) Google Scholar). Briefly, ∼2 reactive leaving groups were introduced into LHN/A and a single sulfhydryl group was introduced into ECL, in both cases by reaction withN-succinimidyl-3-(2-pyridyldithio)propionate. Initial fractionation of the conjugate mixture was performed by size exclusion chromatography (Superose-12, or Superdex G-200 depending on the scale of conjugation). Application of high molecular weight material to immobilized lactose (Sigma) isolated functional conjugate, which was eluted by the addition of 0.3 m lactose. Specifically eluted fractions were dialyzed extensively against phosphate-buffered saline to remove lactose. To create an LHN/A variant defective in endopeptidase activity, a single amino acid mutation at position 227 of the light chain sequence was performed by introduction of the codon for tyrosine (TAC) in place of histidine (CAC). Mutagenesis was performed by overlap polymerase chain reaction using a mutagenic primer pair of CACACGAGCTCATCTACGCCGGTCATCG and CGATGACCGGCGTAGATGAGCTCGTGTG. A single silent SacI site was introduced to aid screening of mutants. The integrity of the entire LHN/A(H227Y) DNA sequence was confirmed by sequencing. Mutated DNA was transformed intoEscherichia coli TG1, and expression and purification procedures followed essentially as described previously (3Chaddock J. Prot. Exp. Purif. 2002; 25: 219-228Crossref PubMed Scopus (59) Google Scholar). SDS-PAGE and Western blot analyses were performed by standard protocols (Novex). Assessment of the ability ofrecLHN/A,recLHN/A(H227Y), and conjugates to cleave SNAP-25 in vitro was performed essentially as previously described (23Hallis B. James B.A.F. Shone C.C. J. Clin. Microbiol. 1996; 34: 1934-1938Crossref PubMed Google Scholar). Primary neuronal cultures of eDRG and eSCN were established using modifications of existing procedures (24Ransom B.R. Neale E. Henkart M. Bullock P.N. Nelson P.G. J. Neurophysiol. 1977; 40: 1132-1150Crossref PubMed Scopus (419) Google Scholar, 25Williamson L.C. Halpern J.L. Montecucco C. Brown J.E. Neale E.A. J. Biol. Chem. 1996; 271: 7694-7699Abstract Full Text Full Text PDF PubMed Scopus (187) Google Scholar, 26Welch M.J. Foster K.A. Haynes L.W. The Neuron in Tissue Culture. 18. John Wiley & Sons Ltd., Chichester, UK1999: 389-393Google Scholar). Briefly, dorsal root ganglia and spinal cord neurons were harvested from 15-day-old fetal Sprague-Dawley rats. For culture of eDRG, dissociated cells were plated onto 24-well plates coated with Matrigel at a density of 1 × 106cells/well. One day postplating the cells were treated with 10 μm cytosine β-d-arabinofuranoside for 48 h. Cells were maintained in Dulbecco's minimal essential medium supplemented with 5% heat-inactivated fetal bovine serum, 5 mml-glutamine, 0.6% d-glucose, 2% B27 supplement, and 100 ng/ml 2.5S mouse nerve growth factor. Cultures were maintained for 2 weeks at 37 °C in 95% air/5% CO2 before addition of test materials. In the case of eSCN, dissociated cells were plated onto 12-well plates coated with poly-d-lysine at a density of 2 × 106 cells/well. After 1 week, the cells were treated with 35 μg/ml uridine and 15 μg/ml 2-fluoro 5′-deoxyuridine and grown in minimal essential medium supplemented with 5% heat-inactivated horse serum, 2 mml-glutamine, 0.6%d-glucose, 40 ng/ml corticosterone, 20 ng/ml triiodothyronine, 0.15% (w/v) sodium bicarbonate, and 2% N1 supplement. Cultures were maintained for 3 weeks at 37 °C in 90% air/10% CO2 before addition of test materials. Release of substance P from eDRG was assessed by enzyme-linked immunosorbent assay. Briefly, eDRG cells were washed twice with low potassium-balanced salt solution (BSS: 5 mmKCl, 137 mm NaCl, 1.2 mm MgCl2, 5 mm glucose, 0.44 mmKH2PO4, 20 mm HEPES, pH 7.4, 2 mm CaCl2). Basal samples were obtained by incubating each well for 5 min with 1 ml of low potassium BSS. After removal of this buffer, the cells were stimulated to release by incubation with 1 ml of high potassium buffer (BSS as above with modification to include 100 mm KCl isotonically balanced with NaCl) for 5 min. All samples were removed to tubes on ice prior to assay of substance P. Total cell lysates were prepared by addition of 250 μl of 2 m acetic acid/0.1% trifluoroacetic acid to lyse the cells, centrifugal evaporation, and resuspension in 500 μl of assay buffer. Diluted samples were assessed for substance P content. Substance P immunoreactivity was measured using Substance P Enzyme Immunoassay Kits (Cayman Chemical Company or R&D Systems) according to manufacturers' instructions. Substance P is expressed in pg/ml relative to a standard substance P curve run in parallel. Release of glutamate from eDRG was assessed as described previously (27Purkiss J.R. Welch M.J. Doward S. Foster K.A. Quinn C.P. Biochem. Soc. Trans. 1998; 26: S108Crossref PubMed Scopus (15) Google Scholar). Briefly, eDRG were exposed to 2–5 μCi/ml (1 ml/well) of [3H]-l-glutamine for 80 min at 37 °C, prior to extensive washing in low potassium BSS. Cells were stimulated to release by the addition of 100 mm KCl for 3 min. Released glutamate was identified following separation ofl-[3H]glutamate from non-metabolizedl-[3H]glutamine by ion exchange chromatography (Dowex-1). Release of transmitter from eSCN was determined essentially as described previously (25Williamson L.C. Halpern J.L. Montecucco C. Brown J.E. Neale E.A. J. Biol. Chem. 1996; 271: 7694-7699Abstract Full Text Full Text PDF PubMed Scopus (187) Google Scholar). Briefly, eSCN cells were washed with BSS and then loaded with [3H]glycine for 30 min prior to wash and then removal of basal and stimulated (using 56 mmK+ solution) samples. Cells were lysed by addition of 250 μl of 2 m acetic acid/1% trifluoroacetic acid, and a sample was used to determine total counts from which % release could be calculated. The basal, stimulated, and cell lysate readings were determined by liquid scintillation counting of the cleared superfusate collected from each treatment. Determination of the ratio of cleaved SNAP-25 to uncleaved SNAP-25 in eDRG following exposure to conjugate material was assessed as described previously (28Boyd R.S. Duggan M.J. Shone C.C. Foster K.A. J. Biol. Chem. 1995; 270: 18216-18218Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). Test material was applied intrathecally using methodology previously described (29Dickenson A.H. Sullivan A.F. Pain. 1986; 24: 211-222Abstract Full Text PDF PubMed Scopus (219) Google Scholar, 30Matthews E.A. Dickenson A.H. Pain. 2001; 92: 235-246Abstract Full Text Full Text PDF PubMed Scopus (167) Google Scholar). Briefly, to assess the acute effects of test material on the responses of spinal cord neurons to stimulation of C-, Aβ- and Aδ-fibers, 100 μl of LHN/A-ECL (4.5 μg/μl) was applied to the exposed spinal cord of halothane/nitrous oxide anesthetized rats. Rats were maintained at 37 °C in a state of areflexia under 1.5–1.8% halothane. Extracellular recordings of convergent dorsal horn neurons were made with parylene-coated tungsten electrodes descended through the spinal cord (mean depth of recording neurons was 700 μm from the surface of the cord). The responses of neurons following transcutaneous electrical stimulation (2-ms wide pulses) of the center of the receptive field were recorded. Responses elicited by a train of 16 stimuli at three times the stimulation threshold for C-fibers were quantified and followed for up to 8 h following spinal application of test material. In a separate group of animals, assessment of electrophysiological response 24 h after application of conjugate was performed by modification of the above procedure. 10 μl of a 4.5 μg/μl solution of LHN/A-ECL was applied by intrathecal injection between lumbar sections L4-L5. Animals were allowed to recover, and then analysis of neuronal activity was made at 24 h postapplication, at which time 10 neurons from a single animal were assessed for response to transcutaneous electrical stimulation as described above. Recordings from 10 neurons from an untreated animal were used to establish control response. The ability of botulinum toxin and conjugate material to induce paralysis in mice (20–25 g, MF1) was evaluated following intraperitoneal injection of 0.5 ml of test sample in gelatin-phosphate buffer (1% (w/v) Na2HPO4, 0.2% (w/v) gelatin, pH 6.5–6.6, using methodology reported previously (31Tse C.K. Dolly J.O. Hambleton P. Wray D. Melling J. Eur. J. Biochem. 1982; 122: 493-500Crossref PubMed Scopus (45) Google Scholar). To prepare a conjugate capable of selective targeting of eDRG neurons, data were obtained for the binding of a range of fluorescein isothiocyanate-labeled lectins to eDRG and eSCN. Data obtained for the lectin obtained from the seeds of ECL demonstrated the most appropriate pattern of eDRG localization (data not shown). Conjugation of ECL to the nLHN/A (native LHN/A) and recLHN/A (recombinant LHN/A) fragment was performed essentially as previously described for a wheat germ agglutinin-LHN/A conjugate (9Chaddock J.A. Purkiss J.R. Friis L.M. Broadbridge J.D. Duggan M.J. Fooks S.J. Shone C.C. Quinn C.P. Foster K.A. Infect. Immun. 2000; 68: 2587-2593Crossref PubMed Scopus (65) Google Scholar), resulting in a conjugation efficiency of 15.9 ± 4.3% (mean yield of ∼5 mg of conjugate from 8 mg of LHN/A and 25 mg of ECL). There were no significant differences between the derivatization rates or final conjugate yield when nLHN/A,recLHN/A, orrecLHN/A(H227Y) was used for conjugate synthesis. Purification of the conjugate was achieved by a two-step process, involving size-exclusion chromatography to remove unconjugated ECL followed by affinity chromatography (immobilized lactose) to remove unconjugated LHN/A. When analyzed by SDS-PAGE (Fig.1), conjugated species of ∼160 kDa are the major component of the final material, representative of a single LHN/A endopeptidase covalently coupled to two ECL monomers. The species of ∼30 kDa apparent in lane 6 of Fig. 1represents ECL monomers that have been liberated from the conjugate in the presence of SDS, thus the final molecular mass of the predominant conjugate species is ∼200 kDa. However, it is clear from SDS-PAGE and size exclusion data that there is a range of conjugate species of varying ECL:LHN/A ratios present in the final purified mixture. Analysis of the conjugate material by native PAGE is suggestive of predominant conjugate species of 200 and 400 kDa (data not shown). In addition to the functionality of the ECL domain, as assessed by lactose binding, it was necessary to confirm that the endopeptidase activity of the conjugate was not adversely affected by the derivatization/conjugation process. By utilizing an in vitroSNAP-25 cleavage assay (23Hallis B. James B.A.F. Shone C.C. J. Clin. Microbiol. 1996; 34: 1934-1938Crossref PubMed Google Scholar), it was possible to demonstrate that the catalytic activity of LHN/A was maintained in the context of the conjugate. The concentration of material to result in 50% cleavage of SNAP-25 (EC50) was estimated to be 8.3 ± 1.7 pm, 5.4 ± 1.6 pm, 12.8 ± 7.8 pm, and 7.5 ± 2.2 pm forrecLHN/A, nLHN/A,recLHN/A-ECL, and nLHN/A-ECL, respectively. It was not possible to estimate an EC50 forrecLHN/A(H227Y) andrecLHN/A(H227Y)-ECL due to insufficient cleavage of SNAP-25; however, data indicated that the endopeptidase activity of the recLHN/A(H227Y) species was reduced ∼300-fold compared with recLHN/A. This is in reasonable agreement with the data previously reported for this H227Y mutation in the light chain of BoNT/A (32Zhou L. de Paiva A. Liu D. Aoki R. Dolly J.O. Biochemistry. 1995; 34: 15175-15181Crossref PubMed Scopus (50) Google Scholar). The toxicity of the conjugate compared with BoNT/A was assessed in the standard measure of toxicity for botulinum toxins, the mouse lethality assay. The mouse lethality assay is highly sensitive for BoNT, with a detection limit of only 5 pg (33Notermans S. Nagel J. Simpson L.L. Botulinum Neurotoxin and Tetanus Toxin. Academic Press, New York1989: 319-331Crossref Google Scholar). Injection of 50 μg ofrecLHN/A-ECL or nLHN/A-ECL conjugate did not result in any mouse deaths. Therefore the conjugate material has an improved toxicity profile of the order of 1 × 107, even though full endopeptidase activity is retained. This presumably reflects the differing neuronal selectivity of the two agents. In vitro DRG cultures obtained from embryonic rat tissue include neuronal populations representative of primary nociceptive afferents, and by measuring the release of appropriate neurotransmitters effects of agents on this neuronal population can be assessed. The close proximity of SCN to the DRG in vivo and the fact that SCN are exquisitely sensitive to BoNT holotoxin make the SCN system an appropriate control for the effects of inappropriately targeted endopeptidase. In addition, the outcome of treating both these cell types with BoNT has been reported previously (18Welch M.J. Purkiss J.R. Foster K.A. Toxicon. 2000; 38: 245-258Crossref PubMed Scopus (424) Google Scholar, 34Neale E.A. Bowers L.M. Jia M. Bateman K.E. Williamson L.C. J. Cell Biol. 1999; 147: 1249-1260Crossref PubMed Scopus (78) Google Scholar). BoNT/A, nLHN/A-ECL, recLHN/A-ECL,recLHN/A(H227Y)-ECL, and unconjugated control materials were applied to eDRG and eSCN 3 days prior to assay of neurotransmitter release (substance P, and for some assays glutamate, from eDRG; glycine from eSCN). Fig. 2indicates the comparative effectiveness of nLHN/A-ECL,recLHN/A-ECL, and BoNT in their ability to inhibit release of substance P from eDRG (Fig. 2 A) and glycine from eSCN (Fig. 2 B). The IC50 values for inhibition of substance P were 17.5 ± 5.5 nm(n = 8), 17.5 ± 2.5 nm(n = 12), and 5.6 ± 0.93 pm(n = 4) for eDRG treated with nLHN/A-ECL,recLHN/A-ECL, and BoNT/A, respectively. These data, therefore, confirm the equivalence of the two conjugated ECL products. By comparison, it was not possible to calculate the IC50 for nLHN/A-,recLHN/A(H227Y)-, orrecLHN/A(H227Y)-ECL-treated cells due to the lack of effect even at high concentration. In all cases, the dose response observed for neurotransmitter release was in good agreement with the cleavage of SNAP-25. For example, cleavage of SNAP-25 (and inhibition of substance P release) from 30 μg/ml nLHN/A-ECL or recLHN/A-ECL-treated eDRG was determined to be 90.2 ± 6.0% (80.9 ± 4.3%) and 74.8 ± 6.5% (76.9 ± 2.2%), respectively. In addition to an assessment of the inhibition of release of substance P, the effect of ECL-targeted conjugates on the release of the fast neurotransmitter glutamate from eDRG was also determined. Following application of 10 μg/ml nLHN/A-ECL to eDRG for 3 days, 83.3 ± 9.1% (n = 3) inhibition of glutamate release was observed, compared with 11.4 ± 1.7% inhibition by LHN/A alone. In the eSCN model, the IC50 for inhibition of glycine by BoNT/A is 0.03 ± 0.01 pm (n = 3), whereas the IC50 for inhibition of glycine release by LHN/A-ECL conjugates could not be calculated due to the low effect (mean inhibition of release of 17.04 ± 2.1% (recLHN/A-ECL) and 40.94 ± 2.36% (nLHN/A-CL) at the maximum concentration used (30 μg/ml)). The ratio of IC50 data for inhibition of release for eSCN compared with eDRG neuron for BoNT/A-treated cells is 0.005:1. Due to the low effect of LHN/A-ECL conjugates in the eSCN model, it was not possible to accurately calculate such a ratio for LHN/A-ECL; however, it is estimated to be in the order of at least 6.9:1. Duration of action of ECL-targeted endopeptidase conjugates in vitro was assessed in the eDRG model. 40 μg/ml nLHN/A-ECL or 40 μg/mlrecLHN/A-ECL was applied to eDRG for 16 h prior to removal and assay of substance P release at specific intervals up to 24 days postapplication (Fig. 3). Maximal inhibition of substance P release was achieved after ∼10 days (71 and 68.2% for nLHN/A-ECL andrecLHN/A-ECL, respectively) with significant effects still observed to the end point of each assay. In a parallel series of experiments, effects of BoNT/A were also maintained to the end point of the assay (data not shown). The data therefore indicate that retargeted LHN/A does retain extended duration of effect in in vitro cell models akin to that of t" @default.
• W2167481964 created "2016-06-24" @default.
• W2167481964 creator A5002803024 @default.
• W2167481964 creator A5006413077 @default.
• W2167481964 creator A5026889440 @default.
• W2167481964 creator A5031280281 @default.
• W2167481964 creator A5034998037 @default.
• W2167481964 creator A5042560425 @default.
• W2167481964 creator A5052738369 @default.
• W2167481964 creator A5053620301 @default.
• W2167481964 creator A5058124328 @default.
• W2167481964 creator A5064121923 @default.
• W2167481964 creator A5066456444 @default.
• W2167481964 creator A5067566994 @default.
• W2167481964 creator A5070608708 @default.
• W2167481964 creator A5074355064 @default.
• W2167481964 creator A5075614659 @default.
• W2167481964 creator A5083801317 @default.
• W2167481964 creator A5088335157 @default.
• W2167481964 creator A5089514756 @default.
• W2167481964 date "2002-09-01" @default.
• W2167481964 modified "2023-10-10" @default.
• W2167481964 title "Inhibition of Release of Neurotransmitters from Rat Dorsal Root Ganglia by a Novel Conjugate of a Clostridium botulinumToxin A Endopeptidase Fragment and Erythrina cristagalliLectin" @default.
• W2167481964 cites W1602626976 @default.
• W2167481964 cites W1890478772 @default.
• W2167481964 cites W1965836027 @default.
• W2167481964 cites W1973061735 @default.
• W2167481964 cites W1982185698 @default.
• W2167481964 cites W1990482183 @default.
• W2167481964 cites W2000694607 @default.
• W2167481964 cites W2000968769 @default.
• W2167481964 cites W2007982098 @default.
• W2167481964 cites W2016996297 @default.
• W2167481964 cites W2017526097 @default.
• W2167481964 cites W2024179537 @default.
• W2167481964 cites W2045927533 @default.
• W2167481964 cites W2068379293 @default.
• W2167481964 cites W2075449190 @default.
• W2167481964 cites W2083375671 @default.
• W2167481964 cites W2085680244 @default.
• W2167481964 cites W2088213907 @default.
• W2167481964 cites W2089457319 @default.
• W2167481964 cites W2111734406 @default.
• W2167481964 cites W2120802222 @default.
• W2167481964 cites W2123166542 @default.
• W2167481964 cites W2132834341 @default.
• W2167481964 cites W2136885970 @default.
• W2167481964 cites W2137333901 @default.
• W2167481964 cites W2143978566 @default.
• W2167481964 cites W2168239813 @default.
• W2167481964 cites W2403846406 @default.
• W2167481964 cites W4299305718 @default.
• W2167481964 doi "https://doi.org/10.1074/jbc.m202902200" @default.
• W2167481964 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12105193" @default.
• W2167481964 hasPublicationYear "2002" @default.
• W2167481964 type Work @default.
• W2167481964 sameAs 2167481964 @default.
• W2167481964 citedByCount "112" @default.
• W2167481964 countsByYear W21674819642012 @default.
• W2167481964 countsByYear W21674819642013 @default.
• W2167481964 countsByYear W21674819642014 @default.
• W2167481964 countsByYear W21674819642015 @default.
• W2167481964 countsByYear W21674819642016 @default.
• W2167481964 countsByYear W21674819642017 @default.
• W2167481964 countsByYear W21674819642018 @default.
• W2167481964 countsByYear W21674819642019 @default.
• W2167481964 countsByYear W21674819642020 @default.
• W2167481964 countsByYear W21674819642022 @default.
• W2167481964 countsByYear W21674819642023 @default.
• W2167481964 crossrefType "journal-article" @default.
• W2167481964 hasAuthorship W2167481964A5002803024 @default.
• W2167481964 hasAuthorship W2167481964A5006413077 @default.
• W2167481964 hasAuthorship W2167481964A5026889440 @default.
• W2167481964 hasAuthorship W2167481964A5031280281 @default.
• W2167481964 hasAuthorship W2167481964A5034998037 @default.
• W2167481964 hasAuthorship W2167481964A5042560425 @default.
• W2167481964 hasAuthorship W2167481964A5052738369 @default.
• W2167481964 hasAuthorship W2167481964A5053620301 @default.
• W2167481964 hasAuthorship W2167481964A5058124328 @default.
• W2167481964 hasAuthorship W2167481964A5064121923 @default.
• W2167481964 hasAuthorship W2167481964A5066456444 @default.
• W2167481964 hasAuthorship W2167481964A5067566994 @default.
• W2167481964 hasAuthorship W2167481964A5070608708 @default.
• W2167481964 hasAuthorship W2167481964A5074355064 @default.
• W2167481964 hasAuthorship W2167481964A5075614659 @default.
• W2167481964 hasAuthorship W2167481964A5083801317 @default.
• W2167481964 hasAuthorship W2167481964A5088335157 @default.
• W2167481964 hasAuthorship W2167481964A5089514756 @default.
• W2167481964 hasBestOaLocation W21674819641 @default.
• W2167481964 hasConcept C105702510 @default.
• W2167481964 hasConcept C134306372 @default.
• W2167481964 hasConcept C140530291 @default.
• W2167481964 hasConcept C169760540 @default.
• W2167481964 hasConcept C181199279 @default.
• W2167481964 hasConcept C185592680 @default.
• W2167481964 hasConcept C197336794 @default.
• W2167481964 hasConcept C2777774944 @default.
• W2167481964 hasConcept C33923547 @default.

• next