FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2168277730> ?p ?o ?g. }

• W2168277730 endingPage "8969" @default.
• W2168277730 startingPage "8958" @default.
• W2168277730 abstract "CpNifS, a cysteine desulfurase required to supply sulfur for ironsulfur cluster biogenesis in Arabidopsis thaliana chloroplasts, belongs to a class of NifS-like enzymes with low endogenous cysteine desulfurase activity. Its bacterial homologue SufS is stimulated by SufE. Here we characterize the Arabidopsis chloroplast protein CpSufE, which has an N-terminal SufE-like domain and a C-terminal BolA-like domain unique to higher plants. CpSufE is targeted to the chloroplast stroma, indicated by green fluorescent protein localization and immunoblot experiments. Like CpNifS, CpSufE is expressed in all major tissues, with higher expression in green parts. Its expression is light-dependent and regulated at the mRNA level. The addition of purified recombinant CpSufE increased the Vmax for the cysteine desulfurase activity of CpNifS over 40-fold and decreased the KM toward cysteine from 0.1 to 0.043 mm. In contrast, CpSufE addition decreased the affinity of CpNifS for selenocysteine, as indicated by an increase in the KM from 2.9 to 4.17 mm, and decreased the Vmax for selenocysteine lyase activity by 30%. CpSufE forms dynamic complexes with CpNifS, indicated by gel filtration, native PAGE, and affinity chromatography experiments. A mutant of CpSufE in which the single cysteine was changed to serine was not active in stimulating CpNifS, although it did compete with WT CpSufE. The iron-sulfur cluster reconstitution activity of the CpNifS-CpSufE complex toward apoferredoxin was 20-fold higher than that of CpNifS alone. We conclude that CpNifS and CpSufE together form a cysteine desulfurase required for iron-sulfur cluster formation in chloroplasts. CpNifS, a cysteine desulfurase required to supply sulfur for ironsulfur cluster biogenesis in Arabidopsis thaliana chloroplasts, belongs to a class of NifS-like enzymes with low endogenous cysteine desulfurase activity. Its bacterial homologue SufS is stimulated by SufE. Here we characterize the Arabidopsis chloroplast protein CpSufE, which has an N-terminal SufE-like domain and a C-terminal BolA-like domain unique to higher plants. CpSufE is targeted to the chloroplast stroma, indicated by green fluorescent protein localization and immunoblot experiments. Like CpNifS, CpSufE is expressed in all major tissues, with higher expression in green parts. Its expression is light-dependent and regulated at the mRNA level. The addition of purified recombinant CpSufE increased the Vmax for the cysteine desulfurase activity of CpNifS over 40-fold and decreased the KM toward cysteine from 0.1 to 0.043 mm. In contrast, CpSufE addition decreased the affinity of CpNifS for selenocysteine, as indicated by an increase in the KM from 2.9 to 4.17 mm, and decreased the Vmax for selenocysteine lyase activity by 30%. CpSufE forms dynamic complexes with CpNifS, indicated by gel filtration, native PAGE, and affinity chromatography experiments. A mutant of CpSufE in which the single cysteine was changed to serine was not active in stimulating CpNifS, although it did compete with WT CpSufE. The iron-sulfur cluster reconstitution activity of the CpNifS-CpSufE complex toward apoferredoxin was 20-fold higher than that of CpNifS alone. We conclude that CpNifS and CpSufE together form a cysteine desulfurase required for iron-sulfur cluster formation in chloroplasts. Iron-sulfur (Fe-S) cluster proteins perform a variety of biological roles in electron transfer, catalysis, gene regulation, and sensing of iron and oxygen (1Beinert H. Holm R.H. Munck E. Science. 1997; 277: 653-659Crossref PubMed Scopus (1531) Google Scholar). Iron-sulfur cluster proteins are particularly important to photosynthesis. Measurements of metal ions in Arabidopsis thaliana have indicated that about 70% of the iron in green tissue is present in chloroplasts, and 40% is found in the thylakoids (2Shikanai T. Müller-Moulé P. Munekage Y. Niyogi K.K. Pilon M. Plant Cell. 2003; 15: 1333-1346Crossref PubMed Scopus (260) Google Scholar). Estimates in other plants indicate that up to 90% of the iron in leaves may be present in the chloroplasts (3Terry N. Abadia J. J. Plant Nutr. 1986; 9: 609-646Crossref Scopus (239) Google Scholar). Within the thylakoids, the majority of the iron is found in Fe-S cluster proteins that function in photosynthetic electron transport (4Raven J.A. Evans M.C. Korb R.E. Photosynthesis Res. 1999; 60: 111-149Crossref Google Scholar). Next to photosynthetic carbon fixation, other pivotal plastid functions that require Fe-S clusters include nitrogen assimilation, sulfur assimilation, and pigment synthesis (for a review, see Ref. 5Balk J. Lobreaux S. Trends Plant Sci. 2005; 10: 324-331Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholar). Whereas all plastid types contain a number of important Fe-S cluster proteins, especially the green chloroplasts need to synthesize and maintain a variety of Fe-S proteins with at least five different cluster types (5Balk J. Lobreaux S. Trends Plant Sci. 2005; 10: 324-331Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholar). In bacteria, three separate Fe-S formation machineries have been characterized (for a review, see Ref. 6Johnson D. Dean D.R. Smith A.D. Johnson M.K. Annu. Rev. Biochem. 2005; 74: 247-281Crossref PubMed Scopus (1110) Google Scholar). All systems include an NifS-like Cys desulfurase protein, which catalyzes the conversion of cysteine to alanine and elemental sulfur or the conversion of selenocysteine (SeCys) 2The abbreviations used are: SeCys, selenocysteine; WT, wild type; GFP, green fluorescent protein; IDA, iminodiacetic acid; HPLC, high pressure liquid chromatography; Tricine, N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine. to alanine and elemental selenium. Every Fe-S machinery also has scaffold proteins thought to function in the preassembly of clusters before transfer to target proteins. The first discovered Fe-S assembly machinery was the Nif system of Azotobacter vinelandii, which is responsible for the formation of Fe-S clusters for nitrogenase (7Zheng L. White R.H. Cash V.L. Jack R.F. Dean D.R. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 2754-2758Crossref PubMed Scopus (503) Google Scholar). The second machinery was the Isc system first discovered in A. vinelandii and later in Escherichia coli, which has a housekeeping function in the formation of other cellular Fe-S proteins (8Zheng L. Cash V.L. Flint D.H. Dean D.R. J. Biol. Chem. 1998; 273: 13264-13272Abstract Full Text Full Text PDF PubMed Scopus (576) Google Scholar). Mitochondrial Fe-S assembly systems in eukaryotes are remarkably similar to this Isc system (6Johnson D. Dean D.R. Smith A.D. Johnson M.K. Annu. Rev. Biochem. 2005; 74: 247-281Crossref PubMed Scopus (1110) Google Scholar, 9Lill R. Kispal G. Trends Biochem. Sci. 2000; 25: 352-356Abstract Full Text Full Text PDF PubMed Scopus (319) Google Scholar). The third machinery was the suf system of E. coli and Erwinia chrysanthemi, which appears to be responsible for the formation of Fe-S clusters under oxidative stress and iron limitation (10Takahashi Y. Tokumoto U. J. Biol. Chem. 2002; 277: 28380-28383Abstract Full Text Full Text PDF PubMed Scopus (354) Google Scholar, 11Nachin L. Loiseau L. Expert D. Barras F. EMBO J. 2003; 22: 427-437Crossref PubMed Scopus (223) Google Scholar, 12Outten F.W. Djaman O. Storz G. Mol. Microbiol. 2004; 52: 861-872Crossref PubMed Scopus (345) Google Scholar). Based on sequence similarities, several of the plastid Fe-S biosynthesis components tentatively identified to date are most related to the bacterial suf cluster genes; other components are unique, however (5Balk J. Lobreaux S. Trends Plant Sci. 2005; 10: 324-331Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholar). Chloroplasts have their own Fe-S assembly systems (13Takahashi Y. Mitsui A. Hase T. Matsubara H. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 2434-2437Crossref PubMed Google Scholar, 14Takahashi Y. Mitsui A. Matsubara H. Plant Physiol. 1990; 95: 97-103Crossref Scopus (26) Google Scholar). Fe-S cluster assembly into radiolabeled freshly imported ferredoxin precursor was demonstrated using isolated intact chloroplasts (15Li H.-M. Theg S.M. Bauerle C.M. Keegstra K. Proc. Natl. Acad. Sci. U. S. A. 1990; 8: 6748-6752Crossref Scopus (48) Google Scholar). The reaction proceeds in the absence of cytosol (16Pilon M. America T. van't Hof R. de Kruijff B. Weisbeek P. Rothman S.S. Advances in Molecular and Cell Biology. 1. JAI Press, Greenwich, CT1995: 229-255Google Scholar). The presence of supersaturated amounts of oxygen in green tissues provides a challenge for the synthesis and maintenance of plastid Fe-S cluster proteins because of the sensitivity of these clusters to oxygen (1Beinert H. Holm R.H. Munck E. Science. 1997; 277: 653-659Crossref PubMed Scopus (1531) Google Scholar). Therefore, it can be anticipated that next to the synthesis of new clusters, chloroplasts must have unique mechanisms to replace or repair oxidatively damaged clusters. Characterization of the chloroplastic Fe-S formation machinery started with the identification of a Cys desulfurase CpNifS (17Leon S. Touraine B. Briat J.F. Lobreaux S. Biochem. J. 2002; 366: 557-564Crossref PubMed Scopus (99) Google Scholar, 18Pilon-Smits E.A.H. Garifullina G.F. Abdel-Ghany S. Kato S. Mihara H. Hale K.L. Burkhead J.L. Esaki N. Kurihara T. Pilon M. Plant Physiol. 2002; 130: 1309-1318Crossref PubMed Scopus (112) Google Scholar) and of scaffold proteins CpNfu2 (19Leon S. Touraine B. Ribot C. Briat J.F. Lobreaux S. Biochem. J. 2003; 371: 823-830Crossref PubMed Scopus (93) Google Scholar, 20Touraine B. Boutin J.P. Marion-Poll A. Briat J.F. Peltier G. Lobreaux S. Plant J. 2004; 40: 101-111Crossref PubMed Scopus (81) Google Scholar, 21Yabe T. Morimoto K. Kikuchi S. Nishio K. Terashima I. Nakai M. Plant Cell. 2004; 16: 993-1007Crossref PubMed Scopus (123) Google Scholar) and CpIscA (22Abdel-Ghany S.E. Ye H. Garifullina G.F. Zhang L. Pilon-Smits E.A.H. Pilon M. Plant Physiol. 2005; 138: 161-172Crossref PubMed Scopus (77) Google Scholar). CpNifS is the Cys desulfurase that converts cysteine into alanine and elemental sulfur for Fe-S formation. CpNfu2 can hold a transient Fe-S cluster. Insertion mutants in the CpNfu2 gene have a dwarf phenotype and are deficient in 2Fe-2S and 4Fe-4S proteins (20Touraine B. Boutin J.P. Marion-Poll A. Briat J.F. Peltier G. Lobreaux S. Plant J. 2004; 40: 101-111Crossref PubMed Scopus (81) Google Scholar, 21Yabe T. Morimoto K. Kikuchi S. Nishio K. Terashima I. Nakai M. Plant Cell. 2004; 16: 993-1007Crossref PubMed Scopus (123) Google Scholar). CpIscA is a putative alternative scaffold that can accept a 2Fe-2S cluster from CpNifS, which can be transferred to apoferredoxin in vitro (22Abdel-Ghany S.E. Ye H. Garifullina G.F. Zhang L. Pilon-Smits E.A.H. Pilon M. Plant Physiol. 2005; 138: 161-172Crossref PubMed Scopus (77) Google Scholar). In addition, other Suf-type system components (23Moller G.M. Kunkel T. Chua N.-H. Genes Dev. 2001; 15: 90-103Crossref PubMed Scopus (176) Google Scholar, 24Xu X.M. Moller S.G. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 9143-9148Crossref PubMed Scopus (105) Google Scholar, 25Xu X.M. Adams S. Chua N-H. Moller S.G. J. Biol. Chem. 2005; 280: 6648-6654Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar) and HCF101 (26Lezhneva L. Amann K. Meurer J. Plant J. 2004; 37: 174-185Crossref PubMed Scopus (110) Google Scholar) may assist the Fe-S formation in plastids. The CpSufBCD complex is an ATPase and may be involved in providing ferrous iron or in transferring the Fe-S cluster from the scaffold protein to the target protein (23Moller G.M. Kunkel T. Chua N.-H. Genes Dev. 2001; 15: 90-103Crossref PubMed Scopus (176) Google Scholar, 24Xu X.M. Moller S.G. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 9143-9148Crossref PubMed Scopus (105) Google Scholar, 25Xu X.M. Adams S. Chua N-H. Moller S.G. J. Biol. Chem. 2005; 280: 6648-6654Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar). HCF101 (high chlorophyll fluorescence 101) encodes a NifH-related P-loop ATPase that seems to be required for 4Fe-4S but not 2Fe-2S assembly in chloroplasts (26Lezhneva L. Amann K. Meurer J. Plant J. 2004; 37: 174-185Crossref PubMed Scopus (110) Google Scholar). Since cysteine was identified as the sulfur source for Fe-S formation in chloroplasts (13Takahashi Y. Mitsui A. Hase T. Matsubara H. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 2434-2437Crossref PubMed Google Scholar, 14Takahashi Y. Mitsui A. Matsubara H. Plant Physiol. 1990; 95: 97-103Crossref Scopus (26) Google Scholar), the Cys desulfurase activity of CpNifS is probably essential for Fe-S formation in chloroplasts. Indeed, the depletion of CpNifS led to the loss of Fe-S reconstitution activity of chloroplast stroma (27Ye H. Garifullina G.F. Abdel-Ghany S.E. Zhang L. Pilon-Smits E.A.H. Pilon M. Planta. 2005; 220: 602-608Crossref PubMed Scopus (34) Google Scholar). This Cys desulfurase of chloroplasts is distinct from the Cys desulfurases NifS and IscS of the Nif and Isc type assembly systems and is more similar in sequence to SufS (18Pilon-Smits E.A.H. Garifullina G.F. Abdel-Ghany S. Kato S. Mihara H. Hale K.L. Burkhead J.L. Esaki N. Kurihara T. Pilon M. Plant Physiol. 2002; 130: 1309-1318Crossref PubMed Scopus (112) Google Scholar). In vitro, the purified CpNifS has a much lower Cys desulfurase activity than SeCys lyase activity (18Pilon-Smits E.A.H. Garifullina G.F. Abdel-Ghany S. Kato S. Mihara H. Hale K.L. Burkhead J.L. Esaki N. Kurihara T. Pilon M. Plant Physiol. 2002; 130: 1309-1318Crossref PubMed Scopus (112) Google Scholar). However, the Fe-S cluster reconstitution activity of CpNifS in stroma is 50-80-fold higher than that of CpNifS alone, suggesting that some factors, most likely proteins, are activating the Cys desulfurase activity of CpNifS (27Ye H. Garifullina G.F. Abdel-Ghany S.E. Zhang L. Pilon-Smits E.A.H. Pilon M. Planta. 2005; 220: 602-608Crossref PubMed Scopus (34) Google Scholar). The activation mechanism has been unclear until the characterization of CpSufE in this study. CpSufE is the latest component of the Suf-type Fe-S formation system identified in Arabidopsis chloroplasts. We show here that CpSufE forms a complex with CpNifS, thus stimulating Cys desulfurase activity over 40-fold and enhancing CpNifS-dependent Fe-S reconstitution in vitro. Cloning and Plasmid Construction—The A. thaliana CpSufE coding sequence was amplified by PCR using cDNA as a template. cDNA was prepared from DNase-treated total RNA prepared from 2-week old seedlings as described (18Pilon-Smits E.A.H. Garifullina G.F. Abdel-Ghany S. Kato S. Mihara H. Hale K.L. Burkhead J.L. Esaki N. Kurihara T. Pilon M. Plant Physiol. 2002; 130: 1309-1318Crossref PubMed Scopus (112) Google Scholar). Primers used for CpSufE amplification were SufE-precursor and SufE-Bam (Table 1). The PCR product was digested with NcoI and BamHI and then ligated into vector pET11d (Novagen, Madison, WI), digested with the same restriction enzymes to produce plasmid pPrSufE. To subclone the mature sequence of CpSufE in pET28a (Novagen, Madison, WI) for expression as a His6-tagged protein, PCR was performed with a set of nested primers, SufE-mature and SufE-Bam (Table 1). Plasmid pPrSufE was used as a template. The PCR product was digested with NdeI and BamHI and subcloned in vector pET28a, which was digested with the same enzymes to produce plasmid pMSufE.TABLE 1Sequence of oligonucleotides used for cloning and plasmid constructionsOligonucleotide5′-3′ sequencesRestriction site underlinedSufE-precursorCATGCCATGGCAGCAGCGATGTCTTCTTCNcoISufE-matureGGAATTCCATATGGCTTCATCATCTCCGTCGAGNdeISufE-BamCGGGATCCTCAAACCTCAGCAGGAGTCTBamHISufEC65S-FAATAAAGTAGAAGGATCTGTTTCTCAGGTTTGGSufEC65S-RCCAAACCTGAGAAACAGATCCTTCTACTTTATTT7CGAAATTAATACGACTCACTATAGT7 terminatorTGCTAGTTATTGCTCAGCGGTSufE-GFP-FGAATGGTCGACATGGCAGCAGCGATGTCTTSallSufE-GFP-RCATGCCATGGCCTCAGCAGGAGTCTTTGCNcoISufE-GFP-RTCATGCCATGGGTAGCTTCGGTGGAAGCTCTNcoINifSC388S-FAAGGTCAGGACACCACTCCGCACAGCCACTCCANifSC388S-RTGGAGTGGCTGTGCGGAGTGGTGTCCTGACCTTNFS-matSee Ref. 18Pilon-Smits E.A.H. Garifullina G.F. Abdel-Ghany S. Kato S. Mihara H. Hale K.L. Burkhead J.L. Esaki N. Kurihara T. Pilon M. Plant Physiol. 2002; 130: 1309-1318Crossref PubMed Scopus (112) Google ScholarNFS-B2See Ref. 18Pilon-Smits E.A.H. Garifullina G.F. Abdel-Ghany S. Kato S. Mihara H. Hale K.L. Burkhead J.L. Esaki N. Kurihara T. Pilon M. Plant Physiol. 2002; 130: 1309-1318Crossref PubMed Scopus (112) Google Scholar Open table in a new tab To change the single cysteine in the mature sequence of CpSufE to serine, recombinant PCR was performed. In the first round, two fragments were amplified with primer set T7 and SufEC65S-R and primer set T7 terminator and SufEC65S-F, respectively (Table 1). pMSufE was used as a template. The two products from the first round of PCR were together used as a template for the second round of PCR, with primers SufE-mature and SufE-Bam (Table 1). The resulting PCR product was digested with NdeI and BamHI and subcloned in vector pET28a to produce plasmid pMSufEC65S. For green fluorescent protein (GFP) localization, the transit peptide coding sequence of CpSufE was amplified with flanking primers SufE-GFP-F and SufE-GFP-RT (Table 1), whereas the full-length protein sequence was amplified with flanking primers SufE-GFP-F and SufE-GFP-R (Table 1). The pPrSufE plasmid was used as a template. PCR products were digested with SalI and NcoI and inserted into the SalI/NcoI-digested GFP reporter plasmid 35Ω-SGFP(S65T) (28Miras S. Salvi D. Ferro M. Grunwald D. Garin J. Joyard J. Rolland N. J. Biol. Chem. 2002; 277: 47770-47778Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar) to create the plasmids TP/SufE-GFP and full-length/SufE-GFP, respectively. For site-directed mutagenesis of cysteine 388 in mature CpNifS to serine, a strategy was used similar to the one described above for the CpSufE mutant. In the first round of PCR, two fragments were amplified with primers T7 and NifSC388S-R and primers T7 terminator and NifSC388S-F, respectively (Table 1), using pMNFS-8 (18Pilon-Smits E.A.H. Garifullina G.F. Abdel-Ghany S. Kato S. Mihara H. Hale K.L. Burkhead J.L. Esaki N. Kurihara T. Pilon M. Plant Physiol. 2002; 130: 1309-1318Crossref PubMed Scopus (112) Google Scholar) as a template. In the second round of PCR, the two fragments were fused together and amplified with primers NFS-mat and NFS-B2 (Table 1). The final PCR product was digested with NcoI and BamHI and ligated into vector pET11d, resulting in pMNFSC388S. All constructs were verified by DNA sequencing. The plasmids used for protoplast transformation were prepared using the Plasmid Midi Kit (Qiagen, Valencia, CA). Sequence Analysis and Alignments—Sequence analysis was performed using the Mac Vector sequence analysis software (International Biotechnologies, New Haven, CT). Searches for sequence similarity were performed using the BLAST network service provided by the National Center for Biotechnology Information (available on the World Wide Web at www.ncbi.nlm.nih.gov). Sequence alignment was performed using ClustalW at European Bioinformatics Institute, ExPASY Proteomics tools (available on the World Wide Web at www.ebi.ac.uk/clustalw). Preparation of Proteins—For overexpression of CpSufE, E. coli BL21 (DE3) codon+ (Stratagene, La Jolla, CA) was transformed with plasmid pMSufE or with pMSufEC65S for the mutant protein. Two liters of LB medium containing 50 μg ml-1 kanamycin was inoculated with one-one hundredth volume of overnight culture. Cells were grown at 37 °C to an A600 of 0.5, and expression was induced by the addition of 0.4 mm isopropyl-β-d-thiogalactopyranoside followed by incubation for 3 h at 37 °C. The culture was chilled on ice, and the cells were collected by centrifugation for 5 min at 5,000 × g at 4 °C. From here on, all procedures were performed at 4 °C except where mentioned. The bacterial pellet was washed with 150 mm NaCl and resuspended in 50 mm Tris-HCl, pH 7.5, and then passed twice through a French press (8,000 p.s.i.) to disrupt the cells. The lysate was centrifuged for 20 min at 12,500 × g, and the cleared supernatant was loaded at a flow rate of 3 ml min-1 onto His-Bind iminodiacetic acid (IDA)-agarose (Novagen, Madison, WI) in a 1.6 × 20-cm column, which was saturated with NiSO4, washed, and equilibrated in 50 mm Tris-HCl, pH 7.5. The column was washed with 4 volumes of 50 mm Tris-HCl, pH 7.5, followed by 4 volumes of 1 m NaCl, 50 mm Tris-HCl, pH 7.5, 6 volumes of 50 mm Tris-HCl, pH 7.5, again, and 2 volumes of 0.1 m imidazole in 50 mm Tris-HCl, pH 7.5, respectively. His6-tagged CpSufE was eluted with 4 volumes of 1 m imidazole in 50 mm Tris-HCl, pH 7.5. Fractions of 6 ml were collected. Peak fractions were pooled and dialyzed overnight against 25 mm Tris-HCl, pH 7.5. Pure His-tagged CpSufE ran as a single band on SDS-PAGE after staining with Coomassie Brilliant Blue. To produce cleaved CpSufE, the pooled peak fractions were dialyzed overnight against 20 mm Tris-HCl, pH 8.4, followed by incubation with thrombin in a 1:1,000 (w/w) ratio (thrombin/target protein) at 4 °C for 8 h in 20 mm Tris-HCl, pH 8.4, 150 mm NaCl, 2.5 mm CaCl2, as suggested by the manufacturer (Novagen, Madison, WI). The cleavage mixture was subsequently applied to a 10 × 1-cm Resource-Q column (Amersham Biosciences), equilibrated in 25 mm Tris-HCl, pH 8.0, at room temperature and connected to a Summit HPLC system (Dionex, Sunnyvale, CA). The column was eluted with a linear gradient from 0 to 1 m NaCl in 25 mm Tris-HCl, pH 8.0, and fractions of 2 ml were collected. Elution was monitored by detection of the OD at 280 and 220 nm. The purified cleaved CpSufE was dialyzed overnight against 25 mm Tris-HCl, pH 7.5, and stored frozen at -80 °C before use in activity assays. Typical yields were 5-10 mg/liter of culture. The purified protein migrated as a single band on SDS-PAGE (12.5% gel) and ran as a single peak in analytical HPLC runs on a 1-ml Resource Q column (Amersham Biosciences). The His6-tagged and cleaved CpSufEC65S were purified essentially as the WT CpSufE protein. WT CpNifS protein was prepared as described before (18Pilon-Smits E.A.H. Garifullina G.F. Abdel-Ghany S. Kato S. Mihara H. Hale K.L. Burkhead J.L. Esaki N. Kurihara T. Pilon M. Plant Physiol. 2002; 130: 1309-1318Crossref PubMed Scopus (112) Google Scholar). For overexpression of CpNifSC388S, E. coli BL21 (DE3) codon+ (Stratagene, La Jolla, CA) was transformed with plasmid pMNFSC388S. The recombinant CpNifSC388S was prepared essentially as WT CpNifS (18Pilon-Smits E.A.H. Garifullina G.F. Abdel-Ghany S. Kato S. Mihara H. Hale K.L. Burkhead J.L. Esaki N. Kurihara T. Pilon M. Plant Physiol. 2002; 130: 1309-1318Crossref PubMed Scopus (112) Google Scholar). Purified CpNifSC388S was eluted from a calibrated 1 × 30-cm Superdex-S200 gel filtration column (Amersham Biosciences) at the same retention time as the WT protein, and a native molecular mass of 83 kDa was calculated, suggesting that CpNifSC388S is a dimer like the wild type protein. Holo- and apoferredoxin were prepared as described (27Ye H. Garifullina G.F. Abdel-Ghany S.E. Zhang L. Pilon-Smits E.A.H. Pilon M. Planta. 2005; 220: 602-608Crossref PubMed Scopus (34) Google Scholar). Enzyme Assays—Cys desulfurase activity was assayed at 25 °C essentially as described (29Outten F.W. Wood M.J. Munoz F.M. Storz G. J. Biol. Chem. 2003; 278: 45713-45719Abstract Full Text Full Text PDF PubMed Scopus (231) Google Scholar). Briefly, 160 μl of reaction mixture contained 25 mm Tris-HCl, pH 7.4, 100 mm NaCl, 2.5 μm enzyme (0.11 mg/ml CpNifS, 0.09 mg/ml CpSufE), 10 μm pyridoxal 5′-phosphate (Acros Organics, Morris Plains, NJ), 1 mm dithiothreitol (Roche Applied Science), and 500 μm cysteine (Sigma). The reaction was stopped by the addition of 20 μl of 20 mm N,N-dimethyl-p-phenylenediamine in 7.2 m HCl. Methylene blue was formed by the addition of 20 μl of 30 mm FeCl3 in 1.2 m HCl and was assayed by measuring the absorbance at 670 nm. The SeCys lyase activity was measured as described (18Pilon-Smits E.A.H. Garifullina G.F. Abdel-Ghany S. Kato S. Mihara H. Hale K.L. Burkhead J.L. Esaki N. Kurihara T. Pilon M. Plant Physiol. 2002; 130: 1309-1318Crossref PubMed Scopus (112) Google Scholar). One unit of enzyme activity corresponds to 1 μmol of substrate converted/min. To estimate kinetic constants for both the Cys desulfurase and SeCys lyase activities of CpNifS, the reaction velocities were measured over a wide range of substrate concentrations (0.01-20 mm). The data in Michaelis-Menten plots were fitted by an iterative method to estimate Km and Vmax values, using the software program Enzfitter (Biosoft, Cambridge, UK). The Fe-S reconstitution assay was performed as described before (27Ye H. Garifullina G.F. Abdel-Ghany S.E. Zhang L. Pilon-Smits E.A.H. Pilon M. Planta. 2005; 220: 602-608Crossref PubMed Scopus (34) Google Scholar). For all statistical analyses, the JMP-IN software (SAS institute, Cary, NC) was used. Gel Filtration—Sizes of protein complexes were estimated by gel filtration experiments, as described before (27Ye H. Garifullina G.F. Abdel-Ghany S.E. Zhang L. Pilon-Smits E.A.H. Pilon M. Planta. 2005; 220: 602-608Crossref PubMed Scopus (34) Google Scholar). The column used was a 1 × 30-cm Superdex-200 column (Amersham Biosciences), which was connected to a summit HPLC system with a UVD170 detector and controlled by Chromeleon software (Dionex, Sunnyvale, CA). The loop size was 0.2 ml. The column was equilibrated in 25 mm Tricine/KOH, pH 7.9, 50 mm KCl. The flow rate was 0.75 ml/min, and fractions were collected every 0.5 min. Elution was monitored by absorbance at both 280 and 220 nm and by immunoblotting of collected fractions. The void volume was determined with blue dextran. Standards used for calibration were IgY, bovine serum albumin, ovalbumin, chymotrypsinogen, and RNase. Protein Coelution Experiment—100 μg of His-tagged CpSufE (WT or mutant) and possible partner proteins were mixed at room temperature in 500 μl of buffer (50 mm Tris-HCl, pH 7.5) and loaded on a 0.5-ml His-Bind IDA-agarose column (Novagen, Madison, WI). The column was washed with 2 ml of buffer and subsequently with 2 ml of 1 m NaCl, 50 mm Tris-HCl, pH 7.5, followed by 2 ml of 50 mm Tris-HCl, pH 7.5, again, and 1 ml of 50 mm Tris-HCl, pH 7.5, 0.1 m imidazole. Finally, the column was eluted with 2 ml of 1 m imidazole, 50 mm Tris-HCl, pH 7.5, and 1-ml fractions were collected. Samples incubated with cysteine were eluted with all solutions containing 1 mm cysteine, whereas samples incubated without cysteine were eluted with solutions free of cysteine. Proteins eluted with 1 m imidazole were analyzed by SDS-PAGE and staining with Coomassie Brilliant Blue. Separation of CpNifS-CpSufE Complexes on Native Gel—5 μg of CpSufE (WT or mutant) was mixed with 5 μg of CpNifS (WT or mutant) in a final volume of 15 μl, with or without 1 mm cysteine. After incubation at room temperature for 10 min, proteins were mixed with an equal volume of 20% (w/v) glycerol, 250 mm Tris-HCl, pH 6.8, and separated by native PAGE, using a 4% stacking gel, a 10% separating gel, and the Laemmli buffer system with the omission of SDS. 5 μg of each single protein was loaded as control. The gel was stained with Coomassie Brilliant Blue. Plant Sampling—A. thaliana (Ecotype Columbia-0) plants were grown on soil with supplementary light on a 15-h light/9-h dark cycle for 4 weeks. Total leaf homogenate, chloroplast stroma, and RNA from different tissues were prepared as described (18Pilon-Smits E.A.H. Garifullina G.F. Abdel-Ghany S. Kato S. Mihara H. Hale K.L. Burkhead J.L. Esaki N. Kurihara T. Pilon M. Plant Physiol. 2002; 130: 1309-1318Crossref PubMed Scopus (112) Google Scholar). For light regulation analysis of CpSufE, Arabidopsis plants were grown on half-strength Murashige and Skoog agar medium (30Murashige T. Skoog F. Physiol. Plant. 1962; 15: 437-497Crossref Scopus (54339) Google Scholar) for 2 weeks, either on a 15-h light/9-h dark cycle or in complete darkness. Protein and RNA preparations from total leaf homogenate were described before (18Pilon-Smits E.A.H. Garifullina G.F. Abdel-Ghany S. Kato S. Mihara H. Hale K.L. Burkhead J.L. Esaki N. Kurihara T. Pilon M. Plant Physiol. 2002; 130: 1309-1318Crossref PubMed Scopus (112) Google Scholar). Subcellular Localization of GFP Fusion Proteins—The plasmids TP/SufE-GFP or full-length/SufE-GFP were transformed into Arabidopsis protoplasts, and expressed proteins were observed under a confocal microscope, as described (22Abdel-Ghany S.E. Ye H. Garifullina G.F. Zhang L. Pilon-Smits E.A.H. Pilon M. Plant Physiol. 2005; 138: 161-172Crossref PubMed Scopus (77) Google Scholar). Antibodies and Immunoblotting—Cleaved CpSufE in 100 mm NaCl, 25 mm sodium phosphate, pH 7.5, was used to raise polyclonal antibody in rabbits at a commercial facility (PRF&L, Canadensis, PA). The CpNifS antibodies have been described (18Pilon-Smits E.A.H. Garifullina G.F. Abdel-Ghany S. Kato S. Mihara H. Hale K.L. Burkhead J.L. Esaki N. Kurihara T. Pilon M. Plant Physiol. 2002; 130: 1309-1318Crossref PubMed Scopus (112) Google Scholar). The Hsp70 antibody was purchased from Sigma. RuBisCo antibody was purchased from AgriSera (Vannas, Sweden). Immunoblotting was performed as described (18Pilon-Smits E.A.H. Garifullina G.F. Abdel-Ghany S. Kato S. Mihara H. Hale K.L. Burkhead J.L. Esaki N. Kurihara T. Pilon M. Plant Physiol. 2002; 130: 1309-1318Crossref PubMed Scopus (112) Google Scholar). Band intensities were quantified with ImageJ software (National Institutes of Health, Bethesda, MD). RNA Blot Analysis—Total RNA from different Arabidopsis tissues was prepared, electrophoresed, and probed with a 32P-labeled 900-bp CpSufE cDNA, essentially as described before (18Pilon-Smits E.A.H. Garifullina G.F. Abdel-Ghany" @default.
• W2168277730 created "2016-06-24" @default.
• W2168277730 creator A5014111742 @default.
• W2168277730 creator A5019511416 @default.
• W2168277730 creator A5041977173 @default.
• W2168277730 creator A5045687931 @default.
• W2168277730 creator A5048419920 @default.
• W2168277730 date "2006-03-01" @default.
• W2168277730 modified "2023-10-16" @default.
• W2168277730 title "CpSufE Activates the Cysteine Desulfurase CpNifS for Chloroplastic Fe-S Cluster Formation" @default.
• W2168277730 cites W1620865342 @default.
• W2168277730 cites W1881646695 @default.
• W2168277730 cites W1948400542 @default.
• W2168277730 cites W1967826096 @default.
• W2168277730 cites W1968531578 @default.
• W2168277730 cites W1974368693 @default.
• W2168277730 cites W1974747745 @default.
• W2168277730 cites W1986416350 @default.
• W2168277730 cites W1992193197 @default.
• W2168277730 cites W1998142761 @default.
• W2168277730 cites W1998551227 @default.
• W2168277730 cites W2005305016 @default.
• W2168277730 cites W2007826649 @default.
• W2168277730 cites W2022491296 @default.
• W2168277730 cites W2022668082 @default.
• W2168277730 cites W2024556021 @default.
• W2168277730 cites W2030671072 @default.
• W2168277730 cites W2036697811 @default.
• W2168277730 cites W2039943732 @default.
• W2168277730 cites W2051317564 @default.
• W2168277730 cites W2052823571 @default.
• W2168277730 cites W2059831206 @default.
• W2168277730 cites W2075008260 @default.
• W2168277730 cites W2086737896 @default.
• W2168277730 cites W2087921651 @default.
• W2168277730 cites W2090079874 @default.
• W2168277730 cites W2090154662 @default.
• W2168277730 cites W2106077509 @default.
• W2168277730 cites W2108992291 @default.
• W2168277730 cites W2113990355 @default.
• W2168277730 cites W2115498985 @default.
• W2168277730 cites W2116472408 @default.
• W2168277730 cites W2122257408 @default.
• W2168277730 cites W2123226016 @default.
• W2168277730 cites W2138881604 @default.
• W2168277730 cites W2148588871 @default.
• W2168277730 cites W2151357324 @default.
• W2168277730 cites W2152458080 @default.
• W2168277730 cites W2157433322 @default.
• W2168277730 cites W2160598359 @default.
• W2168277730 cites W2168492610 @default.
• W2168277730 cites W2575789697 @default.
• W2168277730 doi "https://doi.org/10.1074/jbc.m512737200" @default.
• W2168277730 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/16455656" @default.
• W2168277730 hasPublicationYear "2006" @default.
• W2168277730 type Work @default.
• W2168277730 sameAs 2168277730 @default.
• W2168277730 citedByCount "78" @default.
• W2168277730 countsByYear W21682777302012 @default.
• W2168277730 countsByYear W21682777302013 @default.
• W2168277730 countsByYear W21682777302014 @default.
• W2168277730 countsByYear W21682777302015 @default.
• W2168277730 countsByYear W21682777302016 @default.
• W2168277730 countsByYear W21682777302017 @default.
• W2168277730 countsByYear W21682777302018 @default.
• W2168277730 countsByYear W21682777302020 @default.
• W2168277730 countsByYear W21682777302021 @default.
• W2168277730 countsByYear W21682777302022 @default.
• W2168277730 countsByYear W21682777302023 @default.
• W2168277730 crossrefType "journal-article" @default.
• W2168277730 hasAuthorship W2168277730A5014111742 @default.
• W2168277730 hasAuthorship W2168277730A5019511416 @default.
• W2168277730 hasAuthorship W2168277730A5041977173 @default.
• W2168277730 hasAuthorship W2168277730A5045687931 @default.
• W2168277730 hasAuthorship W2168277730A5048419920 @default.
• W2168277730 hasBestOaLocation W21682777301 @default.
• W2168277730 hasConcept C181199279 @default.
• W2168277730 hasConcept C185592680 @default.
• W2168277730 hasConcept C2779201268 @default.
• W2168277730 hasConcept C55493867 @default.
• W2168277730 hasConcept C86803240 @default.
• W2168277730 hasConcept C95444343 @default.
• W2168277730 hasConceptScore W2168277730C181199279 @default.
• W2168277730 hasConceptScore W2168277730C185592680 @default.
• W2168277730 hasConceptScore W2168277730C2779201268 @default.
• W2168277730 hasConceptScore W2168277730C55493867 @default.
• W2168277730 hasConceptScore W2168277730C86803240 @default.
• W2168277730 hasConceptScore W2168277730C95444343 @default.
• W2168277730 hasIssue "13" @default.
• W2168277730 hasLocation W21682777301 @default.
• W2168277730 hasOpenAccess W2168277730 @default.
• W2168277730 hasPrimaryLocation W21682777301 @default.
• W2168277730 hasRelatedWork W1563841371 @default.
• W2168277730 hasRelatedWork W1581167643 @default.
• W2168277730 hasRelatedWork W1983972257 @default.
• W2168277730 hasRelatedWork W2028357718 @default.
• W2168277730 hasRelatedWork W2030757483 @default.
• W2168277730 hasRelatedWork W2044612312 @default.

• next