FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2169356768> ?p ?o ?g. }

• W2169356768 endingPage "2286" @default.
• W2169356768 startingPage "2279" @default.
• W2169356768 abstract "The Δ6 desaturase, encoded by FADS2, plays a crucial role in omega-3 and omega-6 fatty acid synthesis. These fatty acids are essential components of the central nervous system, and they act as precursors for eicosanoid signaling molecules and as direct modulators of gene expression. The polypyrimidine tract binding protein (PTB or hnRNP I) is a splicing factor that regulates alternative pre-mRNA splicing. Here, PTB is shown to bind an exonic splicing silencer element and repress alternative splicing of FADS2 into FADS2 AT1. PTB and FADS2AT1 were inversely correlated in neonatal baboon tissues, implicating PTB as a major regulator of tissue-specific FADS2 splicing. In HepG2 cells, PTB knockdown modulated alternative splicing of FADS2, as well as FADS3, a putative desaturase of unknown function. Omega-3 fatty acids decreased by nearly one half relative to omega-6 fatty acids in PTB knockdown cells compared with controls, with a particularly strong decrease in eicosapentaenoic acid (EPA) concentration and its ratio to arachidonic acid (ARA). This is a rare demonstration of a mechanism specifically altering the cellular omega-3 to omega-6 fatty acid ratio without any change in diet/media. These findings reveal a novel role for PTB, regulating availability of membrane components and eicosanoid precursors for cell signaling. The Δ6 desaturase, encoded by FADS2, plays a crucial role in omega-3 and omega-6 fatty acid synthesis. These fatty acids are essential components of the central nervous system, and they act as precursors for eicosanoid signaling molecules and as direct modulators of gene expression. The polypyrimidine tract binding protein (PTB or hnRNP I) is a splicing factor that regulates alternative pre-mRNA splicing. Here, PTB is shown to bind an exonic splicing silencer element and repress alternative splicing of FADS2 into FADS2 AT1. PTB and FADS2AT1 were inversely correlated in neonatal baboon tissues, implicating PTB as a major regulator of tissue-specific FADS2 splicing. In HepG2 cells, PTB knockdown modulated alternative splicing of FADS2, as well as FADS3, a putative desaturase of unknown function. Omega-3 fatty acids decreased by nearly one half relative to omega-6 fatty acids in PTB knockdown cells compared with controls, with a particularly strong decrease in eicosapentaenoic acid (EPA) concentration and its ratio to arachidonic acid (ARA). This is a rare demonstration of a mechanism specifically altering the cellular omega-3 to omega-6 fatty acid ratio without any change in diet/media. These findings reveal a novel role for PTB, regulating availability of membrane components and eicosanoid precursors for cell signaling. The Δ6-/Δ8-desaturase, encoded by FADS2, is the rate-limiting enzyme in synthesis of long-chain (20-carbon and above) omega-3 and omega-6 polyunsaturated fatty acids (PUFA) (Fig. 1). These fatty acids constitute about 25% of the structural lipid of central nervous system gray matter (1.Brenna J.T. Diau G.Y. The influence of dietary docosahexaenoic acid and arachidonic acid on central nervous system polyunsaturated fatty acid composition.Prostaglandins Leukot. Essent. Fatty Acids. 2007; 77: 247-250Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar), and they must be supplied in especially large quantities for the brain growth spurt during perinatal development (2.Dobbing J. Sands J. Comparative aspects of the brain growth spurt.Early Hum. Dev. 1979; 3: 79-83Crossref PubMed Scopus (2158) Google Scholar, 3.Martinez M. Tissue levels of polyunsaturated fatty acids during early human development.J. Pediatr. 1992; 120: S129-S138Abstract Full Text PDF PubMed Scopus (678) Google Scholar). Long-chain omega-3 and omega-6 fatty acids are also precursors for lipid mediators known as eicosanoids and docosanoids, which convey signals controlling inflammation and blood clotting, among many other physiological conditions (4.Calder P.C. Polyunsaturated fatty acids and inflammatory processes: new twists in an old tale.Biochimie. 2009; 91: 791-795Crossref PubMed Scopus (563) Google Scholar). Together with their fatty acid precursors, they affect gene expression directly by interaction with nuclear receptors (5.Schmitz G. Ecker J. The opposing effects of n-3 and n-6 fatty acids.Prog. Lipid Res. 2008; 47: 147-155Crossref PubMed Scopus (874) Google Scholar). Although long-chain omega-3 and omega-6 fatty acids can be obtained directly from diet, genetic evidence suggests that biosynthesis is also important for optimal health throughout life. Single nucleotide polymorphisms (SNP) in FADS2 have been associated with allergy and atopic eczema, total cholesterol, LDL, C-reactive protein levels, and coronary artery disease risk, as well as cognitive outcomes such as attention-deficit hyperactivity disorder and IQ in children (6.Aulchenko Y.S. Ripatti S. Lindqvist I. Boomsma D. Heid I.M. Pramstaller P.P. Penninx B.W. Janssens A.C. Wilson J.F. Spector T. et al.Loci influencing lipid levels and coronary heart disease risk in 16 European population cohorts.Nat. Genet. 2009; 41: 47-55Crossref PubMed Scopus (717) Google Scholar, 7.Martinelli N. Girelli D. Malerba G. Guarini P. Illig T. Trabetti E. Sandri M. Friso S. Pizzolo F. Schaeffer L. et al.FADS genotypes and desaturase activity estimated by the ratio of arachidonic acid to linoleic acid are associated with inflammation and coronary artery disease.Am. J. Clin. Nutr. 2008; 88: 941-949Crossref PubMed Scopus (264) Google Scholar, 8.Brookes K.J. Chen W. Xu X. Taylor E. Asherson P. Association of fatty acid desaturase genes with attention-deficit/hyperactivity disorder.Biol. Psychiatry. 2006; 60: 1053-1061Abstract Full Text Full Text PDF PubMed Scopus (117) Google Scholar, 9.Caspi A. Williams B. Kim-Cohen J. Craig I.W. Milne B.J. Poulton R. Schalkwyk L.C. Taylor A. Werts H. Moffitt T.E. Moderation of breastfeeding effects on the IQ by genetic variation in fatty acid metabolism.Proc. Natl. Acad. Sci. USA. 2007; 104: 18860-18865Crossref PubMed Scopus (310) Google Scholar, 10.Steer C.D. Davey Smith G. Emmett P.M. Hibbeln J.R. Golding J. FADS2 polymorphisms modify the effect of breastfeeding on child IQ.PLoS ONE. 2010; 5: e11570Crossref PubMed Scopus (92) Google Scholar, 11.Schaeffer L. Gohlke H. Muller M. Heid I.M. Palmer L.J. Kompauer I. Demmelmair H. Illig T. Koletzko B. Heinrich J. Common genetic variants of the FADS1 FADS2 gene cluster and their reconstructed haplotypes are associated with the fatty acid composition in phospholipids.Hum. Mol. Genet. 2006; 15: 1745-1756Crossref PubMed Scopus (438) Google Scholar). Recently, we discovered that FADS2 is alternatively spliced to generate an alternative transcript (FADS2 AT1) with a pattern of expression that differs from the classical form in primate tissues (12.Park W.J. Reardon H.T. Tyburczy C. Kothapalli K.S. Brenna J.T. Alternative splicing generates a novel FADS2 alternative transcript in baboons.Mol. Biol. Rep. 2010; 37: 2403-2406Crossref PubMed Scopus (16) Google Scholar). No function has yet been found for this alternative splice variant, but its expression is conserved across numerous species (13.Brenna J.T. Kothapalli K.S. Park W.J. Alternative transcripts of fatty acid desaturase (FADS) genes.Prostaglandins Leukot. Essent. Fatty Acids. 2010; 82: 281-285Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar). We have also identified seven alternative transcripts for FADS3, an adjacent gene thought to encode a desaturase, due to its sequence homology to other fatty acid desaturase (FADS, referring specifically to the cluster of genes composed of FADS1, FADS2, and FADS3) genes (14.Park W.J. Kothapalli K.S. Reardon H.T. Kim L.Y. Brenna J.T. Novel fatty acid desaturase 3 (FADS3) transcripts generated by alternative splicing.Gene. 2009; 446: 28-34Crossref PubMed Scopus (40) Google Scholar). Although the function of FADS3 and its alternative splice variants is unknown, SNPs in this gene are associated with plasma sphingolipids, triglycerides, and myocardial infarction, and expression of FADS3 is altered in familial combined hyperlipidemia and in mouse uterus at the site of embryo implantation (15.Plaisier C.L. Horvath S. Huertas-Vazquez A. Cruz-Bautista I. Herrera M.F. Tusie-Luna T. Aguilar-Salinas C. Pajukanta P. A systems genetics approach implicates USF1, FADS3, and other causal candidate genes for familial combined hyperlipidemia.PLoS Genet. 2009; 5: e1000642Crossref PubMed Scopus (129) Google Scholar, 16.Hicks A.A. Pramstaller P.P. Johansson A. Vitart V. Rudan I. Ugocsai P. Aulchenko Y. Franklin C.S. Liebisch G. Erdmann J. et al.Genetic determinants of circulating sphingolipid concentrations in European populations.PLoS Genet. 2009; 5: e1000672Crossref PubMed Scopus (151) Google Scholar, 17.Ma X.H. Hu S.J. Ni H. Zhao Y.C. Tian Z. Liu J.L. Ren G. Liang X.H. Yu H. Wan P. et al.Serial analysis of gene expression in mouse uterus at the implantation site.J. Biol. Chem. 2006; 281: 9351-9360Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). Although the genetic evidence suggests that FADS3 is important for lipid metabolism, mechanisms by which genetic variants in FADS3 affect blood lipids and disease have not been identified. Here, we investigated regulation of fatty acid desaturase alternative pre-mRNA splicing. Two major classes of splicing factors are known to function in opposing ways to regulate splicing: the serine-arginine (SR) proteins, which typically enhance splicing, and the heteronuclear riboprotein (hnRNP) family, known for splicing repression (18.House A.E. Lynch K.W. Regulation of alternative splicing: more than just the ABCs.J. Biol. Chem. 2008; 283: 1217-1221Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar). Polypyrimidine tract binding protein (PTB, also known as PTBP1 or hnRNP I) is a member of the hnRNP family that usually acts as a repressor but also sometimes enhances splicing, depending on the location it binds pre-mRNA and proximity to binding sites for other splicing factors (19.Paradis C. Cloutier P. Shkreta L. Toutant J. Klarskov K. Chabot B. hnRNP I/PTB can antagonize the splicing repressor activity of SRp30c.RNA. 2007; 13: 1287-1300Crossref PubMed Scopus (40) Google Scholar). The majority of PTB protein is normally found in the nucleus, but under some circumstances, it can relocalize to the cytoplasm, where it affects mRNA stability and translational efficiency (20.Sawicka K. Bushell M. Spriggs K.A. Willis A.E. Polypyrimidine-tract-binding protein: a multifunctional RNA-binding protein.Biochem. Soc. Trans. 2008; 36: 641-647Crossref PubMed Scopus (235) Google Scholar). Although sometimes described as ubiquitous because it is expressed by most or all cell types at some point during development, PTB protein levels vary in different tissues, and control of function by phosphorylation allows for dynamic temporal and spatial adjustment of PTB activity. PTB is known to be a primary regulator of alternative splicing for several genes (20.Sawicka K. Bushell M. Spriggs K.A. Willis A.E. Polypyrimidine-tract-binding protein: a multifunctional RNA-binding protein.Biochem. Soc. Trans. 2008; 36: 641-647Crossref PubMed Scopus (235) Google Scholar), and it presumably affects numerous others. However, relatively little is known about high-level functional changes resulting from PTB activity. PTB appears to promote growth in some cancer cell types (21.He X. Pool M. Darcy K.M. Lim S.B. Auersperg N. Coon J.S. Beck W.T. Knockdown of polypyrimidine tract-binding protein suppresses ovarian tumor cell growth and invasiveness in vitro.Oncogene. 2007; 26: 4961-4968Crossref PubMed Scopus (102) Google Scholar), and it binds pyrimidine tracts in several growth-promoting genes, encouraging transcription (22.Rustighi A. Tessari M.A. Vascotto F. Sgarra R. Giancotti V. Manfioletti G. A polypyrimidine/polypurine tract within the Hmga2 minimal promoter: a common feature of many growth-related genes.Biochemistry. 2002; 41: 1229-1240Crossref PubMed Scopus (46) Google Scholar). Cytoplasmic PTB has been shown to enhance production of both insulin and insulin secretory granules by stabilizing mRNA, leading to increased translation (23.Knoch K.P. Bergert H. Borgonovo B. Saeger H.D. Altkruger A. Verkade P. Solimena M. Polypyrimidine tract-binding protein promotes insulin secretory granule biogenesis.Nat. Cell Biol. 2004; 6: 207-214Crossref PubMed Scopus (145) Google Scholar). These functions are consistent with switching from lipid utilization to glucose as an energy source and enhancing fatty acid biosynthetic pathways, but to our knowledge, PTB has never been directly linked with lipid metabolism. Preliminary bioinformatics predictions suggested that PTB might function in regulation of FADS2 alternative splicing. To investigate this, we examined binding of PTB in vitro to a putative exonic silencer site, effects of PTB knockdown with small interfering RNA (siRNA), and expression of PTB relative to FADS alternative transcripts in baboon tissues. Finally, we demonstrated changes in the ratio of omega-3 to omega-6 fatty acids with PTB knockdown in liver-derived cells. For all experiments, human HepG2 hepatocellular carcinoma and SK-N-SH neuroblastoma cells were maintained within 10 passages of the original passage received from the ATCC. HepG2 cells were grown in MEM with 10% FBS, and SK-N-SH cells were grown in DMEM/F-12 with 10% FBS (media and serum obtained from HyClone) in a humidified environment at 37°C with 5% CO2. HepG2 nuclear extracts were prepared from cell lysates using the Qproteome Nuclear Protein Kit (Qiagen). Protein concentration was determined using a BCA Protein Assay Kit (Pierce). Biotin-labeled RNA oligos (Integrated DNA Technologies) were suspended in nuclease-free PBS. The sequences used were: FADS2wt GAUUAUGGCCACCUGUCUGUCUACAGAAAA, and FADS2mut GAUUAUGGACAGAGAUAGACGGACAGAAAA. PTB binding to wild-type (wt) but not to the mutant version was predicted using the online tool Splicing Rainbow (EMBL-EBI Alternative Splicing Workbench, <http://www.ebi.ac.uk/asd-srv/wb.cgi>) (24.Stamm S. Riethoven J.J. Le Texier V. Gopalakrishnan C. Kumanduri V. Tang Y. Barbosa-Morais N.L. Thanaraj T.A. ASD: a bioinformatics resource on alternative splicing.Nucleic Acids Res. 2006; 34: D46-D55Crossref PubMed Scopus (198) Google Scholar). For each binding reaction, 1 mg of magnetic streptavidin-labeled M-280 Dynabeads (Invitrogen) were first prewashed to remove nucleases, following the manufacturer’s recommended protocol. Beads were mixed with 27 μg of biotin-RNA and 15 μg of nuclear extract in PBS for 30 min with gentle rotation at 4°C. Beads were washed four times with PBS, then bound proteins were eluted with the addition of Laemmli sample buffer and boiling for 5 min. Eluted proteins were loaded onto a Mini-Protean precast Any KD SDS-PAGE gel (Bio-Rad) along with 15 μg nuclear extract as a positive control. After separation, proteins were transferred to a nitrocellulose membrane (Li-Cor). The membrane was probed with antibodies at the following dilutions: mouse SH54 anti-PTB (EMD), 1:100; rabbit anti-β-actin (Li-Cor) as a negative control, 1:1000; goat anti-mouse 680LT (Li-Cor), 1:10,000; goat anti-rabbit 800CW, 1:15,000. The blot was visualized on a Li-Cor Odyssey two-color fluorescence imager. PTB siRNA (100 nM) and control nontargeting siRNA (Dharmacon siGENOME SMARTpool) were used in triplicate treatments with Dharmafect 4 (HepG2) or Dharmafect 1 (SK-N-SH), following the manufacturer's protocol. SMARTpool reagents contained four different siRNA, allowing lower concentrations of individual siRNA to be used to prevent off-target effects. In addition, a combination of sense and antisense strand chemical modifications that reduce off-target effects were incorporated when needed (25.Jackson A.L. Burchard J. Leake D. Reynolds A. Schelter J. Guo J. Johnson J.M. Lim L. Karpilow J. Nichols K. et al.Position-specific chemical modification of siRNAs reduces “off-target” transcript silencing.RNA. 2006; 12: 1197-1205Crossref PubMed Scopus (654) Google Scholar). Cells were treated for 72 h before RNA or lipid extraction. For fatty acid treatment, omega-3 docosapentaenoic acid (22:5n-3) was first noncovalently bound to fatty-acid free BSA (BSA). Fatty acid sodium salts were suspended in PBS, mixed with fatty-acid free BSA in a 3:1 ratio of fatty acid to albumin, and incubated for 5 h at 37°C. RNA interference (RNAi) was carried out as usual, with the addition of 25 μM BSA-bound 22:5n-3 or vehicle (BSA only) in the media for the entire 72 h incubation. Banked neonate baboon tissues were obtained in a previous study from our laboratory (26.Hsieh A.T. Anthony J.C. Diersen-Schade D.A. Rumsey S.C. Lawrence P. Li C. Nathanielsz P.W. Brenna J.T. The influence of moderate and high dietary long chain polyunsaturated fatty acids (LCPUFA) on baboon neonate tissue fatty acids.Pediatr. Res. 2007; 61: 537-545Crossref PubMed Scopus (55) Google Scholar) and stored from time of necropsy at −80°C until RNA was extracted. All tissues were from a 12-week-old control animal that had been fed an infant formula containing no long-chain PUFA. Live baboon work was carried out at the Southwest Foundation for Biomedical Research (SFBR) in San Antonio, TX. Animal protocols were approved by the SFBR and Cornell University Institutional Animal Care and Use Committee (IACUC, protocol #02-105.) Baboon tissue and cell culture RNA was extracted, RNA integrity assessed, cDNA prepared, and semi-quantitative RT-PCR carried out as described previously (14.Park W.J. Kothapalli K.S. Reardon H.T. Kim L.Y. Brenna J.T. Novel fatty acid desaturase 3 (FADS3) transcripts generated by alternative splicing.Gene. 2009; 446: 28-34Crossref PubMed Scopus (40) Google Scholar). PCR primers designed for FADS splice variants (Integrated DNA Technologies, sequences available upon request) were validated by cloning and sequencing PCR products. Gel bands were analyzed by densitometry using ImageJ software (National Institutes of Health). Quantitative real-time PCR was carried out using SYBR Green Master Mix (Roche) on a LightCycler 480 instrument (Roche), with β-actin chosen from a panel of candidate reference genes because it was not affected by cell treatments. PCR reaction efficiency was calculated from standard curves, and reactions were assessed by both melting curves and by running on agarose gels to verify reaction products and the absence of primer-dimers. Quantitative cycle (Cq) values were determined using LightCycler 480 SW1.5.0SP3 software, version 1.5.0.39 (Roche). Analysis was carried out with REST 2009 software (Qiagen), which employs the Pfaffl method for relative quantification (27.Pfaffl M.W. A new mathematical model for relative quantification in real-time RT-PCR.Nucleic Acids Res. 2001; 29: e45Crossref PubMed Scopus (25499) Google Scholar) and uses bootstrapping and randomization techniques to calculate fold changes and statistical significance. Cells were washed with HBSS and then trypsinized to remove from growth surfaces. After centrifugation and removal of supernatant, lipid extraction was carried out on the cell pellets. Fatty acid methyl esters (FAME) were prepared using a modification of the one-step method of Garces and Mancha (28.Garcés R. Mancha M. One-step lipid extraction and fatty acid methyl esters preparation from fresh plant tissues.Anal. Biochem. 1993; 211: 139-143Crossref PubMed Scopus (502) Google Scholar). FAME were analyzed in triplicate and quantified by gas chromatography-flame ionization detection (GC-FID), using an equal weight FAME standard mixture to verify response factors daily (29.Diau G.Y. Hsieh A.T. Sarkadi-Nagy E.A. Wijendran V. Nathanielsz P.W. Brenna J.T. The influence of long chain polyunsaturate supplementation on docosahexaenoic acid and arachidonic acid in baboon neonate central nervous system.BMC Med. 2005; 3: 11Crossref PubMed Scopus (162) Google Scholar). Peak identities were confirmed by GC-covalent adduct chemical ionization tandem mass spectrometry (GC-CACI-MS/MS) (30.Van Pelt C.K. Brenna J.T. Acetonitrile chemical ionization tandem mass spectrometry to locate double bonds in polyunsaturated fatty acid methyl esters.Anal. Chem. 1999; 71: 1981-1989Crossref PubMed Scopus (96) Google Scholar, 31.Lawrence P. Brenna J.T. Acetonitrile covalent adduct chemical ionization mass spectrometry for double bond localization in non-methylene-interrupted polyene fatty acid methyl esters.Anal. Chem. 2006; 78: 1312-1317Crossref PubMed Scopus (69) Google Scholar, 32.Michaud A.L. Diau G.Y. Abril R. Brenna J.T. Double bond localization in minor homoallylic fatty acid methyl esters using acetonitrile chemical ionization tandem mass spectrometry.Anal. Biochem. 2002; 307: 348-360Crossref PubMed Scopus (55) Google Scholar). The standard deviation for ratios (fold change in treated/control) was calculated using a propagation-of-error approach. To identify putative binding sites for splicing factors that might regulate alternative splicing of FADS genes, we investigated alternative exonic splice sites in FADS2 (NCBI accession EU780003) and FADS3 (NCBI accession EU780002) using the bioinformatics tool Splicing Rainbow (EMBL-EBI Alternative Splicing Workbench, <http://www.ebi.ac.uk/asd-srv/wb.cgi>) (24.Stamm S. Riethoven J.J. Le Texier V. Gopalakrishnan C. Kumanduri V. Tang Y. Barbosa-Morais N.L. Thanaraj T.A. ASD: a bioinformatics resource on alternative splicing.Nucleic Acids Res. 2006; 34: D46-D55Crossref PubMed Scopus (198) Google Scholar). The alternative transcripts (AT) and in vivo expression patterns of FADS2 and FADS3 splice variants have been described in detail previously (12.Park W.J. Reardon H.T. Tyburczy C. Kothapalli K.S. Brenna J.T. Alternative splicing generates a novel FADS2 alternative transcript in baboons.Mol. Biol. Rep. 2010; 37: 2403-2406Crossref PubMed Scopus (16) Google Scholar, 14.Park W.J. Kothapalli K.S. Reardon H.T. Kim L.Y. Brenna J.T. Novel fatty acid desaturase 3 (FADS3) transcripts generated by alternative splicing.Gene. 2009; 446: 28-34Crossref PubMed Scopus (40) Google Scholar). Approximately 30 nt regions flanking splice sites identified from our previous work were examined for predicted binding sites. Numerous splicing enhancer binding sites were predicted, but there was also a striking pattern of predicted PTB binding directly on splice sites identified from baboon cDNA for FADS2 AT1 (NCBI accession FJ901343) and FADS3 AT7 (NCBI accession FJ641203). The alternative splice site in FADS2 exon 4 occurred at base 7 of the 14-mer predicted PTB binding site. FADS3 exon 8 included a 35 nt stretch predicted to bind PTB, with the alternative splice site located at nucleotide 19 of the 35-mer. Replacing the sequences with human cDNA sequences yielded identical binding predictions. In addition, FADS3 AT1 (NCBI accession EU780004) exhibited a predicted PTB binding site near the splice site but not overlapping with it. To test the validity of the predicted binding sites, we carried out an in vitro RNA pull-down assay to determine whether the putative exonic splicing silencer (ESS) in FADS2 could pull down PTB from nuclear extracts. Biotinylated RNA oligos were designed containing either the intact 14-mer human predicted binding site or a mutated binding site of equal length, with pyrimidines in the binding site replaced by purines in the mutant but retaining the same flanking sequences (oligo sequences shown in Materials and Methods). The mutant sequence was checked with Splicing Rainbow to ensure that no consensus binding sites for other splicing factors were introduced in the process of altering the predicted PTB binding site. Each oligo was incubated with nuclear extract, and RNA-bound proteins were eluted and detected by Western blotting. Whole nuclear extract was run in parallel as a positive control, and the blot was probed for β-actin as a negative control to detect nonspecific protein binding. As shown in Fig. 2, PTB bound preferentially to the predicted ESS rather than to the mutant version. Because PTB has previously been shown to repress splicing by sterically hindering binding of splicing enhancers (20.Sawicka K. Bushell M. Spriggs K.A. Willis A.E. Polypyrimidine-tract-binding protein: a multifunctional RNA-binding protein.Biochem. Soc. Trans. 2008; 36: 641-647Crossref PubMed Scopus (235) Google Scholar), we hypothesized that PTB might function as a repressor for FADS2 AT1 and FADS3 AT7 expression. To investigate this hypothesis, siRNA against PTB was used to knock down PTB in human neuronal (SK-N-SH) and liver-derived (HepG2) cells. Expression of the alternative transcripts was examined by RT-PCR using primers designed to bridge sequences unique to each splice variant. In a preliminary time course experiment, FADS2 AT1 levels rose with time, concomitant with reductions in PTB mRNA levels in SK-N-SH cells (Fig. 3A). Changes in expression were investigated in more detail in HepG2 cells with quantitative real-time PCR for transcripts in the FADS gene cluster (Fig. 3B). With > 90% knockdown of PTB, FADS2 AT1 expression increased 1.48-fold, whereas FADS3 AT7 increased 1.39-fold, consistent with splicing repression by PTB. Interestingly, FADS3 AT1 relative mRNA abundance decreased slightly, suggesting PTB might play a role in stabilizing splicing of this transcript. There were no significant changes in FADS1, FADS2 CS (classically spliced), or any other FADS3 transcripts (data not shown). The concentration of FADS2 AT1 is about 10-fold lower than FADS2 CS in HepG2 cells (estimated from Cq values for identical cDNA dilutions), so even a 50% increase in FADS2 AT1 levels would decrease FADS2 CS by only 5%, well below the detection limit for real-time PCR; hence, no reduction in observed FADS2 CS is expected. Thus, in this liver cell model, PTB knockdown was sufficient to regulate splicing of FADS2 AT1 and FADS3 AT7 transcripts. To understand the role of PTB in regulating tissue-specific splicing of FADS genes in vivo, we examined levels of FADS2 AT1, FADS3 AT7, FADS3 AT1, and PTB mRNA in neonatal baboon tissues. Of 11 tissues evaluated, 8 followed an inverse correlation of FADS2 AT1 with PTB mRNA levels (Fig. 4A, R2= 0.87), suggesting that PTB may play an important role in regulating FADS2 tissue-specific splicing in vivo. The 3 tissues with the lowest levels of PTB did not fit the pattern; these results are consistent with predominant transcription-level control in these tissues, as levels of FADS2 AT1 corresponded closely with FADS2 CS levels in tissues with relatively low PTB (Fig. 4B). Unlike FADS2 AT1, there was much lower correlation between PTB levels and FADS3 AT7 or FADS3 AT1 in baboon tissues (Fig. 5). There was a slight inverse correlation of PTB and FADS3 AT7 (Fig. 5A, R2= 0.44) in the same 8 tissues examined above, whereas FADS3 AT1 showed very little correlation with PTB (Fig. 5B, R2= 0.26).Fig. 5Lower correlation between PTB and FADS3 transcripts. (A) Slight inverse correlation of FADS3 AT7 and PTB in the majority of neonatal baboon tissues examined (■), with R2= 0.44 for trend excluding tissues with low PTB (△). Axes represent RT-PCR-integrated densities normalized to β-actin. (B) Low correlation of FADS3 AT1 and PTB, with R2= 0.26 for trend excluding tissues with low PTB (△).View Large Image Figure ViewerDownload Hi-res image Download (PPT) To determine functional consequences of upregulation of FADS2 AT1 and FADS3 AT7, the fatty acid composition of HepG2 cells was analyzed after PTB knockdown or control siRNA treatment (Fig. 6, gray bars). Both omega-3 and omega-6 fatty acids decreased significantly after PTB knockdown, offset by a slight increase in monounsaturates and no change in saturated fatty acids. Interestingly, in all cases, omega-3 fatty acids declined more than omega-6 fatty acids (23% decrease overall compared with 13%, respectively; P < 0.01 for the difference). There was a 12% reduction (P = 0.005) in the ratio of total omega-3 to omega-6 fatty acids with PTB knockdown. The most dramatic change with PTB knockdown was a 50% reduction in eicosapentaenoic acid (EPA, 20:5n-3) content, coinciding with upregulation of FADS2 AT1 and FADS3 AT7. Although both EPA and arachidonic acid (ARA, 20:4n-6) levels declined with PTB knockdown, EPA levels went down much more than ARA levels; the ratio of EPA to ARA was reduced by 43% (P = 0.0002) with PTB knockdown. The EPA precursors 20:4n-3 and 18:3n-3, normally at very low levels in most cells, were below quantifiable limits, and thus the substrates were not accumulating as EPA product decreased. However, the ratio of 20:3n-6 to its precursor 18:3n-6 decreased 17% with PTB knockdown (P = 0.0005), consistent with inhibition of the elongation step from 18- to 20-carbon polyunsaturated fatty acids. To determine how specific the inhibitory activity was for EPA synthesis compared with longer chain omega-3 fatty acids, we asked whether adding 22:5n-3, an elongation product of EPA, would rescue levels of the desaturation product 22:6n-3 (docosahexaenoic acid, DHA). To investigate this, PTB knockdown was repeated in HepG2 cells in the presence of media supplemented with 22:5n-3 (Fig. 6, black bars). As before, EPA levels were sharply reduced with PTB knockdown, as were the ratio of EPA to ARA and the ratio of total omega-3 to omega-6 fatty acids. Despite 22:5n-3 supplementation, levels of 22:5n-3, 22:6n-3, and the elongation product 24:6n-3 were still significantly reduced with PTB knockdown, although the differences from control cells tended to be less obvious than without supplementation. For example, 22:6n-3 concentration declined 21% in PTB knockdown compared with control (P = 0.001) in unsupplemented cells, whereas the decrease was only 13% (P = 0.002" @default.
• W2169356768 created "2016-06-24" @default.
• W2169356768 creator A5005044274 @default.
• W2169356768 creator A5005312959 @default.
• W2169356768 creator A5034896031 @default.
• W2169356768 creator A5045169483 @default.
• W2169356768 creator A5060793496 @default.
• W2169356768 creator A5077260921 @default.
• W2169356768 date "2011-12-01" @default.
• W2169356768 modified "2023-10-16" @default.
• W2169356768 title "The polypyrimidine tract binding protein regulates desaturase alternative splicing and PUFA composition" @default.
• W2169356768 cites W1559530996 @default.
• W2169356768 cites W1907473378 @default.
• W2169356768 cites W1923747726 @default.
• W2169356768 cites W1963525603 @default.
• W2169356768 cites W1965991219 @default.
• W2169356768 cites W1966991669 @default.
• W2169356768 cites W1974177211 @default.
• W2169356768 cites W1982561172 @default.
• W2169356768 cites W1984169180 @default.
• W2169356768 cites W1990431444 @default.
• W2169356768 cites W1993813725 @default.
• W2169356768 cites W1995239307 @default.
• W2169356768 cites W1999069585 @default.
• W2169356768 cites W1999312002 @default.
• W2169356768 cites W2009150012 @default.
• W2169356768 cites W2010517054 @default.
• W2169356768 cites W2014056397 @default.
• W2169356768 cites W2018483037 @default.
• W2169356768 cites W2023506303 @default.
• W2169356768 cites W2031834113 @default.
• W2169356768 cites W2043019080 @default.
• W2169356768 cites W2051648756 @default.
• W2169356768 cites W2053993799 @default.
• W2169356768 cites W2054106515 @default.
• W2169356768 cites W2058752285 @default.
• W2169356768 cites W2059751934 @default.
• W2169356768 cites W2061857734 @default.
• W2169356768 cites W2065322234 @default.
• W2169356768 cites W2065914771 @default.
• W2169356768 cites W2073186316 @default.
• W2169356768 cites W2075356083 @default.
• W2169356768 cites W2080131125 @default.
• W2169356768 cites W2081466642 @default.
• W2169356768 cites W2086206475 @default.
• W2169356768 cites W2093443539 @default.
• W2169356768 cites W2093550977 @default.
• W2169356768 cites W2096452690 @default.
• W2169356768 cites W2100939507 @default.
• W2169356768 cites W2108244474 @default.
• W2169356768 cites W2121966590 @default.
• W2169356768 cites W2125416562 @default.
• W2169356768 cites W2143313350 @default.
• W2169356768 cites W2144380192 @default.
• W2169356768 cites W2161527180 @default.
• W2169356768 cites W2170504439 @default.
• W2169356768 doi "https://doi.org/10.1194/jlr.m019653" @default.
• W2169356768 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/3220295" @default.
• W2169356768 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/21980057" @default.
• W2169356768 hasPublicationYear "2011" @default.
• W2169356768 type Work @default.
• W2169356768 sameAs 2169356768 @default.
• W2169356768 citedByCount "25" @default.
• W2169356768 countsByYear W21693567682012 @default.
• W2169356768 countsByYear W21693567682013 @default.
• W2169356768 countsByYear W21693567682014 @default.
• W2169356768 countsByYear W21693567682015 @default.
• W2169356768 countsByYear W21693567682016 @default.
• W2169356768 countsByYear W21693567682017 @default.
• W2169356768 countsByYear W21693567682018 @default.
• W2169356768 countsByYear W21693567682019 @default.
• W2169356768 countsByYear W21693567682020 @default.
• W2169356768 countsByYear W21693567682021 @default.
• W2169356768 countsByYear W21693567682022 @default.
• W2169356768 countsByYear W21693567682023 @default.
• W2169356768 crossrefType "journal-article" @default.
• W2169356768 hasAuthorship W2169356768A5005044274 @default.
• W2169356768 hasAuthorship W2169356768A5005312959 @default.
• W2169356768 hasAuthorship W2169356768A5034896031 @default.
• W2169356768 hasAuthorship W2169356768A5045169483 @default.
• W2169356768 hasAuthorship W2169356768A5060793496 @default.
• W2169356768 hasAuthorship W2169356768A5077260921 @default.
• W2169356768 hasBestOaLocation W21693567681 @default.
• W2169356768 hasConcept C104317684 @default.
• W2169356768 hasConcept C138885662 @default.
• W2169356768 hasConcept C185592680 @default.
• W2169356768 hasConcept C194583182 @default.
• W2169356768 hasConcept C2777793812 @default.
• W2169356768 hasConcept C40231798 @default.
• W2169356768 hasConcept C41895202 @default.
• W2169356768 hasConcept C53345823 @default.
• W2169356768 hasConcept C54458228 @default.
• W2169356768 hasConcept C55493867 @default.
• W2169356768 hasConcept C67705224 @default.
• W2169356768 hasConcept C72994624 @default.
• W2169356768 hasConcept C86803240 @default.
• W2169356768 hasConceptScore W2169356768C104317684 @default.
• W2169356768 hasConceptScore W2169356768C138885662 @default.

• next