FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2170586278> ?p ?o ?g. }

• W2170586278 endingPage "462" @default.
• W2170586278 startingPage "455" @default.
• W2170586278 abstract "We have determined which sequences at the right border of the T-DNA region of the nopaline C58 Ti plasmid are required for transfer and/or integration of the T-DNA into the plant cell genome. The results indicate that the 25 by T-DNA terminus repeat sequence, TGACAGGATATATTGGCGGGTAAAC, is directly responsible for T-DNA transfer; furthermore, this sequence is directional in its mode of action. A transfer-negative nononcogenic Ti plasmid derivative, pGV3852, was constructed, in which 3 kb covering the right T-DNA border region was substituted for by pBR322 sequences. The pBR322 sequences in pGV3852 provide a site for homologous recombination with pBR-derived plasmids containing sequences to assay for transfer activity. First, a 3.3 kb restriction fragment overlapping the deleted region in pGV3852 was shown to restore transfer activity. Second, a sequence of only 25 bp, the T-DNA terminus sequence, was shown to be sufficient to restore normal transfer activity. The transfer-promoting sequences are most active when reinserted in one orientation, that normally found in the Ti plasmid." @default.
• W2170586278 created "2016-06-24" @default.
• W2170586278 creator A5038313175 @default.
• W2170586278 creator A5047966980 @default.
• W2170586278 creator A5053453290 @default.
• W2170586278 creator A5069308120 @default.
• W2170586278 date "1984-09-01" @default.
• W2170586278 modified "2023-09-27" @default.
• W2170586278 title "Right 25 by terminus sequence of the nopaline t-DNA is essential for and determines direction of DNA transfer from Agrobacterium to the plant genome" @default.
• W2170586278 cites W1234577111 @default.
• W2170586278 cites W1488634396 @default.
• W2170586278 cites W1539685658 @default.
• W2170586278 cites W1539973494 @default.
• W2170586278 cites W1547225371 @default.
• W2170586278 cites W1850152714 @default.
• W2170586278 cites W1869121016 @default.
• W2170586278 cites W193914404 @default.
• W2170586278 cites W1955722333 @default.
• W2170586278 cites W1964051596 @default.
• W2170586278 cites W1972988109 @default.
• W2170586278 cites W1977766787 @default.
• W2170586278 cites W1977939052 @default.
• W2170586278 cites W1984640298 @default.
• W2170586278 cites W1985796431 @default.
• W2170586278 cites W1986068520 @default.
• W2170586278 cites W1991387467 @default.
• W2170586278 cites W1992042701 @default.
• W2170586278 cites W1992085874 @default.
• W2170586278 cites W2010896362 @default.
• W2170586278 cites W2017445070 @default.
• W2170586278 cites W2018545957 @default.
• W2170586278 cites W2019410656 @default.
• W2170586278 cites W2021158380 @default.
• W2170586278 cites W2035284951 @default.
• W2170586278 cites W2043411905 @default.
• W2170586278 cites W2046451872 @default.
• W2170586278 cites W2047519875 @default.
• W2170586278 cites W2047762243 @default.
• W2170586278 cites W2072644460 @default.
• W2170586278 cites W2097554272 @default.
• W2170586278 cites W2101720727 @default.
• W2170586278 cites W2122742156 @default.
• W2170586278 cites W2161524167 @default.
• W2170586278 cites W2179319758 @default.
• W2170586278 cites W2317310379 @default.
• W2170586278 cites W4296765338 @default.
• W2170586278 doi "https://doi.org/10.1016/0092-8674(84)90500-2" @default.
• W2170586278 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/6467373" @default.
• W2170586278 hasPublicationYear "1984" @default.
• W2170586278 type Work @default.
• W2170586278 sameAs 2170586278 @default.
• W2170586278 citedByCount "282" @default.
• W2170586278 countsByYear W21705862782012 @default.
• W2170586278 countsByYear W21705862782013 @default.
• W2170586278 countsByYear W21705862782014 @default.
• W2170586278 countsByYear W21705862782015 @default.
• W2170586278 countsByYear W21705862782016 @default.
• W2170586278 countsByYear W21705862782017 @default.
• W2170586278 countsByYear W21705862782018 @default.
• W2170586278 countsByYear W21705862782019 @default.
• W2170586278 countsByYear W21705862782020 @default.
• W2170586278 countsByYear W21705862782021 @default.
• W2170586278 countsByYear W21705862782022 @default.
• W2170586278 crossrefType "journal-article" @default.
• W2170586278 hasAuthorship W2170586278A5038313175 @default.
• W2170586278 hasAuthorship W2170586278A5047966980 @default.
• W2170586278 hasAuthorship W2170586278A5053453290 @default.
• W2170586278 hasAuthorship W2170586278A5069308120 @default.
• W2170586278 hasConcept C104317684 @default.
• W2170586278 hasConcept C141231307 @default.
• W2170586278 hasConcept C153911025 @default.
• W2170586278 hasConcept C160136775 @default.
• W2170586278 hasConcept C167625842 @default.
• W2170586278 hasConcept C170673058 @default.
• W2170586278 hasConcept C19924922 @default.
• W2170586278 hasConcept C203284983 @default.
• W2170586278 hasConcept C204241405 @default.
• W2170586278 hasConcept C205225487 @default.
• W2170586278 hasConcept C22744801 @default.
• W2170586278 hasConcept C2778112365 @default.
• W2170586278 hasConcept C2779656422 @default.
• W2170586278 hasConcept C40767141 @default.
• W2170586278 hasConcept C51603236 @default.
• W2170586278 hasConcept C54355233 @default.
• W2170586278 hasConcept C552990157 @default.
• W2170586278 hasConcept C80343103 @default.
• W2170586278 hasConcept C86803240 @default.
• W2170586278 hasConcept C92087593 @default.
• W2170586278 hasConcept C98151556 @default.
• W2170586278 hasConceptScore W2170586278C104317684 @default.
• W2170586278 hasConceptScore W2170586278C141231307 @default.
• W2170586278 hasConceptScore W2170586278C153911025 @default.
• W2170586278 hasConceptScore W2170586278C160136775 @default.
• W2170586278 hasConceptScore W2170586278C167625842 @default.
• W2170586278 hasConceptScore W2170586278C170673058 @default.
• W2170586278 hasConceptScore W2170586278C19924922 @default.
• W2170586278 hasConceptScore W2170586278C203284983 @default.
• W2170586278 hasConceptScore W2170586278C204241405 @default.

• next