FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2170969802> ?p ?o ?g. }

• W2170969802 endingPage "12016" @default.
• W2170969802 startingPage "12006" @default.
• W2170969802 abstract "We report sequence of Thermus thermophilus HB8 DNA containing the gene (cycA) for cytochrome c 552 and a gene (cycB) encoding a protein homologous with one subunit of an ATP-binding cassette transporter. The cycA gene encodes a 17-residue N-terminal signal peptide with following amino acid sequence identical to that reported by (Titani, K., Ericsson, L. H., Hon-nami, K., and Miyazawa, T. (1985) Biochem. Biophys. Res. Commun. 128, 781–787). A modified cycA was placed under control of the T7 promoter and expressed in Escherichia coli. Protein identical to that predicted from the gene sequence was found in two heme C-containing fractions. Fraction rC 552, characterized by an α-band at 552 nm, contains ∼60–70% of a protein highly similar to native cytochromec 552 and ∼30–40% of a protein that contains a modified heme. Cytochrome rC 552 is monomeric and is an excellent substrate for cytochromeba 3. Cytochrome rC 557is characterized by an α-band at 557 nm, contains ∼90% heme C and ∼10% of non-C heme, exists primarily as a homodimer, and is essentially inactive as a substrate for cytochromeba 3. We suggest thatrC 557 is a “conformational isomer” ofrC 552 having non-native, axial ligands to the heme iron and an “incorrect” protein fold that is stabilized by homodimer formation. We report sequence of Thermus thermophilus HB8 DNA containing the gene (cycA) for cytochrome c 552 and a gene (cycB) encoding a protein homologous with one subunit of an ATP-binding cassette transporter. The cycA gene encodes a 17-residue N-terminal signal peptide with following amino acid sequence identical to that reported by (Titani, K., Ericsson, L. H., Hon-nami, K., and Miyazawa, T. (1985) Biochem. Biophys. Res. Commun. 128, 781–787). A modified cycA was placed under control of the T7 promoter and expressed in Escherichia coli. Protein identical to that predicted from the gene sequence was found in two heme C-containing fractions. Fraction rC 552, characterized by an α-band at 552 nm, contains ∼60–70% of a protein highly similar to native cytochromec 552 and ∼30–40% of a protein that contains a modified heme. Cytochrome rC 552 is monomeric and is an excellent substrate for cytochromeba 3. Cytochrome rC 557is characterized by an α-band at 557 nm, contains ∼90% heme C and ∼10% of non-C heme, exists primarily as a homodimer, and is essentially inactive as a substrate for cytochromeba 3. We suggest thatrC 557 is a “conformational isomer” ofrC 552 having non-native, axial ligands to the heme iron and an “incorrect” protein fold that is stabilized by homodimer formation. Three cytochromes c from Thermus thermophilus HB8 have been described (cf. Fee et al. for review (1Fee J.A. Kuila D. Mather M.W. Yoshida T. Biochim. Biophys. Acta. 1986; 853: 153-185Crossref PubMed Scopus (70) Google Scholar)). One of these, the very basic cytochromec 552, is a good substrate for the terminal oxidase, cytochrome ba 3 (∼250 electrons/s at 25 °C (2Soulimane T. von Walter M. Hof P. Than M.E. Huber R. Buse G. Biochem. Biophys. Res. Commun. 1997; 237: 572-576Crossref PubMed Scopus (53) Google Scholar), and a poor substrate for the terminal oxidase cytochromecaa 3 (∼1–2 electrons/s at 25 °C, Ref. 3Yoshida T. Fee J.A. J. Biol. Chem. 1984; 259: 1031-1036Abstract Full Text PDF PubMed Google Scholar). Mechanistic and biophysical examination of these respiratory enzymes is greatly impeded, because useful quantities are only obtained from large amounts of bacterial cell mass, and yields of the cytochromec 552 from T. thermophilus are small; for example, <1 mg of pure cytochrome c 552 is obtained from 1 kg of Thermus cell paste (4Yoshida T. Lorence R.M. Choc M.G. Tarr G.E. Findling K.L. Fee J.A. J. Biol. Chem. 1984; 259: 112-123Abstract Full Text PDF PubMed Google Scholar), although this may depend on growth conditions and purification procedures (4Yoshida T. Lorence R.M. Choc M.G. Tarr G.E. Findling K.L. Fee J.A. J. Biol. Chem. 1984; 259: 112-123Abstract Full Text PDF PubMed Google Scholar, 5Hon-nami K. Oshima T. J. Biochem. (Tokyo). 1977; 82: 769-776Crossref PubMed Scopus (54) Google Scholar). Studies on the functional properties of the two Thermuscytochrome c oxidases are thus limited by the availability of and by the need for designed mutations in the cytochromec. The prospect of having the three-dimensional structure of cytochrome ba 3 (6Soulimane T. Gohlke U. Huber R. Buse G. FEBS Lett. 1995; 368: 132-134Crossref PubMed Scopus (17) Google Scholar) and the report of an atomic resolution x-ray structure of native Thermus cytochromec 552 (7Than M.E. Hof P. Huber R. Bourenkov G.P. Bartunik H.D. Buse G. Soulimane T. J. Mol. Biol. 1997; 271: 629-644Crossref PubMed Scopus (77) Google Scholar) emphasize the potential of this system to provide novel insight on cytochrome c oxidase function. In the course of constructing a deletion series of a Thermusgenomic DNA fragment for sequencing the c 552locus, we observed that colonies from a certain time point in the series were distinctly reddish-brown in color (8Keightley, J. A., The Molecular Cloning and Nucleotide Sequence Analysis of the Genes Encoding Thermus thermophilus Cytochrome c552 and Cytochrome c Oxidase ba3 and the Expression of the Cytochrome c552 Gene in Escherichia coli.Ph.D. thesis, 1993, University of New Mexico.Google Scholar). This led us to attempt engineered expression of the cytochromec 552 gene in E. coli. The c-type cytochromes have covalently attached heme groups usually linked via thioether bonds between two cysteine residues and the 2- and 4-vinyl groups of the heme. Bacterial cytochromesc are located in the periplasmic space in Gram-negative bacteria, or in the case of Gram-postive bacteria, they are bound to the outer surface of the plasma membrane by means of a hydrophobic N-terminal segment (9von Wachenfeldt C. Hederstedt L. J. Biol. Chem. 1990; 265: 13939-13948Abstract Full Text PDF PubMed Google Scholar). Cytochrome c 552 ofT. thermophilus was previously shown to be located in the periplasmic space (10Lorence R.M. Yoshida T. Findling K.L. Fee J.A. Biochem. Biophys. Res. Commun. 1981; 99: 591-599Crossref PubMed Scopus (3) Google Scholar). Bacterial cytochrome c synthesis involves several steps: (a) a pre-apocytochrome cis synthesized in the cytoplasm, i.e. a protein having no heme attached and which possesses an additional N-terminal domain containing signals to transport the protein across the plasma membrane and to specifically proteolyze the signal sequence peptide. (b) The apoprotein and protoheme IX are transported across the plasma membrane, where the signal peptide is cleaved. (c) Once heme and apoprotein are in the periplasmic space, the heme is covalently attached to the protein. And finally, (d) the protein folds into the conformation of the mature holoprotein (cf. Ref. 11Thöny-Meyer L. Microbiol. Mol. Biol. Rev. 1997; 61: 337-376Crossref PubMed Scopus (316) Google Scholar for review). While many details remain unknown, the entire process occurs within a few seconds of protein synthesis (12Garrard W.T. J. Biol. Chem. 1972; 247: 5935-5943Abstract Full Text PDF PubMed Google Scholar). As many as 16 genes and/or gene products are essential for cytochromec synthesis (cf. Refs. 11Thöny-Meyer L. Microbiol. Mol. Biol. Rev. 1997; 61: 337-376Crossref PubMed Scopus (316) Google Scholar and 13Lang S.E. Jenney J.F.E. Daldal F. J. Bacteriol. 1996; 178: 5279-5290Crossref PubMed Google Scholar for review). Included are ferrochelatase (HemH), an enzyme responsible for incorporating iron into protoporphyrin IX (14Frustaci J.M. O'Brian M.R. J. Bacteriol. 1992; 174: 4223-4229Crossref PubMed Google Scholar); heme lyase (CcmF and CcmH) to attach heme to apoprotein by catalyzing the formation of the thioether (see Refs. 11Thöny-Meyer L. Microbiol. Mol. Biol. Rev. 1997; 61: 337-376Crossref PubMed Scopus (316) Google Scholar and 15Grove J. Busby S. Cole J. Mol. Gen. Genet. 1996; 252: 332-341PubMed Google Scholar for review and additional references); a thioredoxin-like molecule located in the periplasm maintains reduced cysteine SH in apocytochromes c (CycY or HelX, Refs. 16Vargas C. Wu G. Davies A.E. Downie J.A. J. Bacteriol. 1994; 176: 4117-4123Crossref PubMed Google Scholar,17Beckman D.L. Trawick D.R. Kranz R.G. Genes Dev. 1992; 6: 268-283Crossref PubMed Scopus (147) Google Scholar); a disulfide isomerase that presumably helps maintain the apocytochrome c in a state suitable for reaction with the lyase (DipZ) (18Sambongi Y. Ferguson S.J. FEBS Lett. 1994; 353: 235-238Crossref PubMed Scopus (64) Google Scholar); unidentified “assembly factors” such as CycH inParacoccus denitrificans (19Page M.D. Ferguson S.J. Mol. Microbiol. 1995; 15: 307-318Crossref PubMed Scopus (46) Google Scholar); and genes that encode for ABC transporters (for review, see Refs. 11Thöny-Meyer L. Microbiol. Mol. Biol. Rev. 1997; 61: 337-376Crossref PubMed Scopus (316) Google Scholar and 20Fath M.J. Kolter R. Microbiol. Rev. 1993; 57: 995-1017Crossref PubMed Google Scholar). For example, thehelABCD operon of Rhodobacter capsulatus (17Beckman D.L. Trawick D.R. Kranz R.G. Genes Dev. 1992; 6: 268-283Crossref PubMed Scopus (147) Google Scholar) and the cycVWXY operon of Bradyrhizobium japonicum(21Ramseier T.M. Winteler H.V. Hennecke H. J. Biol. Chem. 1991; 266: 7793-7803Abstract Full Text PDF PubMed Google Scholar) encode ABC-type ATP-dependent transport proteins that are essential for cytochrome c synthesis in their respective organisms (cf. Refs. 11Thöny-Meyer L. Microbiol. Mol. Biol. Rev. 1997; 61: 337-376Crossref PubMed Scopus (316) Google Scholar and 13Lang S.E. Jenney J.F.E. Daldal F. J. Bacteriol. 1996; 178: 5279-5290Crossref PubMed Google Scholar for review and additional citations). Finally, there are specialized gene products for synthesis of specific cytochromes c, e.g. cytochromec 1 of the bc 1 complex (19Page M.D. Ferguson S.J. Mol. Microbiol. 1995; 15: 307-318Crossref PubMed Scopus (46) Google Scholar, 22Thöny-Meyer L. James P. Hennecke H. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 5001-5005Crossref PubMed Scopus (42) Google Scholar), and there appear to be specific sequences within the cytochrome c molecule itself that contain information to guide the synthetic process (23Caffrey M. Davidson E. Cusanovich M. Daldal F. Arch. Biochem. Biophys. 1992; 292: 419-426Crossref PubMed Scopus (34) Google Scholar, 24Brandner J.P. Stabb E.V. Temme R. Donohue T.J. J. Bacteriol. 1991; 173: 3958-3965Crossref PubMed Google Scholar). Given the complexity of cytochrome c maturation, one might suspect that heterologous expression would be inefficient and, indeed, there are numerous reports to that effect (25McEwan A.G. Kaplan S. Donohue T.J. FEMS Microbiol. Lett. 1989; 59: 253-258Crossref Scopus (30) Google Scholar, 26von Wachenfeldt C. Hederstedt L. FEBS Lett. 1990; 270: 147-151Crossref PubMed Scopus (44) Google Scholar, 27Self S.J. Hunter C.N. Leatherbarrow R.J. Biochem. J. 1990; 265: 599-604Crossref PubMed Scopus (13) Google Scholar, 28Sanbongi Y. Yang J.-H. Igarashi Y. Kodama T. Eur. J. Biochem. 1991; 198: 7-12Crossref PubMed Scopus (50) Google Scholar, 29Grisshammer R. Oeckl C. Michel H. Biochim. Biophys. Acta. 1991; 1088: 183-190Crossref PubMed Scopus (21) Google Scholar, 30Arai H. Igarashi Y. Kodama T. FEBS Lett. 1991; 280: 351-353Crossref PubMed Scopus (24) Google Scholar, 31Kai K. Noguchi S. Sone N. J. Ferment. Bioeng. 1997; 84: 190-194Crossref Scopus (6) Google Scholar). There are, however, some notable exceptions. Thus, Ubbink et al. (32Ubbink M. van Beeumen J. Canters G.W. J. Bacteriol. 1992; 174: 3707-3714Crossref PubMed Google Scholar) describe expression of the complete (including code for the signal peptide)Thiobacillus versutus cytochrome c 550gene in E. coli. The cell mass obtained from each liter of culture medium yielded 1–2 mg of holoprotein, all of which appeared to reside in the periplasm. This allowed the authors to obtain enough protein for high-resolution NMR studies. Sambongi and Ferguson (33Sambongi Y. Ferguson S.J. FEBS Lett. 1994; 340: 65-70Crossref PubMed Scopus (66) Google Scholar) made the remarkable observation that synthesis of holo Paracoccus denitrificans cytochrome c 550 in E. coli requires an N-terminal signal peptide to target the gene product to the periplasm, whereas E. coli can synthesize holo Hydrogenobacter thermophilus cytochromec 552 without targeting to the periplasm. These authors attributed heme C formation to “spontaneous cytoplasmic attachment of heme to the (properly folded) thermostable protein,” revealing yet another complexity of cytochrome c synthesis in E. coli. We describe here the first heterologous expression system for large scale preparation of Thermuscytochrome c 552 from E. coli and our initial characterization of the gene products. Genomic DNA was isolated fromT. thermophilus strain HB8 (ATCC 27634) as described previously (34Mather M.W. Fee J.A. Plasmid. 1990; 24: 45-56Crossref PubMed Scopus (10) Google Scholar). E. coli strains were cultured in L-broth (35Bertani G. J. Bacteriol. 1952; 62: 293-300Crossref Google Scholar) modified by omitting glucose and lowering the sodium chloride to 0.5%, with 1.5% agar (Difco) for plates. Plasmid preparations were carried out by standard procedures (36Maniatis T. Fritsch E.F. Sambrook J. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1982Google Scholar). Probe design for genomic hydridization was based on the method of most probable codons (37Lathe R. J. Mol. Biol. 1985; 183: 1-12Crossref PubMed Scopus (468) Google Scholar, 38Fee J.A. Mather M.W. Springer P. Hensel S. Buse G. Ann. N. Y. Acad. Sci. 1988; 550: 33-38Crossref PubMed Scopus (9) Google Scholar; see “Results”) using the GCG (39Devereux J. Haeberli P. Smithies O. Nucleic Acids Res. 1984; 12: 387-395Crossref PubMed Scopus (11536) Google Scholar) program CODONFREQUENCY. The cytochrome c 552 gene was isolated on a 1.6-kilobase KpnI genomic restriction fragment by the method of Mather et al. (40Mather M.W. Keightley J.A. Fee J.A. Methods Enzymol. 1993; 218: 695-704Crossref PubMed Scopus (8) Google Scholar) and cloned in the Stratagene vector BSII(SK+), generating plasmid p13BCYCA (8Keightley, J. A., The Molecular Cloning and Nucleotide Sequence Analysis of the Genes Encoding Thermus thermophilus Cytochrome c552 and Cytochrome c Oxidase ba3 and the Expression of the Cytochrome c552 Gene in Escherichia coli.Ph.D. thesis, 1993, University of New Mexico.Google Scholar). An exonuclease III deletion series was constructed to sequence the sense strand (Erase-a-base system, Promega), and synthetic oligonucleotide primers were used to sequence the antisense strand. Sequencing was performed by the method of Sanger et al. (41Sanger F. Nicklen S. Coulson A.R. Proc. Natl. Acad. Sci. U. S. A. 1977; 74: 5463-5467Crossref PubMed Scopus (52610) Google Scholar) with modifications as described (42Keightley J.A. Zimmermann B.H. Mather M.W. Springer P. Pastuszyn A. Lawrence D.M. Fee J.A. J. Biol. Chem. 1995; 270: 20345-20358Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar) to alleviate compressions, false terminations, and pyrophosphorolysis. The c 552reading frame was amplified by PCR 1The abbreviations used are: PCR, polymerase chain reaction; nt, nucleotide; ABC, ATP-binding cassette; phc, pyridine hemochrome; IPTG, isopropyl-β-d-thiogalactopyranoside. from p13BCYCA (42Keightley J.A. Zimmermann B.H. Mather M.W. Springer P. Pastuszyn A. Lawrence D.M. Fee J.A. J. Biol. Chem. 1995; 270: 20345-20358Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar) while simultaneously introducing restriction sites for subcloning. The expression vector pET17b (Novagen, Madison, WI) was used to harbor and direct the synthesis of the following construct in E. colistrain BL21(DE3). The sense-strand primer, 5′-d(CTGCTCGGCGGCCTGGCAT ATG GCCCAG)-3′, introduces an NdeI site (underlined) and the start codon (bold type). The antisense primer, 5′-d(CTGGGCCAGCATGGGATCCGGTTACTT)-3′, introduces a BamHI site (underlined) just downstream of the native stop codon (bold type). PCR primers were synthesized at the California Institute of Technology using an Applied Biosystems 380B DNA synthesizer. The PCR reaction was optimized using the HotWax OptiStart Kit™ (Invitrogen, San Diego, CA). The PCR fragment was gel-purified to remove excess primers, nucleotides, and PCR buffer from the sample. After digesting the PCR fragment and pET17b with NdeI andBamHI, each was agarose gel-purified. The prepared vector and insert fragments were ligated with T4DNA ligase (New England Biolabs). Bacterial strain BL21(DE3) was transformed to ampicillin resistance with the ligation mixture and colonies containing the construct pETC552 were isolated for analysis. The construct was verified by DNA sequencing on an Applied Biosystems Prism DNA sequencing system at the California Institute of Technology sequencing facility. Optical spectra were recorded on a SLM/AMINCO model DB3500 spectrophotometer in 1-cm cells. Fully oxidized proteins were obtained by making the solution 10 μm in ferricyanide, and reduced proteins were prepared by adding a small amount of strongly buffered sodium dithionite solution directly to the optical cuvette. The reduced-oxidized extinction coefficient, Δε = 14.3 mm−1cm−1 (5Hon-nami K. Oshima T. J. Biochem. (Tokyo). 1977; 82: 769-776Crossref PubMed Scopus (54) Google Scholar), was used to determine approximate concentrations of the recombinant cytochromes c. Pyridine hemochromes were prepared and quantified according to the method of Berry and Trumpower (43Berry E.A. Trumpower B.L. Anal. Biochem. 1987; 161: 1-15Crossref PubMed Scopus (746) Google Scholar). Second derivatives of absorption spectra were obtained using the Macintosh program, IGOR (Wavemetrics Inc., Portland, OR). Protein was measured by the BCA protein assay kit of Pierce according to manufacturer's instructions. Cytochrome c oxidase activity was determined polarographically at 25 °C in a Gilson water-jacketed cell using a YSI 5331 oxygen probe (Yellow Springs Instruments) and a Chemtrix type 30 oxygen meter with output to a strip-chart recorder. Amino acid analyses and N-terminal sequencing were done in the Protein Chemistry Laboratory at the University of New Mexico and carried out as described by Keightley et al. (42Keightley J.A. Zimmermann B.H. Mather M.W. Springer P. Pastuszyn A. Lawrence D.M. Fee J.A. J. Biol. Chem. 1995; 270: 20345-20358Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). Reaction of protein with iodoacetic acid was carried out as described by Simpson et al. (44Simpson R.J. Neuberger M.R. Liu T.-Y. J. Biol. Chem. 1976; 251: 1936-1940Abstract Full Text PDF PubMed Google Scholar). Under the conditions of the N-terminal sequence analysis, carboxymethyl cysteine has the same chromatographic properties as serine. SDS-polyacrylamide gel electrophoresis was carried out, with minor modifications, according to Downer et al. (45Downer N.W. Robinson N.C. Capaldi R.A. Biochemistry. 1976; 15: 2930-2936Crossref PubMed Scopus (176) Google Scholar), using a Bio-Rad Mini-PROTEAN II electrophoresis cell (Hercules, CA). Nondenaturing gel electrophoresis was carried out with reversed polarity using the same apparatus according to the method of Gabriel (46Gabriel O. Methods Enzymol. 1972; 22: 565-578Crossref Scopus (528) Google Scholar). Electrospray mass spectrometry was carried out at the Scripps Research Institute Mass Spectrometry Facility (La Jolla, CA) using a Perkin-Elmer SCIEX API III mass analyzer with the orifice potential set at 100 V (47Siuzdak G. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 11290-11297Crossref PubMed Scopus (236) Google Scholar). Reconstructions of mass spectra from ion spectra were made using the Perkin-Elmer program Bio-MultiView. The GCG (39Devereux J. Haeberli P. Smithies O. Nucleic Acids Res. 1984; 12: 387-395Crossref PubMed Scopus (11536) Google Scholar) program, PEPTIDESORT, was used to calculate expected properties of the isolated gene products. 10 ml of culture medium (LB and 50 mg/ml ampicillin) were inoculated from a freshly streaked plate of E. coli (strain BL21-DE3) cells containing the pETC552 plasmid. After incubation overnight at 37 °C, this culture was used to inoculate 1 liter of LB medium, containing 50 mg/ml ampicillin, in a 2.8-liter Fernbach flask. This culture was incubated at 37 °C overnight on a rotary shaker set at 125 rpm. The cells were pelleted by centrifugation at 5000 × g for 5 min. The cell pellet was distinctively reddish-brown color, indicating heme protein overproduction. The pellet from 1 liter of culture was resuspended in 25 ml of 50 mm Tris-HCl, pH 8.0, 4 mg/ml lysozyme, 40 units/ml DNase I, 3 units/ml RNase A, 0.1% Triton X-100.p-toluenesulfonyl fluoride was added (2 mm) to inhibit proteolysis, and the extract was incubated at 30 °C for at least 30 min. The cell debris was separated from the extract by centrifugation at 12,000 × g for 15 min at 4 °C. The supernatant, which had the characteristic reddish-brown color, was loaded onto a CM-52 gravity column that had been equilibrated with 25 mm Tris-HCl, 0.1 mm EDTA, pH 8.0 (25 mm TE buffer (TE buffer: 25 mm Tris-HCl, 0.1 mm EDTA, pH 8.0)) at 4 °C, washed overnight with several column volumes of equilibration buffer, and eluted with a gradient of 0–1 m NaCl in 10 mm TE buffer. Fractions containing the reddish-orange protein were combined and concentrated using Centricon 10 concentrators (Amicon) with YM-3 or YM-10 membranes. The concentrated protein was desalted (10 mm TE buffer) using a PD-10 (Amersham Pharmacia Biotech) and passed over a EconoPac CM Column (Bio-Rad) attached to an Amersham Pharmacia Biotech fast protein liquid chromatography purification system. The column was washed with several column volumes of the same buffer, and the protein was eluted with a gradient of 0–2 m NaCl in 10 mm TE buffer. The final step of the procedure involves fast protein liquid chromatography purification using a HiLoad 16/60 Superdex 75 column (Amersham Pharmacia Biotech) that was equilibrated with TE buffer (see Fig. 3). The protein was concentrated as described above. The amino acid sequence of T. thermophilus HB8 cytochrome c 552 was previously determined by Edman degradation of proteolytically generated peptides (48Titani K. Ericsson L.H. Hon-nami K. Miyazawa T. Biochem. Biophys. Res. Commun. 1985; 128: 781-787Crossref PubMed Scopus (17) Google Scholar). We used reverse translation and took advantage of the highly skewed codon usage of T. thermophilus (cf. Refs. 49Mather M.W. Springer P. Fee J.A. J. Biol. Chem. 1991; 266: 5025-5035Abstract Full Text PDF PubMed Google Scholar and 50Mather M.W. Springer P. Hensel S. Buse G. Fee J.A. J. Biol. Chem. 1993; 268: 5395-5408Abstract Full Text PDF PubMed Google Scholar) to design a nondegenerate oligonucleotide probe for the gene that was complimentary to the protein sequence, QGQIEVKGMKYNG: 5′-(CCGTTCTACTTCATCCCCTTGACCTCGATCTGCCCCTG). This probe was used to identify and isolate a 1.6-kilobase pairKpnI fragment as described under “Experimental Procedures.” The entire fragment was sequenced on both strands and is presented in Fig. 1; the sequence of the probe was found to differ in only 4 of the 38 positions (at the positions underlined above). The DNA sequence reveals two open reading frames. The first open reading frame begins at position 154 and ends at position 600 with the stop codon TAA. The translated nucleotide sequence from 205 to 597 corresponds to the chemically determined amino acid sequence of native cytochrome c 552 (48Titani K. Ericsson L.H. Hon-nami K. Miyazawa T. Biochem. Biophys. Res. Commun. 1985; 128: 781-787Crossref PubMed Scopus (17) Google Scholar), and we designate thiscycA. Translation from position 154 through 204 indicates the presence of a 17-amino acid signal peptide (underlinedin Fig. 1; cf. Ref. 51von Heijne G. Abrahmsen L. FEBS Lett. 1989; 244: 439-446Crossref PubMed Scopus (192) Google Scholar). The region upstream of the initiation codon (position 154) contains elements that probably serve as a promoter, including −10 and −35 regions and a ribosome binding site, also underlined in Fig. 1 (cf. Ref. 52Maseda H. Hoshino T. FEMS Microbiol. 1995; 128: 127-134Crossref PubMed Google Scholar for a review of Thermus promoters). Only 9 bases downstream of the TAA stop codon in cycA, a second open reading frame begins at nucleotide 610 and ends with a termination codon (TAG) at 1404; we designate this region as cycB. The DNA sequences in the cycA and cycB regions were subjected to codon usage analysis using a table of codon usage generated from 14 previously sequenced T. thermophilus genes (cf. Ref. 42Keightley J.A. Zimmermann B.H. Mather M.W. Springer P. Pastuszyn A. Lawrence D.M. Fee J.A. J. Biol. Chem. 1995; 270: 20345-20358Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). The average codon preference value for cycA (nt 154 to nt 600) = 1.3084, and the value for cycB (nt 610 to nt 1404) = 1.2317, values typical of other Thermus genes (cf. Refs. 42Keightley J.A. Zimmermann B.H. Mather M.W. Springer P. Pastuszyn A. Lawrence D.M. Fee J.A. J. Biol. Chem. 1995; 270: 20345-20358Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar and 50Mather M.W. Springer P. Hensel S. Buse G. Fee J.A. J. Biol. Chem. 1993; 268: 5395-5408Abstract Full Text PDF PubMed Google Scholar). In contrast, average codon preferences of the other two possible frames in these two regions range from 0.3858 to 0.7692. These results reveal that both cycAand cycB adhere closely to Thermus usage and are thus properly assigned as open reading frames. The sequence ofcycA predicts exactly the amino acid sequence of cytochromec 552 determined chemically by Titani et al. (48Titani K. Ericsson L.H. Hon-nami K. Miyazawa T. Biochem. Biophys. Res. Commun. 1985; 128: 781-787Crossref PubMed Scopus (17) Google Scholar). The translated amino acid sequence from cycB is also shown in Fig. 1. A TFASTA search (53Gribskov M. Homyak M. Edenfield J. Eisenberg D. Comput. Appl. Biosci. 1988; 4: 61-66PubMed Google Scholar) against the Swissprot data base retrieved numerous proteins that share amino acid sequence similarity, with the highest scoring hits being members of the protein superfamily known as ABC transporters (data not shown). These form a diverse group of enzymes that bind and hydrolyze ATP to drive the transport of signal sequence-independent transport of polypeptides, organic molecules, or ions across membranes (cf. Ref. 20Fath M.J. Kolter R. Microbiol. Rev. 1993; 57: 995-1017Crossref PubMed Google Scholar for a general review). As reviewed by Thöny-Meyer (11Thöny-Meyer L. Microbiol. Mol. Biol. Rev. 1997; 61: 337-376Crossref PubMed Scopus (316) Google Scholar), a subset of this family is essential for cytochrome c maturation. Fig.2 shows a complete alignment of the CycB amino acid sequence with those of the ATP-binding subunit of selected ABC transporters that have been implicated in cytochrome cmaturation in several eubacteria. The designated A- and B-sites (Fig.2) form the ATP binding fold (20Fath M.J. Kolter R. Microbiol. Rev. 1993; 57: 995-1017Crossref PubMed Google Scholar, 54Walker J.E. Saraste M. Runswick M.J. Gay N.J. EMBO J. 1982; 1: 945-951Crossref PubMed Scopus (4248) Google Scholar), and the sequence similarity in these regions as well as throughout the molecule is evident. CycB fromThermus thus appears to be a homolog of known cytochromec maturation proteins and therefore probably has the same function in T. thermophilus (see “Discussion”). Two palindromic sequences were identified using the GCG (39Devereux J. Haeberli P. Smithies O. Nucleic Acids Res. 1984; 12: 387-395Crossref PubMed Scopus (11536) Google Scholar) program STEMLOOP as underlined in Fig. 1. The first palindromic sequence occurs at nt 606 to nt 617 with a complementary sequence at nt 633 to nt 622. This includes 2 G=U pairings, which suggests that this palindrome may form in the mRNA and thus may regulate a termination of translation. Since the start codon of cycB is located in the leading strand of this potential structure, it may provide part of an attenuation signal to modulate CycB formation. 2A significant effort was made to detect an RNA transcript in Thermus cells containing both cycAand cycB using Northern analyses (36Maniatis T. Fritsch E.F. Sambrook J. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1982Google Scholar). By rapidly coolingThermus cells grown at 70 °C to ice temperature, we were able to detect very low levels of an RNA molecule that bound an oligonucleotide probe specific for cycA but could not detect any RNA using an oligonucleotide probe specific for cycB(J. A. Fee, J. A. Keightley, and D. Sanders, unpublished results). Potentially the strongest stemloop-forming sequence begins at nt 1435 to nt 1448 with a complementary region nt 1466 to nt 1453. This occurs 30 nucleotides after the termination codon of cycB, it contains a single A-C mismatch and is probably involved in termination of transcription. Although functional in Thermus cells, the suggested promoter elements upstream of cycA (Fig. 1) do not direct the expression of detectable amounts of cytochromec 552 in E. coli. Other T. thermophilus HB8 promoters containing similar −10 and −35 elements do function in E. coli (cf. Refs.55Sato S. Nakada Y. Kanaya S. Tanaka T. Biochim. Biophys. Acta. 1988; 950: 303-312Crossref PubMed Scopus (33) Google Scholar, 56Croft J.E. Love D.R. Bergquist P.L. Mol. Gen. Genet. 1987; 210: 490-497Crossref PubMed Scopus (19) Google Scholar, 57Hartmann R.K. Ulbrich N. Erdmann V.A. Biochimie (Paris). 1987; 69: 1097-1104Crossref PubMed Scopus (35) Google Scholar), however, and transcription from a 23 S rRNA-5 S rRNA rRNA-tRNAGly promoter with similar −10 and −35 elements was found to promote th" @default.
• W2170969802 created "2016-06-24" @default.
• W2170969802 creator A5008733140 @default.
• W2170969802 creator A5015398011 @default.
• W2170969802 creator A5032602155 @default.
• W2170969802 creator A5053860329 @default.
• W2170969802 creator A5091409545 @default.
• W2170969802 date "1998-05-01" @default.
• W2170969802 modified "2023-10-03" @default.
• W2170969802 title "Cloning and Expression in Escherichia coli of the Cytochrome c 552 Gene from Thermus thermophilus HB8" @default.
• W2170969802 cites W124504601 @default.
• W2170969802 cites W1480918825 @default.
• W2170969802 cites W1491106180 @default.
• W2170969802 cites W1500843383 @default.
• W2170969802 cites W1503923203 @default.
• W2170969802 cites W1509810252 @default.
• W2170969802 cites W1510071974 @default.
• W2170969802 cites W1514336087 @default.
• W2170969802 cites W1527819798 @default.
• W2170969802 cites W1532724693 @default.
• W2170969802 cites W156135670 @default.
• W2170969802 cites W1561799415 @default.
• W2170969802 cites W1574128379 @default.
• W2170969802 cites W1574150437 @default.
• W2170969802 cites W1590726325 @default.
• W2170969802 cites W1595292062 @default.
• W2170969802 cites W1660028824 @default.
• W2170969802 cites W1691695228 @default.
• W2170969802 cites W1705731201 @default.
• W2170969802 cites W1743741466 @default.
• W2170969802 cites W1834799313 @default.
• W2170969802 cites W1870836661 @default.
• W2170969802 cites W1873199501 @default.
• W2170969802 cites W1943327251 @default.
• W2170969802 cites W1958059967 @default.
• W2170969802 cites W1966982338 @default.
• W2170969802 cites W1968374969 @default.
• W2170969802 cites W1975566702 @default.
• W2170969802 cites W1981233605 @default.
• W2170969802 cites W1986221684 @default.
• W2170969802 cites W1987158549 @default.
• W2170969802 cites W1994219106 @default.
• W2170969802 cites W1997323735 @default.
• W2170969802 cites W2005966889 @default.
• W2170969802 cites W2009310436 @default.
• W2170969802 cites W2017449280 @default.
• W2170969802 cites W2018549431 @default.
• W2170969802 cites W2022256164 @default.
• W2170969802 cites W2026182346 @default.
• W2170969802 cites W2026538661 @default.
• W2170969802 cites W2026630258 @default.
• W2170969802 cites W2028036933 @default.
• W2170969802 cites W2032116643 @default.
• W2170969802 cites W2036531741 @default.
• W2170969802 cites W2037597875 @default.
• W2170969802 cites W2039058916 @default.
• W2170969802 cites W2040538639 @default.
• W2170969802 cites W2047961406 @default.
• W2170969802 cites W2054370312 @default.
• W2170969802 cites W2059911192 @default.
• W2170969802 cites W2063458954 @default.
• W2170969802 cites W2064024312 @default.
• W2170969802 cites W2064708740 @default.
• W2170969802 cites W2068112084 @default.
• W2170969802 cites W2069457426 @default.
• W2170969802 cites W2078362254 @default.
• W2170969802 cites W2081792639 @default.
• W2170969802 cites W2087841131 @default.
• W2170969802 cites W2089611548 @default.
• W2170969802 cites W2093044206 @default.
• W2170969802 cites W2093426310 @default.
• W2170969802 cites W2108750474 @default.
• W2170969802 cites W2109162773 @default.
• W2170969802 cites W2138270253 @default.
• W2170969802 cites W2143908576 @default.
• W2170969802 cites W2153317207 @default.
• W2170969802 cites W2163389080 @default.
• W2170969802 cites W2171755502 @default.
• W2170969802 cites W2210251745 @default.
• W2170969802 cites W2313500378 @default.
• W2170969802 cites W2337584375 @default.
• W2170969802 cites W2339523095 @default.
• W2170969802 cites W87515128 @default.
• W2170969802 cites W88395068 @default.
• W2170969802 cites W940243699 @default.
• W2170969802 doi "https://doi.org/10.1074/jbc.273.20.12006" @default.
• W2170969802 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/9575141" @default.
• W2170969802 hasPublicationYear "1998" @default.
• W2170969802 type Work @default.
• W2170969802 sameAs 2170969802 @default.
• W2170969802 citedByCount "35" @default.
• W2170969802 countsByYear W21709698022012 @default.
• W2170969802 countsByYear W21709698022013 @default.
• W2170969802 countsByYear W21709698022014 @default.
• W2170969802 countsByYear W21709698022023 @default.
• W2170969802 crossrefType "journal-article" @default.
• W2170969802 hasAuthorship W2170969802A5008733140 @default.
• W2170969802 hasAuthorship W2170969802A5015398011 @default.

• next