FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2171062099> ?p ?o ?g. }

• W2171062099 endingPage "8968" @default.
• W2171062099 startingPage "8960" @default.
• W2171062099 abstract "Induction of myelin genes occurs around birth in the last stage of Schwann cells differentiation and is reactivated in case of nerve injury. Previous studies showed that activation of the gp130 receptor system, using as ligand interleukin-6 fused to its soluble receptor (IL6RIL6), causes induction of myelin genes such as myelin basic protein (MBP) and myelin protein zero (Po) in embryonic dorsal root ganglia Schwann cells. We also reported that in murine melanoma B16/F10.9 cells, IL6RIL6 causes a shut-off of melanogenesis mediated by a down-regulation of the paired-homeodomain factor Pax3. The present work demonstrates that these IL6RIL6-treated F10.9 cells undergo transdifferentiation to a myelinating glial phenotype characterized by induction of the transcriptional activities of both Po and MBP promoters and accumulation of myelin gene products. For both Po and MBP promoters, a repression by Pax3 and stimulation by Sox10 can be demonstrated. Because after IL6RIL6-treatment, Pax3 disappears from the F10.9 cells (as it does in mature myelinating Schwann cells) whereas the level of Sox10 rather increases, we modulated the relative level of these factors and show their involvement in the induction of myelin gene expression by IL6RIL6. In addition, however, we show that a C/G-rich CACC box in the Po promoter is required for activation by IL6RIL6, as well as by ectopic Sox10, and identify a Kruppel-type zinc finger factor acting through this CACC box, which stimulates Po promoter activity. Induction of myelin genes occurs around birth in the last stage of Schwann cells differentiation and is reactivated in case of nerve injury. Previous studies showed that activation of the gp130 receptor system, using as ligand interleukin-6 fused to its soluble receptor (IL6RIL6), causes induction of myelin genes such as myelin basic protein (MBP) and myelin protein zero (Po) in embryonic dorsal root ganglia Schwann cells. We also reported that in murine melanoma B16/F10.9 cells, IL6RIL6 causes a shut-off of melanogenesis mediated by a down-regulation of the paired-homeodomain factor Pax3. The present work demonstrates that these IL6RIL6-treated F10.9 cells undergo transdifferentiation to a myelinating glial phenotype characterized by induction of the transcriptional activities of both Po and MBP promoters and accumulation of myelin gene products. For both Po and MBP promoters, a repression by Pax3 and stimulation by Sox10 can be demonstrated. Because after IL6RIL6-treatment, Pax3 disappears from the F10.9 cells (as it does in mature myelinating Schwann cells) whereas the level of Sox10 rather increases, we modulated the relative level of these factors and show their involvement in the induction of myelin gene expression by IL6RIL6. In addition, however, we show that a C/G-rich CACC box in the Po promoter is required for activation by IL6RIL6, as well as by ectopic Sox10, and identify a Kruppel-type zinc finger factor acting through this CACC box, which stimulates Po promoter activity. Axonal myelination is a function of specialized glial cells, oligodendrocytes in the brain and myelinating Schwann cells (SC) 1The abbreviations used are: SC, Schwann cell(s); MBP, myelin basic protein; Po, protein zero; IL, interleukin; IL6R, IL-6 receptor; IL6RIL6, IL-6 fused to its soluble receptor; DRG, dorsal root ganglia; MITF, microphtalmia-associated transcription factor; RT, reverse transcription; F, forward; R, reverse; G3′PDH, glyceraldehyde 3′-phosphodehydrogenase; nt, nucleotides; 3-AT, 3-amino-1,2,4-triazole; TK, thymidine kinase 1The abbreviations used are: SC, Schwann cell(s); MBP, myelin basic protein; Po, protein zero; IL, interleukin; IL6R, IL-6 receptor; IL6RIL6, IL-6 fused to its soluble receptor; DRG, dorsal root ganglia; MITF, microphtalmia-associated transcription factor; RT, reverse transcription; F, forward; R, reverse; G3′PDH, glyceraldehyde 3′-phosphodehydrogenase; nt, nucleotides; 3-AT, 3-amino-1,2,4-triazole; TK, thymidine kinase in peripheral nerves, whose impairment in demyelinating diseases affects nerve function and integrity. Maturation of cells producing myelin occurs around birth and needs to be reactivated for repair of nerve injury (1Stoll G. Muller H.W. Brain Pathol. 1999; 9: 313-325Google Scholar). The developmental stages from neural crest-derived precursors to mature myelinating SC were defined by specific gene markers (see Refs.2Jessen K.R. Mirsky R. Glia. 1991; 4: 185-194Google Scholar, 3Jessen K.R. Mirsky R. Microsc. Res. Tech. 1998; 41: 393-402Google Scholar, 4Zorick T.S. Lemke G. Curr. Opin. Cell Biol. 1996; 8: 870-876Google Scholar, 5Kioussi C. Gruss P. Trends Genet. 1996; 12: 84-86Google Scholar for reviews). At early stages, embryonic SC express low affinity nerve growth factor receptor, neural cell adhesion molecule (N-CAM), glial fibrillary acidic protein (GFAP), the transcription factors paired homeodomain Pax3, and later POU domain Octamer-6 (Oct-6)/suppressed cAMP-inducible POU (SCIP). This phenotype also characterizes the adult non-myelinating SC and reappears after nerve injury. Maturation of myelinating SC is marked by disappearance of these early markers, including Pax3, and the induction of myelin genes such as myelin basic protein (MBP) and protein zero (Po or myelin protein zero). Promoters driving glial-specific expression of Po (6Lemke G. Lamar E. Patterson J. Neuron. 1988; 1: 73-83Google Scholar, 7Messing A. Behringer R.R. Hammang J.P. Palmiter R.D. Brinster R.L. Lemke G. Neuron. 1992; 8: 507-520Google Scholar, 8Brown A.M. Lemke G. J. Biol. Chem. 1997; 272: 28939-28947Google Scholar) and of MBP (9Miura M. Tamura T. Aoyama A. Mikoshiba K. Gene. 1989; 75: 31-38Google Scholar, 10Foran D.R. Peterson A.C. J. Neurosci. 1992; 12: 4890-4897Google Scholar, 11Gow A. Friedrich Jr., V.L. Lazzarini R.A. J. Cell Biol. 1992; 119: 605-816Google Scholar, 12Goujet-Zalc C. Babinet C. Monge M. Timsit S. Cabon F. Gansmuller A. Miura M. Sanchez M. Pournin S. Mikoshiba K. et al.Eur. J. Neurosci. 1993; 5: 624-632Google Scholar, 13Wrabetz L. Shumas S. Grinspan J. Feltri M.L. Bozyczko D. McMorris F.A. Pleasure D. Kamholz J. J. Neurosci. Res. 1993; 36: 455-471Google Scholar, 14Forghani R. Garofalo L. Foran D.R. Farhadi H.F. Lepage P. Hudson T.J. Tretjakoff I. Valera P. Peterson A. J. Neurosci. 2001; 21: 3780-3787Google Scholar) were identified along with regulatory transcription factors (see Ref. 15Wegner M. Glia. 2000; 29: 118-123Google Scholar for review). Thus, the high mobility group (HMG) domain Sox10, already present in early neural crest cells, activates the Po promoter (16Peirano R.I. Goerich D.E. Riethmacher D. Wegner M. Mol. Cell. Biol. 2000; 20: 3198-3209Google Scholar). Krox20/Egr2, a late marker of myelinating SC differentiation required for myelination (17Topilko P. Schneider-Maunoury S. Levi G. Baron-Van Evercooren A. Chennoufi A.B. Seitanidou T. Babinet C. Charnay P. Nature. 1994; 371: 796-799Google Scholar), stimulates expression of several myelin genes (18Zorick T.S. Syroid D.E. Brown A. Gridley T. Lemke G. Development. 1999; 126: 1397-1406Google Scholar, 19Nagarajan R. Svaren J. Le N. Araki T. Watson M. Milbrandt J. Neuron. 2001; 30: 355-368Google Scholar). Conversely, Pax3 represses expression of MBP (20Kioussi C. Gross M.K. Gruss P. Neuron. 1995; 15: 553-562Google Scholar), and so does SCIP (21Monuki E.S. Kuhn R. Lemke G. Mech. Dev. 1993; 42: 15-32Google Scholar), in line with the need for of Pax3 and SCIP to decrease during the terminal differentiation of myelinating SC. Among extracellular factors acting on SC, only a few could be shown to activate myelin gene expression. The main SC growth factors, neuregulins nerve-derived factor (NDF)/glial growth factor (GGF) (22Dong Z. Brennan A. Liu N. Yarden Y. Lefkowitz G. Mirsky R. Jessen K.R. Neuron. 1995; 15: 585-596Google Scholar), stimulate proliferation at early SC differentiation stages but have negative effects on the induction of MBP and Po genes (23Cheng L. Mudge A.W. Neuron. 1996; 16: 309-319Google Scholar). Similarly, fibroblast growth factor or transforming growth factor-β inhibit Po gene expression (24Morgan L. Jessen K.R. Mirsky R. Development. 1994; 120: 1399-1409Google Scholar). Axonal contacts are thought to provide positive stimuli for myelin gene expression in SC cultures (25Lemke G. Chao M. Development. 1988; 102: 499-504Google Scholar) and in transected nerves (26Trapp B.D. Hauer P. Lemke G. J. Neurosci. 1988; 8: 3515-3521Google Scholar). The molecules mediating these axonal cues are not well known. Intracellular cyclic AMP elevation (e.g. by forskolin) induces Po and MBP (25Lemke G. Chao M. Development. 1988; 102: 499-504Google Scholar, 27Morgan L. Jessen K.R. Mirsky R. J. Cell Biol. 1991; 112: 457-467Google Scholar) whereas it represses Pax3 (20Kioussi C. Gross M.K. Gruss P. Neuron. 1995; 15: 553-562Google Scholar). Activating effects of forskolin were seen on the promoters of the genes encoding myelin proteins Po (6Lemke G. Lamar E. Patterson J. Neuron. 1988; 1: 73-83Google Scholar), MBP (28Zhang X. Miskimins R. J. Neurochem. 1993; 60: 2010-2017Google Scholar, 29Li X. Wrabetz L. Cheng Y. Kamholz J. J. Neurochem. 1994; 63: 28-40Google Scholar), and peripheral myelin protein-22 (PMP-22) (30Saberan-Djoneidi D. Sanguedolce V. Assouline Z. Levy N. Passage E. Fontes M. Gene. 2000; 248: 223-231Google Scholar). Hormones, such as progesterone and glucocorticosteroids, also stimulate Po and PMP-22 promoter activities (31Desarnaud F. Do Thi A.N. Brown A.M. Lemke G. Suter U. Baulieu E.E. Schumacher M. J. Neurochem. 1998; 71: 1765-1768Google Scholar, 32Desarnaud F. Bidichandani S. Patel P.I. Baulieu E.E. Schumacher M. Brain Res. 2000; 865: 12-16Google Scholar). A third group of factors are IL-6 family cytokines that activate the gp130 receptor system. As a prototype of this large family (see Ref. 33Taga T. Kishimoto T. Annu. Rev. Immunol. 1997; 15: 797-819Google Scholar for review), we have used a recombinant protein IL6RIL6 resulting from the fusion of IL-6 to its soluble IL-6 receptor (sIL-6R) that activates the gp130 signaling pathway in many cell types and has a high affinity for gp130 (34Chebath J. Fischer D. Kumar A. Oh J.W. Kolett O. Lapidot T. Fischer M. Rose-John S. Nagler A. Slavin S. Revel M. Eur. Cytokine Network. 1997; 8: 359-365Google Scholar, 35Kollet O. Aviram R. Chebath J. ben-Hur H. Nagler A. Shultz L. Revel M. Lapidot T. Blood. 1999; 94: 923-931Google Scholar). We showed that this gp130 activator potently stimulates the expression of MBP and Po mRNAs and proteins in cultures of mouse E14 embryonic dorsal root ganglia (DRG), as well as in derived SC (36Haggiag S. Chebath J. Revel M. FEBS Lett. 1999; 457: 200-204Google Scholar, 37Haggiag S. Zhang P.L. Slutzky G. Shinder V. Kumar A. Chebath J. Revel M. J. Neurosci. Res. 2001; 64: 564-574Google Scholar). IL6RIL6 strongly down-regulated the expression of Pax3 in these embryonic cells. Moreover, IL6RIL6 enhancedin vivo the number of myelinated fibers in regenerating sciatic nerve (37Haggiag S. Zhang P.L. Slutzky G. Shinder V. Kumar A. Chebath J. Revel M. J. Neurosci. Res. 2001; 64: 564-574Google Scholar). Others observed that IL6RIL6 induces MBP RNA in brain cells, as well. 2M. Pizzi, personal communication. 2M. Pizzi, personal communication.The physiological relevance of these data is supported by the fact that in mice the conditional inactivation of gp130 after birth causes loss of myelin sheaths and SC defects in peripheral nerves (38Betz U.A.K. Bloch W. van den Broek M. Yoshida K. Taga T. Kishimoto T. Addicks K. Rajewsky K. Muller W. J. Exp. Med. 1998; 188: 1955-1965Google Scholar). We show here another system in which the gp130 activator IL6RIL6 switches on the expression of myelin genes and causes transdifferentiation of melanoma cells toward a glial phenotype. The murine melanoma B16/F10.9 cells undergo terminal growth arrest when exposed to the combination of IL-6 with its agonistic soluble IL-6 receptor (39Oh J.W. Katz A. Harroch S. Eisenbach L. Revel M. Chebath J. Oncogene. 1997; 15: 569-577Google Scholar) or to the IL6RIL6 chimera (34Chebath J. Fischer D. Kumar A. Oh J.W. Kolett O. Lapidot T. Fischer M. Rose-John S. Nagler A. Slavin S. Revel M. Eur. Cytokine Network. 1997; 8: 359-365Google Scholar). There is a silencing of the melanogenic pathway because of a profound reduction in Pax3, which then down-regulates the microphtalmia-associated transcription factor (MITF) gene and, in turn, the tyrosinase activity (40Kamaraju A.K. Bertolotto C. Chebath J. Revel M. J. Biol. Chem. 2002; 277: 15132-15141Google Scholar). The present work demonstrates that IL6RIL6 subsequently induces expression of the myelin Po and MBP mRNAs through promoter-mediated transcriptional activation. This melanoma provides a new model to study the transcription factors involved in the regulation of myelin genes expression and their induction by IL-6 family cytokines. Murine B16 melanoma metastatic clone F10.9 cells (41Katz A. Shulman L.M. Porgador A. Revel M. Feldman M. Eisenbach L. J. Immunother. 1993; 13: 98-109Google Scholar, 42Porgador A. Feldman M. Eisenbach L. J. Immunogenet. 1989; 16: 291-303Google Scholar) were cultured as a monolayer at 37 °C, 5% CO2, in Dulbecco's modified Eagle's medium with 8% fetal calf serum (Biolabs, Bet Ha-Emek, Ness Ziona, Israel), supplemented with glutamine, penicillin, and streptomycin. Cells were subcultured every 3 days at 10–30% confluency. Fused IL6RIL6 chimera was produced as described (34Chebath J. Fischer D. Kumar A. Oh J.W. Kolett O. Lapidot T. Fischer M. Rose-John S. Nagler A. Slavin S. Revel M. Eur. Cytokine Network. 1997; 8: 359-365Google Scholar, 35Kollet O. Aviram R. Chebath J. ben-Hur H. Nagler A. Shultz L. Revel M. Lapidot T. Blood. 1999; 94: 923-931Google Scholar) using mammalian Chinese hamster ovary cells and immunoaffinity purification of the secreted 85-kDa protein (Interpharm, Israel). Total RNA was extracted with Tri-Reagent (Molecular Research Center), as recommended by the manufacturer. For RT-PCR, RNA samples (about 2 μg/assay) were reverse-transcribed with SuperscriptII (Invitrogen Molecular Biology) in the presence of oligo(dT) in 20 μl, and 2 μl of the RT reaction was used for amplification withTaq polymerase. The primers used to amplify specific mouse cDNAs were as follows: Pax3 (accession number NM_008781), forward (F): 414–438 and reverse (R): 837–861; Sox10 (AF047043), F: 924–948 and R: 1435–1459; glial fibrillary acidic protein (L27219; rat), F: 1301–1605 and R: 2175–2194; Po (mRNA sequence reconstituted from M62857–60), F: 231–255 and R: 690–714; and MBP (M15060), F: 136–156 and R: 466–485. Glyceraldehyde 3′-phosphodehydrogenase (G3′PDH) primers (Clontech) were used to verify RNA loading. Amplification conditions were 94 °C (1 min), 52–58 °C (45 s), 72 °C (1 min) for 29 cycles or for 22 cycles (G3′PDH). The sequence of PCR fragments was verified on DNA analyzer 3700 (PE Applied Biosystems, Hitachi). Real time PCR for Pax3 and Sox10 was carried out in a LightCycler (Roche Diagnostics) as recommended by the manufacturer. Northern blots were probed with a MBP cDNA fragment cloned, sequenced, and radiolabeled with [α-32P]dCTP by random priming with the Rediprime-II kit (Amersham Biosciences). Western blots with rabbit anti-Sox10 antibody (CeMines) and anti-Pax3 (Geneka Biotechnology Inc.) antibodies (both at 1/2000 dilution) and with anti-CNPase mouse monoclonal antibody (1/300 dilution; Sigma) were as detailed elsewhere (40Kamaraju A.K. Bertolotto C. Chebath J. Revel M. J. Biol. Chem. 2002; 277: 15132-15141Google Scholar). Anti-extracellular signal-regulated kinase (ERK) 1/2 antibodies were used as control (gift of R. Seger, Weizmann Institute). RT-PCR with F10.9 total RNA was used as described (40Kamaraju A.K. Bertolotto C. Chebath J. Revel M. J. Biol. Chem. 2002; 277: 15132-15141Google Scholar) to amplify the entire coding sequences of Pax3c cDNA (NM_008781; nt 255–1759) and Sox10 cDNA (AF047043; nt 39–1339). The cDNAs were cloned in the pcDNA3 expression vector (Invitrogen). The plasmid pAdRSV Krox20G (a gift of Drs. P. Charnay and P. Topilko, Paris, France) contains 5.2 kbp of Krox20 mouse genomic DNA sequence (including the complete protein coding sequence) in 3′ of Rous sarcoma virus long terminal repeat and in 5′ of the pIX gene polyadenylation domain. We prepared permanently transfected clones of F10.9 cells where Sox10 or Pax3 gene expression can be increased following addition of tetracycline (or doxycyclin) to the growth medium (Tet-on system). We first selected F10.9 cell clones expressing the recombinant reverse tetracycline repressor rtTA isolated from the pTet-On regulator plasmid (Clontech) cloned in pEFIRES-puro, using puromycin as before (40Kamaraju A.K. Bertolotto C. Chebath J. Revel M. J. Biol. Chem. 2002; 277: 15132-15141Google Scholar). The clones were screened for rtTA activity, wild-type growth rate, and response to IL6RIL6 by morphological change. In the selected clone cells, we introduced the vector pSV2Hygro, together with pBI vectors containing a bidirectional Tet-regulated element (Clontech). In the pBI vectors, downstream to the Tet-regulated element, we cloned the cDNA for the green fluorescent protein, enhanced green fluorescent protein (Clontech), either alone (control) or with Sox10 or Pax3 cDNA (in the opposite direction). F10.9-rtTA cell clones growing in the presence of hygromycin and becoming fluorescent after treatment with doxycycline (200 ng/ml) were selected. Expression of the ectopic mRNAs was verified by RT-PCR, using the vector reverse primer 5′ ACTCACCCTGAAGTTCTCAG and forward primers Sox10 (AF047043; nt 924–948) or Pax3 (NM_008781; nt 850–880). The MBP reporter plasmid pBG1b (9Miura M. Tamura T. Aoyama A. Mikoshiba K. Gene. 1989; 75: 31-38Google Scholar) (a gift of Dr. C. Kioussi, San Diego, CA) was excised withBglII and BspeI and blunt-ended to obtain the 5′ flanking MBP gene sequence −1320/+33. The fragment was cloned in front of the luciferase coding sequence in the pGL3 basic plasmid (Promega) cut by XhoI and HindIII, blunt-ended, to create the plasmid pGL3MBP/−1.3. The latter was cut withBglII (in 5′) and PstI (in the MBP sequence) and closed by ligation to create pGL3MBP/−0.65 or was cut with Ecl136–1 and PvuII to create pGL3MBP/−105. The rat Po promoter (6Lemke G. Lamar E. Patterson J. Neuron. 1988; 1: 73-83Google Scholar) was generated by genomic PCR, using the following primers: F, 5′-GACATTATCCCTCCCATCCCCTTATTTCCC-3′; and R, 5′-GCCCAGAGCGTCTGT-GGGGTGGAGAGAGCG-3′. After end polishing, the amplified fragment (genomic sequence −912/+45 relative to the start site) was cloned upstream of luciferase in pGL3 basic cut withSmaI to create pGL3Po-912. For pGL3Po-500, Po gene sequence −500/+45 was made by PCR with pGL3Po-912 as template and primers F, 5′-GGGGACGCGTCCAGGATGCAGGGAGATG-3′, with aMluI site (underlined); and R, 5′- GGGGAAGCTTGCCCAGAGCGTCTGTGGG-3′, with aHindIII site. The MluI/HindIII PCR fragment was inserted in pGL3 basic cut byMluI/HindIII. The other 5′ deletion plasmids were similarly prepared. For 3′ deletions of the Po promoter, the pGL3Po-300 plasmid was used as template for PCR amplification between primer F, 5′-GGGGGCTAGCTCTATCCCTCAGAGAAGT-3′, with aNheI site; and R, 5′-GGGGAGGCCTCCCCTGGATCCCCAGCAT-3′ or 5′-GGGGAGGCCTGGGGCATTGTATACTCTG-3′, with aStuI site. The amplified fragments contain sequences −299/−30 or −299/−137 of the Po promoter. All 3′ deletions were made with the same method and were introduced in front of the minimal herpes simian virus (HSV)-TK promoter (−73/+57) in the PGL3-TK plasmid cut by NheI/StuI. PGL3-TK was made by using as template a construct containing the −155/+57 sequence of HSV-TK in front of the luciferase gene in PGL3 basic. We amplified by PCR a large fragment of this plasmid by using primer F, 5′-GGGGGCTAGC AGGCCTAACACGCAGATGCAGTCGG containing in 5′ NheI (bold) and StuI (underlined) sites in front of the TK sequence from −73. The reverse primer 5′-TCTGGCATGCGAGAATCTCACGC-3′ overlapped the unique SphI site of the vector. The PCR fragment cut by NheI/SphI was cloned in PGL3 basic vector cut by NheI/SphI. Site-directed mutagenesis was done by using an Expand high fidelity PCR system (Roche Molecular Biochemicals). Two primers in opposite orientation, each one carrying half of the mutated site in its 5′, were used to amplify the mutated plasmid in a single PCR reaction. Typical conditions for the PCR reaction were according to the manufacturer's protocol. Amplification conditions were 95 °C (3 min) for one cycle; 94 °C (15 s (sec), 58 °C (30 s), and 68 °C (4 min) for 10 cycles; 94 °C (15 s), 58 °C (30 s), and 68 °C (4 min) for 15 cycles; and 72 °C (7 min) for 1 cycle. The PCR product was precipitated with ethanol and then phosphorylated by T4 kinase. The phosphorylated fragment was self-ligated by T4 DNA ligase and digested with restriction enzyme DpnI to eliminate the non-mutated template. The mutated plasmid was cloned and amplified inEscherichia coli (DH5-α strain) competent cells. For transfections, growing F10.9 cells were seeded in 6-cm Nunc plates. After 24 h, each well received 2 ml of a mixture containing a constant amount of 3.3 μg of DNA composed of 0.5 μg of the Po or MBP promoter-luciferase pGL3 plasmids, 100 ng of pSV40-Renilla luciferase plasmid (Promega) and completed with empty pCDNA3, alone or with Sox10 or Pax3 expression vectors, plus 20 μl of LipofectAMINE (Invitrogen), all in medium without antibiotics. After culture for 12 h at 37 °C, each transfected plate was split into 10 wells of 6-well plates, and half the wells were treated with IL6RIL6, and half were left untreated. After further culture for 72 h, the dual luciferase assay system kit (Promega) was used to measure luciferase activities according to the manufacturer's protocol. Results were calculated from quadruplicate wells. Nuclear extracts were prepared from F10.9 cells grown in 9-cm dishes for different times in the presence or absence of IL6RIL6 (300 ng/ml). The cell monolayer, washed with PBS (minus calcium, magnesium), was scraped with a rubber policeman in 2 ml of phosphate-buffered saline into Eppendorf tubes. Pellets recovered by centrifugation at 3000 rpm were frozen and stored in liquid nitrogen until use. Pellets were thawed on ice and homogenized in hypotonic Buffer A (4 volumes per volume pellet) by mixing five times with pipette, left 10 min on ice, and centrifuged for 10 min at 4 °C at 5000 rpm. The pellet compacted by a 10-s spin at 14000 rpm was resuspended in 2.5 volumes (relative to original cell pellet) of Buffer B by mixing five times with pipette, left on ice for 10 min, and centrifuged 14000 rpm for 10 min at 4 °C. The supernatants (nuclear extracts) were kept at −70 °C. Buffer A contained 10 mm Hepes, pH 7.9, 10 mm NaCl, 5% glycerol, 2 mm EDTA, 2 mm EGTA, 50 mm NaF and was completed at the last moment with 1 mm dithiothreitol, 10 mm sodium molybdate, 0.1 mm sodium orthovanadate, and a mix of protease inhibitors (Calbiochem) diluted 1/50 in Buffer A. Buffer B is the same as Buffer A with 400 mm NaCl. Complementary oligonucleotides of Po promoter 176/−151 segment (see Fig. 6 D) were 5′-labeled with [γ-32P]ATP (104 cpm/fmol) and polynucleotide kinase. After annealing, the double-stranded oligonucleotide was purified on a non-denaturing 8% polyacrylamide gel. About 20,000 cpm of the oligonucleotide probe (20 fmol) was incubated with 2 μl of nuclear extracts for 20 min on ice in a final volume of 20 μl. The incubation buffer final composition was 20 mm Hepes, pH 7.9, 60 mm NaCl, 1 mmdithiothreitol, 5% glycerol, 5 mm MgCl2, 0.1 mm ZnCl2, and 100 μg/ml bovine serum albumin, with, respectively, 2 and 0.1 μg of poly(dG)-poly(dC) and poly(dI)-poly(dC) alternate copolymers per assay (Roche Molecular Biochemicals). For competition, 2 pmol of cold wild-type −176/−151 probe or oligonucleotides with mutated CACC site were used as follows: 5′-TGTGTCCCTAGATCTACCTACCCAGA-3′ (−168/−161 mutant) or 5′-TGTGTCCCCCGGGCCCCCTACCCAGA-3′ (−165/−163 mutant). The MATCHMAKER one-hybrid system from Clontech was used according to the manufacturer's protocols. Complementary synthetic oligonucleotides containing the CACC box sequence −174/−156 of the myelin Po promoter cTGTCCCCCCACCCCCCTACa were placed in four tandem repeats upstream of the pHis-1 and pLAcZ1 plasmids. Target reporter strains ofSaccharomyces cerevisiae YM4271 were obtained after transformation with these plasmids and tested for minimal background growth in minimal medium lacking histidine and containing calibrated concentrations of 3-amino-1,2,4-triazole (3-AT). A cDNA library (minimal length 400 bp) was prepared from RNA extracted from F10.9 melanoma cells that had been treated for 48 h with IL6RIL6. The amplified and tailed cDNAs were used for recombination-mediated cloning in yeast with the SmaI-linearized pGADT7-Rec plasmid to form fusion products with the Gal4 activation domain upon transformation into the target reporter yeast strain. Large positive yeast colonies growing in the minimal synthetic dropout (SD) medium lacking histidine and leucine and supplemented with 30 mm 3-AT were selected. Plasmids isolated from the yeast colonies by cloning into E. coli DH5α were tested individually in the yeast target reporter strain. Screening was done in the histidine- and leucine-free selective medium for colonies that grew as efficiently in the presence of at least 30 mm 3-AT as in the absence of 3-AT, thereby eliminating false-positive clones. Candidate plasmids were isolated and sequenced from 5′ and 3′ ends of the insert. Specific primers were prepared for RT-PCR with RNA from F10.9 cells treated or not with IL6RIL6 (for ZBP-99, forward, 5′-GAGGACACATAGTGGAGAAAAGCC-3′; reverse, 5′-TTTCTACTGAATAACTATGCATGT-3′). Constructs with full-length open reading frames were made in pcDNA3 expression vector and used for transfections as above. As previously reported (40Kamaraju A.K. Bertolotto C. Chebath J. Revel M. J. Biol. Chem. 2002; 277: 15132-15141Google Scholar), treatment of the melanoma F10.9 cells by the gp130 activator IL6RIL6 induces a transition in morphology from epithelial-like cells to elongated cells with extended processes that align to form cell tracks. Concomitantly to the cell shape changes, the IL6RIL6-treated cells stopped releasing melanin pigment in the medium, and the rate-limiting melanogenic enzyme tyrosinase decreased. We have demonstrated (40Kamaraju A.K. Bertolotto C. Chebath J. Revel M. J. Biol. Chem. 2002; 277: 15132-15141Google Scholar) that the loss of tyrosinase upon IL6RIL6 treatment results from the decrease in the transcription factor MITF, decrease that is itself mainly because of the loss of Pax3 from the cells. Fig.1 A shows that following the Pax3 RNA down-regulation, there was a strong induction of MBP transcripts in the IL6RIL6-treated melanoma cells. A progressive accumulation of MBP mRNA was observed from 12 to 48 h (Fig.1 B). Transcripts for myelin Po, which is the most abundant component specifically found in the peripheral nerve myelin made by Schwann cells, were strongly induced by IL6RIL6 in the F10.9 cells starting from 24 h (Fig.2 C). The CNPase protein, another constant component of myelin (43Sprinkle T.J. McMorris F.A. Yoshino J. DeVries G.H. Neurochem. Res. 1985; 10: 919-931Google Scholar), was similarly induced by IL6RIL6 in the F10.9 melanoma cells (Fig. 2 D). There was also an induction of PMP-22 and of galactocerebroside (GalC; not shown). The F10.9 melanoma cell response to IL6RIL6 can be defined as a transdifferentiation, because the cells transit from a melanocytic phenotype, which is enhanced if the cells are treated by forskolin (40Kamaraju A.K. Bertolotto C. Chebath J. Revel M. J. Biol. Chem. 2002; 277: 15132-15141Google Scholar), to a phenotype characteristic of myelinating Schwann cells.Figure 2Ectopic expression of Pax3 inhibits Po and MBP promoter activities; down-regulation of Pax3 with IL6RIL6 treatment may account for promoter induction. A, F10.9 cells co-transfected with MBP promoter (−1.3kb/+33), luciferase reporter (0.5 μg), and different amounts of pcDNA3-Pax3 plasmid (with empty pcDNA3 to keep DNA constant at 3.3 μg). Promoter activity, expressed as firefly luciferase values, normalized on Renilla luciferase values, is shown at 48 h with 350 ng/ml IL6RIL6 (black bars) or untreated (open bars).B, same with Po promoter −912/+45, in the same transfection experiment. C, plot of the -fold increase by IL6RIL6 and its repression by different ratios of pcDNA3-Pax3 over the reporter plasmid in three experiments of transfection with Po −912/+45 or MBP −1.3 kb/+33 promoters. D, Western blots of nuclear extracts from F10.9 (72 h without or with IL6RIL6 treatment, 140 ng/ml) reacted successively with Sox10 antibodies and after stripping, with anti-Pax3 antibodies. E, RT-PCR for Sox10 RNA in F10.9 cells without and with IL6RIL6 for 72 h.View Large Image Figure ViewerDownload (PPT) To determine whether the induction of the MBP and Po mRNAs following IL6RIL6 treatment results from transcriptional gene activation, we cloned the 5′ flanking −1320/+33 region of the murine MBP proximal promoter (9Miura M. Tamura T. Aoyama A. Mikoshiba K. Gene. 1989; 75: 31-38Google Scholar) in front of the luciferase reporter gene. This region of the promoter confers tissue-specific expression in cell lines and in myelinating oligodendrocytes in vivo (44Wrabetz L. Taveggia C. Feltri M.L. Quattrini A. Awatrami R. Scherer S.S. Messing A. Kamholz J. J. Neurobiol. 1998; 34: 10-26Google Scholar). Transfection of the F10.9 cells with this reporter gene demonstrated that the MBP gene undergoes a transcriptional activation of about 5-fold in response to the IL6RIL6 stimulus (Fig. 2 A). For the myelin Po gene, the 5′ flanking sequences −912 to +45 of the rat gene, which confer specific expression in Sc" @default.
• W2171062099 created "2016-06-24" @default.
• W2171062099 creator A5035259204 @default.
• W2171062099 creator A5043000211 @default.
• W2171062099 creator A5062464466 @default.
• W2171062099 creator A5070626110 @default.
• W2171062099 creator A5071964475 @default.
• W2171062099 date "2003-03-01" @default.
• W2171062099 modified "2023-09-29" @default.
• W2171062099 title "Activation of Myelin Genes during Transdifferentiation from Melanoma to Glial Cell Phenotype" @default.
• W2171062099 cites W119076594 @default.
• W2171062099 cites W1524481042 @default.
• W2171062099 cites W1526247294 @default.
• W2171062099 cites W1958675029 @default.
• W2171062099 cites W1971926715 @default.
• W2171062099 cites W1972308156 @default.
• W2171062099 cites W1974461694 @default.
• W2171062099 cites W1974534322 @default.
• W2171062099 cites W1983473899 @default.
• W2171062099 cites W1997759424 @default.
• W2171062099 cites W1997889534 @default.
• W2171062099 cites W2000146676 @default.
• W2171062099 cites W2026633715 @default.
• W2171062099 cites W2028448032 @default.
• W2171062099 cites W2028934778 @default.
• W2171062099 cites W2030046231 @default.
• W2171062099 cites W2031523552 @default.
• W2171062099 cites W2036761446 @default.
• W2171062099 cites W2038068782 @default.
• W2171062099 cites W2038205842 @default.
• W2171062099 cites W2043765395 @default.
• W2171062099 cites W2045895566 @default.
• W2171062099 cites W2046434701 @default.
• W2171062099 cites W2049215950 @default.
• W2171062099 cites W2050689467 @default.
• W2171062099 cites W2051618688 @default.
• W2171062099 cites W2056714530 @default.
• W2171062099 cites W2062746755 @default.
• W2171062099 cites W2063251624 @default.
• W2171062099 cites W2064369464 @default.
• W2171062099 cites W2069406175 @default.
• W2171062099 cites W2072414884 @default.
• W2171062099 cites W2076915669 @default.
• W2171062099 cites W2078002199 @default.
• W2171062099 cites W2081001417 @default.
• W2171062099 cites W2081426113 @default.
• W2171062099 cites W2092836250 @default.
• W2171062099 cites W2094196490 @default.
• W2171062099 cites W2108627571 @default.
• W2171062099 cites W2109734495 @default.
• W2171062099 cites W2112368212 @default.
• W2171062099 cites W2115619470 @default.
• W2171062099 cites W2115940913 @default.
• W2171062099 cites W2116227695 @default.
• W2171062099 cites W2119120508 @default.
• W2171062099 cites W2126887820 @default.
• W2171062099 cites W2126947711 @default.
• W2171062099 cites W2143802836 @default.
• W2171062099 cites W2145343118 @default.
• W2171062099 cites W2146538952 @default.
• W2171062099 cites W2151718718 @default.
• W2171062099 cites W2158115811 @default.
• W2171062099 cites W2162497387 @default.
• W2171062099 cites W2162593602 @default.
• W2171062099 cites W2164927488 @default.
• W2171062099 cites W2165608274 @default.
• W2171062099 cites W2169641844 @default.
• W2171062099 cites W2320440027 @default.
• W2171062099 cites W2344200432 @default.
• W2171062099 cites W2417350626 @default.
• W2171062099 cites W4323238684 @default.
• W2171062099 doi "https://doi.org/10.1074/jbc.m210569200" @default.
• W2171062099 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/12643284" @default.
• W2171062099 hasPublicationYear "2003" @default.
• W2171062099 type Work @default.
• W2171062099 sameAs 2171062099 @default.
• W2171062099 citedByCount "47" @default.
• W2171062099 countsByYear W21710620992012 @default.
• W2171062099 countsByYear W21710620992013 @default.
• W2171062099 countsByYear W21710620992014 @default.
• W2171062099 countsByYear W21710620992015 @default.
• W2171062099 countsByYear W21710620992016 @default.
• W2171062099 countsByYear W21710620992019 @default.
• W2171062099 countsByYear W21710620992021 @default.
• W2171062099 countsByYear W21710620992022 @default.
• W2171062099 crossrefType "journal-article" @default.
• W2171062099 hasAuthorship W2171062099A5035259204 @default.
• W2171062099 hasAuthorship W2171062099A5043000211 @default.
• W2171062099 hasAuthorship W2171062099A5062464466 @default.
• W2171062099 hasAuthorship W2171062099A5070626110 @default.
• W2171062099 hasAuthorship W2171062099A5071964475 @default.
• W2171062099 hasBestOaLocation W21710620991 @default.
• W2171062099 hasConcept C104317684 @default.
• W2171062099 hasConcept C127716648 @default.
• W2171062099 hasConcept C1491633281 @default.
• W2171062099 hasConcept C169760540 @default.
• W2171062099 hasConcept C2777658100 @default.
• W2171062099 hasConcept C2778609137 @default.

• next