FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2182228627> ?p ?o ?g. }

• W2182228627 endingPage "29188" @default.
• W2182228627 startingPage "29178" @default.
• W2182228627 abstract "The synthesis of selenocysteine-containing proteins (selenoproteins) involves the interaction of selenocysteine synthase (SelA), tRNA (tRNASec), selenophosphate synthetase (SelD, SPS), a specific elongation factor (SelB), and a specific mRNA sequence known as selenocysteine insertion sequence (SECIS). Because selenium compounds are highly toxic in the cellular environment, the association of selenium with proteins throughout its metabolism is essential for cell survival. In this study, we demonstrate the interaction of SPS with the SelA-tRNASec complex, resulting in a 1.3-MDa ternary complex of 27.0 ± 0.5 nm in diameter and 4.02 ± 0.05 nm in height. To assemble the ternary complex, SPS undergoes a conformational change. We demonstrated that the glycine-rich N-terminal region of SPS is crucial for the SelA-tRNASec-SPS interaction and selenoprotein biosynthesis, as revealed by functional complementation experiments. Taken together, our results provide new insights into selenoprotein biosynthesis, demonstrating for the first time the formation of the functional ternary SelA-tRNASec-SPS complex. We propose that this complex is necessary for proper selenocysteine synthesis and may be involved in avoiding the cellular toxicity of selenium compounds. The synthesis of selenocysteine-containing proteins (selenoproteins) involves the interaction of selenocysteine synthase (SelA), tRNA (tRNASec), selenophosphate synthetase (SelD, SPS), a specific elongation factor (SelB), and a specific mRNA sequence known as selenocysteine insertion sequence (SECIS). Because selenium compounds are highly toxic in the cellular environment, the association of selenium with proteins throughout its metabolism is essential for cell survival. In this study, we demonstrate the interaction of SPS with the SelA-tRNASec complex, resulting in a 1.3-MDa ternary complex of 27.0 ± 0.5 nm in diameter and 4.02 ± 0.05 nm in height. To assemble the ternary complex, SPS undergoes a conformational change. We demonstrated that the glycine-rich N-terminal region of SPS is crucial for the SelA-tRNASec-SPS interaction and selenoprotein biosynthesis, as revealed by functional complementation experiments. Taken together, our results provide new insights into selenoprotein biosynthesis, demonstrating for the first time the formation of the functional ternary SelA-tRNASec-SPS complex. We propose that this complex is necessary for proper selenocysteine synthesis and may be involved in avoiding the cellular toxicity of selenium compounds. Selenium has been recognized as an essential trace element for many life forms, although it is toxic at high levels due to the high chemical reactivity of its metabolites (1Lu J. Holmgren A. Selenoproteins.J. Biol. Chem. 2009; 284: 723-727Abstract Full Text Full Text PDF PubMed Scopus (358) Google Scholar, 2Papp L.V. Lu J. Holmgren A. Khanna K.K. From selenium to selenoproteins: synthesis, identity, and their role in human health.Antioxid. Redox Signal. 2007; 9: 775-806Crossref PubMed Scopus (1012) Google Scholar). Organisms in all three domains of life (bacteria, archaea, and eukarya) synthesize selenocysteine (Sec) 3The abbreviations used are:SecselenocysteineSPSselenophosphate synthetasePLPpyridoxal 5′-phosphateH/DExhydrogen/deuterium exchangeAFMatomic force microscopy. as the main form of organic selenium in the cells, which is incorporated into specialized proteins, known as selenoproteins, that are involved in several functions including oxidoreductions, redox signaling, and antioxidant defense (1Lu J. Holmgren A. Selenoproteins.J. Biol. Chem. 2009; 284: 723-727Abstract Full Text Full Text PDF PubMed Scopus (358) Google Scholar, 3Yoshizawa S. Böck A. The many levels of control on bacterial selenoprotein synthesis.Biochim. Biophys. Acta. 2009; 1790: 1404-1414Crossref PubMed Scopus (85) Google Scholar). selenocysteine selenophosphate synthetase pyridoxal 5′-phosphate hydrogen/deuterium exchange atomic force microscopy. Sec is synthesized on the specific l-serine-aminoacylated tRNA (Ser-tRNASec) and incorporated into selenoproteins at UGA codons via a complex pathway that works through transient protein-RNA and protein-protein interactions. In bacteria, this pathway requires the specific tRNASec (SelC) and an mRNA-specific structure called selenocysteine insertion sequence (SECIS) (1Lu J. Holmgren A. Selenoproteins.J. Biol. Chem. 2009; 284: 723-727Abstract Full Text Full Text PDF PubMed Scopus (358) Google Scholar, 3Yoshizawa S. Böck A. The many levels of control on bacterial selenoprotein synthesis.Biochim. Biophys. Acta. 2009; 1790: 1404-1414Crossref PubMed Scopus (85) Google Scholar). Escherichia coli tRNASec has 8- and 5-bp stems in the acceptor and T arms, respectively, whereas the canonical tRNAs have a 7+5 secondary structure. The D arm of E. coli tRNASec has a 6-bp stem and a 4-nucleotide loop, whereas the canonical tRNAs have a 3–4-bp D stem and 7–12-nucleotide D loop. In addition, the extra arms of the bacterial tRNASer have 5–7-bp stems, in contrast to the 6–9-bp stem observed in E. coli tRNASec (4Itoh Y. Bröcker M.J. Sekine S. Hammond G. Suetsugu S. Söll D. Yokoyama S. Decameric SelA·tRNASec ring structure reveals mechanism of bacterial selenocysteine formation.Science. 2013; 340: 75-78Crossref PubMed Scopus (46) Google Scholar). Sec biosynthesis is initiated by the conversion of l-seryl-tRNASec, aminoacylated with serine by seryl-tRNA synthetase (SerRS), to l-selenocysteyl-tRNASec in a reaction catalyzed by selenocysteine synthase (E.C. 2.9.1.1., SelA), which is a pyridoxal 5′-phosphate (PLP)-dependent homodecameric enzyme of ∼500 kDa (5Forchhammer K. Böck A. Selenocysteine synthase fromEscherichia coli: analysis of the reaction sequence.J. Biol. Chem. 1991; 266: 6324-6328Abstract Full Text PDF PubMed Google Scholar). The co-factor PLP is covalently linked to the Lys295 amino acid residue in each monomer of E. coli SelA prior to Ser-Sec conversion (5Forchhammer K. Böck A. Selenocysteine synthase fromEscherichia coli: analysis of the reaction sequence.J. Biol. Chem. 1991; 266: 6324-6328Abstract Full Text PDF PubMed Google Scholar). Therefore, seryl-tRNASec is linked to SelA in the cofactor site, resulting in a binary complex consisting of one SelAdecamer:10 tRNASec (6Manzine L.R. Serrão V.H. da Rocha e Lima L.M. de Souza M.M. Bettini J. Portugal R.V. van Heel M. Thiemann O.H. Assembly stoichiometry of bacterial selenocysteine synthase and SelC (tRNAsec).FEBS Lett. 2013; 587: 906-911Crossref PubMed Scopus (10) Google Scholar). Recently, the structures of Aquifex aeolicus SelA and its binary complex SelA-tRNASec were resolved by x-ray crystallography, highlighting that the decameric conformation is mandatory to provide the catalytic site for binding the tRNA molecule (4Itoh Y. Bröcker M.J. Sekine S. Hammond G. Suetsugu S. Söll D. Yokoyama S. Decameric SelA·tRNASec ring structure reveals mechanism of bacterial selenocysteine formation.Science. 2013; 340: 75-78Crossref PubMed Scopus (46) Google Scholar). To achieve Ser-Sec conversion, selenium is transferred to the binary complex on its biologically active form, selenophosphate, a product of the reaction catalyzed by the 72.4-kDa dimeric enzyme selenophosphate synthetase (E.C. 2.7.9.3, SelD or SPS), from selenide and ATP (8Ehrenreich A. Forchhammer K. Tormay P. Veprek B. Böck A. Selenoprotein synthesis inEscherichia coli: purification and characterization of the enzyme catalyzing selenium activation.Eur. J. Biochem. 1992; 206: 767-773Crossref PubMed Scopus (89) Google Scholar). Selenophosphate is produced in a two-step reaction, in which selenide is phosphorylated by the ATP γ-phosphate moiety and then ADP is hydrolyzed, releasing selenophosphate, AMP, and orthophosphate (8Ehrenreich A. Forchhammer K. Tormay P. Veprek B. Böck A. Selenoprotein synthesis inEscherichia coli: purification and characterization of the enzyme catalyzing selenium activation.Eur. J. Biochem. 1992; 206: 767-773Crossref PubMed Scopus (89) Google Scholar, 9Glass R.S. Singh W.P. Jung W. Veres Z. Scholz T.D. Stadtman T.C. Monoselenophosphate: synthesis, characterization, and identity with the prokaryotic biological selenium donor, compound SePX.Biochemistry. 1993; 32: 12555-12559Crossref PubMed Scopus (132) Google Scholar, 10Itoh Y. Sekine S. Matsumoto E. Akasaka R. Takemoto C. Shirouzu M. Yokoyama S. Structure of selenophosphate synthetase essential for selenium incorporation into proteins and RNAs.J. Mol. Biol. 2009; 385: 1456-1469Crossref PubMed Scopus (31) Google Scholar, 11Collins R. Johansson A.-L. Karlberg T. Markova N. van den Berg S. Olesen K. Hammarström M. Flores A. Schüler H. Schiavone L.H. Brzezinski P. Arnér E.S.J. Högbom M. Biochemical discrimination between selenium and sulfur 1: a single residue provides selenium specificity to human selenocysteine lyase.PLoS One. 2012; 7: e30581Crossref PubMed Scopus (21) Google Scholar). Selenide originates from selenite reduction, from converted methylated selenium compounds, or through selenium removal from selenoprotein degradation (12Lacourciere G.M. Mihara H. Kurihara T. Esaki N. Stadtman T.C. Escherichia coli NifS-like proteins provide selenium in the pathway for the biosynthesis of selenophosphate.J. Biol. Chem. 2000; 275: 23769-23773Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). Because the Km value of 20 μm for selenide in vitro results in toxic levels of this compound in the cellular environment, it was hypothesized that SPS in vivo obtains selenide from the PLP-dependent NifS-like enzymes CsdB, CSD, and IscS (12Lacourciere G.M. Mihara H. Kurihara T. Esaki N. Stadtman T.C. Escherichia coli NifS-like proteins provide selenium in the pathway for the biosynthesis of selenophosphate.J. Biol. Chem. 2000; 275: 23769-23773Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). In E. coli, these PLP-donor enzymes act as β-lyases, catalyzing the cleavage of the C–S bond from Cys or the C-Se bond from Sec to Ala and S0 or Se0, respectively (3Yoshizawa S. Böck A. The many levels of control on bacterial selenoprotein synthesis.Biochim. Biophys. Acta. 2009; 1790: 1404-1414Crossref PubMed Scopus (85) Google Scholar, 11Collins R. Johansson A.-L. Karlberg T. Markova N. van den Berg S. Olesen K. Hammarström M. Flores A. Schüler H. Schiavone L.H. Brzezinski P. Arnér E.S.J. Högbom M. Biochemical discrimination between selenium and sulfur 1: a single residue provides selenium specificity to human selenocysteine lyase.PLoS One. 2012; 7: e30581Crossref PubMed Scopus (21) Google Scholar, 13Takahata M. Tamura T. Abe K. Mihara H. Kurokawa S. Yamamoto Y. Nakano R. Esaki N. Inagaki K. Selenite assimilation into formate dehydrogenase H depends on thioredoxin reductase inEscherichia coli.J. Biochem. 2008; 143: 467-473Crossref PubMed Scopus (21) Google Scholar). However, an interaction between SPS and NifS-like enzymes has not been described, although a structural basis for the interaction of E. coli CsdB and A. aeolicus SPS was proposed because the molecular surfaces surrounding the active sites of CsdB and SPS exhibit complementarity by molecular docking (10Itoh Y. Sekine S. Matsumoto E. Akasaka R. Takemoto C. Shirouzu M. Yokoyama S. Structure of selenophosphate synthetase essential for selenium incorporation into proteins and RNAs.J. Mol. Biol. 2009; 385: 1456-1469Crossref PubMed Scopus (31) Google Scholar). It is possible that thioredoxin reductase, which is involved in selenite reduction, is also involved in delivering selenide for SPS (3Yoshizawa S. Böck A. The many levels of control on bacterial selenoprotein synthesis.Biochim. Biophys. Acta. 2009; 1790: 1404-1414Crossref PubMed Scopus (85) Google Scholar, 13Takahata M. Tamura T. Abe K. Mihara H. Kurokawa S. Yamamoto Y. Nakano R. Esaki N. Inagaki K. Selenite assimilation into formate dehydrogenase H depends on thioredoxin reductase inEscherichia coli.J. Biochem. 2008; 143: 467-473Crossref PubMed Scopus (21) Google Scholar). After selenophosphate is synthesized, it remains bound to the active-site cavity of SPS until ADP hydrolysis occurs and the product release is completed (7Noinaj N. Wattanasak R. Lee D.-Y. Wally J.L. Piszczek G. Chock P.B. Stadtman T.C. Buchanan S.K. Structural insights into the catalytic mechanism ofEscherichia coli selenophosphate synthetase.J. Bacteriol. 2012; 194: 499-508Crossref PubMed Scopus (19) Google Scholar, 10Itoh Y. Sekine S. Matsumoto E. Akasaka R. Takemoto C. Shirouzu M. Yokoyama S. Structure of selenophosphate synthetase essential for selenium incorporation into proteins and RNAs.J. Mol. Biol. 2009; 385: 1456-1469Crossref PubMed Scopus (31) Google Scholar). Itoh et al. (10Itoh Y. Sekine S. Matsumoto E. Akasaka R. Takemoto C. Shirouzu M. Yokoyama S. Structure of selenophosphate synthetase essential for selenium incorporation into proteins and RNAs.J. Mol. Biol. 2009; 385: 1456-1469Crossref PubMed Scopus (31) Google Scholar) hypothesized that SPS could interact with SelA in a manner similar to that of NifS-like proteins, facilitating the efficient transfer of selenophosphate from SPS to SelA; however, this interaction has never been formally proven. Interestingly, the human SepSecS was reported to interact in vivo with the SPS1 isoform (14Small-Howard A. Morozova N. Stoytcheva Z. Forry E.P. Mansell J.B. Harney J.W. Carlson B.A. Xu X.M. Hatfield D.L. Berry M.J. Supramolecular complexes mediate selenocysteine incorporationin vivo.Mol. Cell. Biol. 2006; 26: 2337-2346Crossref PubMed Scopus (124) Google Scholar), but little is known about the mechanism of this interaction. The elucidation of SPS-catalyzed selenium metabolism is important because SPS, rather than the less specific SelA, is responsible for the discrimination between selenium and sulfur in the process of Sec-tRNASec biosynthesis. The structural basis for this specificity is not yet understood. In this study, we show that SPS functionally interacts with the SelA-tRNASec binary complex, forming the SelA-tRNASec-SPS complex. The macromolecular assembly of the ternary complex follows a stoichiometric ratio of 1SelAdecamer:10tRNASec:5SPSdimer, resulting in a macromolecular structure of ∼1.3 MDa, and we provide structural insights into the organization of the ternary complex. SelA was expressed and purified according to Manzine et al. (15Manzine L.R. Cassago A. da Silva M.T. Thiemann O.H. An efficient protocol for the production of tRNA-free recombinant selenocysteine synthase (SELA) fromEscherichia coli and its biophysical characterization.Protein Expr. Purif. 2013; 88: 80-84Crossref PubMed Scopus (4) Google Scholar) in binding buffer consisting of 20 mm potassium phosphate (pH 7.5), 100 mm sodium chloride, 5% glycerol, 2 mm β-mercaptoethanol, and 10 μm PLP. The Δ28-SelA truncated N-terminal domain was amplified from selA-pET29a vector using 5′-CATATGGCTATTGATCGCTTATTG-3′ forward and 5′-GCGGCCGCTCATTTCAACAACATCTCC-3′ reverse primers and then ligated into the same vector used by Manzine et al. (15Manzine L.R. Cassago A. da Silva M.T. Thiemann O.H. An efficient protocol for the production of tRNA-free recombinant selenocysteine synthase (SELA) fromEscherichia coli and its biophysical characterization.Protein Expr. Purif. 2013; 88: 80-84Crossref PubMed Scopus (4) Google Scholar) and transformed into the selA(−) E. coli strain JS1. The DNA sequence of E. coli SPS was amplified from E. coli genomic DNA using 5′-ACTGTATCATATGAGCGAGAACTCGATTCGTTTGACCCAATAC-3′ forward and 5′-TGCACTCGAGTCATTAACGAATCTCAACCATGGCACGACCGAC-3′ reverse primers and ligated into pET28a(+) vector (GE Healthcare). Recombinant SPS was overexpressed at 37 °C overnight in the E. coli BL21 (λDE3) (Stratagene) in LB medium and then harvested at 12,000 × g for 15 min at 4 °C. The pellet was resuspended in buffer A (50 mm Tris/HCl, pH 8.0, 10 mm imidazole, 300 mm NaCl) and lysed by six cycles of 30 s of sonication and 1 min of rest using the 550 Sonic Dismembrator (Fisher Scientific). The soluble fraction was applied to a metal-chelate affinity matrix (nickel-nitrilotriacetic acid, Qiagen) and eluted with 250 mm imidazole, followed by cleavage of the affinity tag using 1 unit of thrombin protease (GE Healthcare) for 100 μg of E. coli SPS. The product was purified to homogeneity using size exclusion chromatography (Superdex 200, GE Healthcare) in 50 mm Tris/HCl buffer, pH 8.0, 300 mm NaCl, and 5 mm DTT. Limited proteolysis of E. coli SPS was performed using chymotrypsin protease (Sigma). SPS (5 mg/ml) was incubated at a protease:protein ratio of 1:50 w/w for 20 min at 18 °C and analyzed by SDS-PAGE. A stable proteolytic fraction was subjected to N-terminal sequencing by Edman degradation (Department of Biochemistry, University of Cambridge). The result from the proteolytic digestion was used to confirm the truncation of the N-terminal sequence of E. coli SPS after the 11th amino acid residue. The Δ11-SPS construct lacking the first 11 amino acid residues was obtained by DNA sequence amplification from E. coli genomic DNA using 5′-AGCATATGAGCCACGGAGCTGGTTGCGGCTG-3′ forward and 5′-AGCTCGAGTTAACGGATCTCAACCATGGCACG-3′ reverse primers and ligated into pET28a(+) vector (GE Healthcare). We used the protocol described by Manzine et al. (6Manzine L.R. Serrão V.H. da Rocha e Lima L.M. de Souza M.M. Bettini J. Portugal R.V. van Heel M. Thiemann O.H. Assembly stoichiometry of bacterial selenocysteine synthase and SelC (tRNAsec).FEBS Lett. 2013; 587: 906-911Crossref PubMed Scopus (10) Google Scholar) to obtain the E. coli tRNASec (5Forchhammer K. Böck A. Selenocysteine synthase fromEscherichia coli: analysis of the reaction sequence.J. Biol. Chem. 1991; 266: 6324-6328Abstract Full Text PDF PubMed Google Scholar). For fluorescence spectroscopy assays, E. coli tRNASec was labeled with fluorescein maleimide using the 5′ EndTagTM nucleic acid labeling system (Vector Laboratories, Burlingame, CA) according to Manzine et al. (6Manzine L.R. Serrão V.H. da Rocha e Lima L.M. de Souza M.M. Bettini J. Portugal R.V. van Heel M. Thiemann O.H. Assembly stoichiometry of bacterial selenocysteine synthase and SelC (tRNAsec).FEBS Lett. 2013; 587: 906-911Crossref PubMed Scopus (10) Google Scholar). E. coli tRNASec oligonucleotides were designed with modified regions (in bold) replaced by corresponding regions of one isoform of the amino acid serine tRNA carrier (tRNASer) of E. coli, as follows: E. coli serine tRNA gene: ′-GGTGAGGTGTCCGAGTGGCTGAAGGAGCACGCCTGGAAAGTGTGTATACGGCAACGTATCGGGGGTTCGAATCCCCCCCTCACCGCCA-3′; E. coli selC gene: 5′-ACGAATTCTAATACGACTCACTATAGGGAAGATCGTCGTCTCCGGTGAGGCGGCTGGACTTCAAATCCAGTTGGGGCCGCCAGCGGTCCCGGGCAGGTTCGACTCCTGTGATCTTCCGCCA-3′; acceptor arm mutant: 5′-ACGAATTCTAATACGACTCACTATAGGGTGAGGGTCGTCTCCGGTGAGGCGGCTGGACTTCAAATCCAGTTGGGGCCGCCAGCGGTCCCGGGCAGGTTCGACTCCTGTCCTCACCGCCA-3′; D-loop arm mutant: 5′-ACGAATTCTAATACGACTCACTATAGGGAAGATCGTTCCGAGTGGCTGAAGGAGCTGGACTTCAAATCCAGTTGGGGCCGCCAGCGGTCCCGGGCAGGTTCGACTCCTGTGATCTTCCGCCA-3′; anticodon arm mutant: 5′-ACGAATTCTAATACGACTCACTATAGGGAAGATCGTCGTCTCCGGTGAGGCGGCACGCCTGGAAAGTGTGTTGGGGCCGCCAGCGGTCCCGGGCAGGTTCGACTCCTGTGATCTTCCGCCA-3′; deleted variable arm construct: 5′-ACGAATTCTAATACGACTCACTATAGGGAAGATCGTCGTCTCCGGTGAGGCGGCTGGACTTCAAATCCAGTGGCAGGTTCGACTCCTGTGATCTTCCGCCA-3′; variable arm mutant: 5′-ACGAATTCTAATACGACTCACTATAGGGAAGATCGTCGTCTCCGGTGAGGCGGCTGGACTTCAAATCCAGTATACGGCAACGTATGGCAGGTTCGACTCCTGTGACTTTCCGCCA-3′; and TΨC arm mutant: 5′-ACGAATTCTAATACGACTCACTATAGGGAAGATCGTCGTCTCCGGTGAGGCGGCTGGACTTCAAATCCAGTTGGGGCCGCCAGCGGTCCCGGGGGGGTTCGAATCCCCCGATCTTCCGCCA-3′. The amplification, in vitro transcription, and folding were performed as described previously (6Manzine L.R. Serrão V.H. da Rocha e Lima L.M. de Souza M.M. Bettini J. Portugal R.V. van Heel M. Thiemann O.H. Assembly stoichiometry of bacterial selenocysteine synthase and SelC (tRNAsec).FEBS Lett. 2013; 587: 906-911Crossref PubMed Scopus (10) Google Scholar) The functional complementation experiments were conducted according to Sculaccio et al. (16Sculaccio S.A. Rodrigues E.M. Cordeiro A.T. Magalhães A. Braga A.L. Alberto E.E. Thiemann O.H. Selenocysteine incorporation in Kinetoplastid: Selenophosphate synthetase (SELD) fromLeishmania major andTrypanosoma brucei.Mol. Biochem. Parasitol. 2008; 162: 165-171Crossref PubMed Scopus (24) Google Scholar) for N-terminally truncated SPS. Briefly, the E. coli strain WL400 (DE3), which lacks the functional selD gene (7Noinaj N. Wattanasak R. Lee D.-Y. Wally J.L. Piszczek G. Chock P.B. Stadtman T.C. Buchanan S.K. Structural insights into the catalytic mechanism ofEscherichia coli selenophosphate synthetase.J. Bacteriol. 2012; 194: 499-508Crossref PubMed Scopus (19) Google Scholar), was transformed with the full-length E. coli SPS sequence and the SPS construct lacking the N-terminal 11 residues (Δ11-SPS). These cells were tested for the presence of an active selenoprotein formate dehydrogenase H (FDH H) using the benzyl viologen assay under anaerobic conditions (16Sculaccio S.A. Rodrigues E.M. Cordeiro A.T. Magalhães A. Braga A.L. Alberto E.E. Thiemann O.H. Selenocysteine incorporation in Kinetoplastid: Selenophosphate synthetase (SELD) fromLeishmania major andTrypanosoma brucei.Mol. Biochem. Parasitol. 2008; 162: 165-171Crossref PubMed Scopus (24) Google Scholar). Similarly, the SelA and N-terminally truncated SelA complementation experiments were performed using this methodology using the E. coli strain JS1 (DE3), which lacks the functional selA gene, under the same anaerobic conditions (16Sculaccio S.A. Rodrigues E.M. Cordeiro A.T. Magalhães A. Braga A.L. Alberto E.E. Thiemann O.H. Selenocysteine incorporation in Kinetoplastid: Selenophosphate synthetase (SELD) fromLeishmania major andTrypanosoma brucei.Mol. Biochem. Parasitol. 2008; 162: 165-171Crossref PubMed Scopus (24) Google Scholar) for 48 h in 30 °C. Fluorescence anisotropy measurements were performed in an ISS-PC spectrofluorometer (ISS, Champaign, IL). The uncharged tRNASec was fluorescein-labeled, and its interaction with SelA was conducted using 500 nm SelA with 490 nm unlabeled tRNASec and 10 nm fluorescein-labeled tRNASec incubated in binding buffer for 30 min at 25 °C to form the covalently bound binary complex SelA-tRNASec in a final equimolar stoichiometry, according to previous publications (5Forchhammer K. Böck A. Selenocysteine synthase fromEscherichia coli: analysis of the reaction sequence.J. Biol. Chem. 1991; 266: 6324-6328Abstract Full Text PDF PubMed Google Scholar, 6Manzine L.R. Serrão V.H. da Rocha e Lima L.M. de Souza M.M. Bettini J. Portugal R.V. van Heel M. Thiemann O.H. Assembly stoichiometry of bacterial selenocysteine synthase and SelC (tRNAsec).FEBS Lett. 2013; 587: 906-911Crossref PubMed Scopus (10) Google Scholar). The isothermal fluorescence anisotropy assay was performed with fluorescence anisotropy measurements in “L” geometry at 25 °C. A concentrated SPS sample was titrated to a SelA-tRNASec sample, homogenized, and equilibrated for 5 min at 25 °C prior to steady-state anisotropy measurements. The same experimental conditions were applied to fluorescence anisotropy assays using mutant tRNASec constructs. Excitation was set to 480 nm, and emission was recorded through an orange cut-off filter at 515 nm (6Manzine L.R. Serrão V.H. da Rocha e Lima L.M. de Souza M.M. Bettini J. Portugal R.V. van Heel M. Thiemann O.H. Assembly stoichiometry of bacterial selenocysteine synthase and SelC (tRNAsec).FEBS Lett. 2013; 587: 906-911Crossref PubMed Scopus (10) Google Scholar). Anisotropy fluorescence values, r, and total intensity of fluorescence were calculated with the ISS program. In all cases, maximal dilution was less than 20%. The resulting fluorescence anisotropy values were fitted, using the program Origin 8.0, to the Hill equation r = r 0 + ( r f − r 0 ) × ( [ SPS monomer ] ) n ( K d ) n + ( [ SPS monomer ] ) n (Eq. 1) with r0 and rf representing the initial and final fluorescence anisotropy measures. [SPSmonomer] is the titrated SPS concentration in units of monomers. Thus, the apparent dissociation constant (Kd) and the Hill constant (n) were determined. Experiments for determination of the stoichiometry of SelA-tRNASec-SPS binding were performed using 5000 nm SelA bound to 4990 nm unlabeled tRNASec and 10 nm fluorescein-labeled tRNASec. The same procedures as described above were used during the SPS titration. Mutant tRNASec molecules were also tested for interaction with SelA by fluorescence anisotropy assays, as described previously (6Manzine L.R. Serrão V.H. da Rocha e Lima L.M. de Souza M.M. Bettini J. Portugal R.V. van Heel M. Thiemann O.H. Assembly stoichiometry of bacterial selenocysteine synthase and SelC (tRNAsec).FEBS Lett. 2013; 587: 906-911Crossref PubMed Scopus (10) Google Scholar). We used hydrogen/deuterium exchange coupled with mass spectrometry to map the surfaces of SelA and SPS following the formation of the SelA-tRNASec binary complex and the SelA-tRNASec-SPS ternary complex. The various samples (SelA, SelA-tRNASec, SPS, tRNASec, and SelA-tRNASec-SPS) were prepared using a published protocol (17Figueira A.C.M. Saidemberg D.M. Souza P.C.T. Martínez L. Scanlan T.S. Baxter J.D. Skaf M.S. Palma M.S. Webb P. Polikarpov I. Analysis of agonist and antagonist effects on thyroid hormone receptor conformation by hydrogen/deuterium exchange.Mol. Endocrinol. 2011; 25: 15-31Crossref PubMed Scopus (37) Google Scholar). Briefly, the samples were labeled by diluting the sample to a final concentration of D2O of ∼90%. At each time point analyzed, aliquots (20 μl) were taken out of the exchange tube and quenched by mixing the solution with a 1:1 ratio of the quenching buffer (D2O, 100 mm sodium phosphate, pH 2.5) and cooled to 0 °C to slow down the H/D exchange. These sample aliquots were digested for 5 min at 0 °C after the addition of 1 μl of a precooled pepsin solution (1 mg/ml in 5% (v/v) formic acid) and were injected directly to the mass spectrometer using a flow of 80 μl/min. The MS experiments were performed with an electrospray ionization triple quadrupole instrument, model Quatro II (Micromass UK), using the same procedures described by Figueira et al. (17Figueira A.C.M. Saidemberg D.M. Souza P.C.T. Martínez L. Scanlan T.S. Baxter J.D. Skaf M.S. Palma M.S. Webb P. Polikarpov I. Analysis of agonist and antagonist effects on thyroid hormone receptor conformation by hydrogen/deuterium exchange.Mol. Endocrinol. 2011; 25: 15-31Crossref PubMed Scopus (37) Google Scholar). The spectral data were acquired and monitored using the MassLynx software (Micromass); the spectra deconvolution of the intact protein samples was performed with the program Transform (Waters). The theoretical digest was performed using the MS-Digest web server, and the error at each data point was determined to be 0.3 Da (based on multiple measurements). The structural model of E. coli SelA decamer was obtained using the I-TASSER server (18Roy A. Kucukural A. Zhang Y. I-TASSER: a unified platform for automated protein structure and function prediction.Nat. Protoc. 2010; 5: 725-738Crossref PubMed Scopus (4691) Google Scholar) that joins multiple threading alignments to rounds of iterative structural assembly simulations for protein structure modeling. Infrared spectra of protein solutions were collected in a Nicolet Nexus 670 FTIR spectrometer equipped with a DTGS KBr detector, corresponding to 512 scans at a resolution of 2 cm−1 over the wavenumber range 4000–400 cm−1 at 25 °C. During data acquisition, the spectrometer was continuously purged with nitrogen. The buffer spectrum was subtracted digitally from the sample spectrum. The second derivative was used to identify the peak positions of the major components of the amide I band on the original (non-smoothed) protein vibrational spectra. To estimate the secondary structure content, Gaussian curve fitting was performed in the region of 1500–1700 cm−1 using GRAMS/386 software package (Galactic Industries). For FTIR analyses, SelA and SPS were prepared isolated in solution but also in the combinations 1SPS:1SelA, 1SelA:1tRNASec, and 1SelA:1tRNASec:1SPS (molar ratios in monomer units). Difference infrared spectra were used to monitor the initial and the final state of SelA after SelA-tRNASec complex formation obtained by spectrum subtraction of the complex with the isolated samples. The final state of SPS after SelA-tRNASec-SPS complex formation was assessed by subtracting the experimental FTIR signal for the ternary complex, previously subtracted by the FTIR signal of the binary complex, to the SPS spectrum. The combination 1SelA:1SPS was also analyzed. To analyze the external dimensions, 1 μl of each sample, at 0.5 mg/ml, was incubated in binding buffer without PLP for 40 min at 25 °C, deposited on a mica square (10 × 10 mm), and dried at room temperature for 3 h. This mica square was fixed in a metal base and analyzed in a Bruker Digital Instruments Nanoscope IIIA atomic force microscope (LNNano, CNPEM) using the non-contact mode and silicon tip of 1-nm diameter with 256 lines of scanning (19Müller D.J. Janovjak H. Lehto T. Kuerschner L. Anderson K. Observing structure, function and assembly of single proteins by AFM.Prog. Biophys. Mol. Biol. 2002; 79: 1-43Crossref PubMed Scopus (149) Google Scholar). The n-Surf 1.0 beta software was used to analyze the images and determine the dimensions of the ternary complex. To test the hypothesis that SelA-tRNASec interacts with SPS, we isothermally titrat" @default.
• W2182228627 created "2016-06-24" @default.
• W2182228627 creator A5012877871 @default.
• W2182228627 creator A5021158593 @default.
• W2182228627 creator A5028254889 @default.
• W2182228627 creator A5035130557 @default.
• W2182228627 creator A5053295842 @default.
• W2182228627 creator A5059638044 @default.
• W2182228627 creator A5064162634 @default.
• W2182228627 creator A5073574165 @default.
• W2182228627 creator A5080872282 @default.
• W2182228627 creator A5083697340 @default.
• W2182228627 date "2015-12-01" @default.
• W2182228627 modified "2023-10-17" @default.
• W2182228627 title "Formation of a Ternary Complex for Selenocysteine Biosynthesis in Bacteria" @default.
• W2182228627 cites W1610318839 @default.
• W2182228627 cites W1966386635 @default.
• W2182228627 cites W1976619439 @default.
• W2182228627 cites W1987205935 @default.
• W2182228627 cites W2008077687 @default.
• W2182228627 cites W2016790691 @default.
• W2182228627 cites W2021607498 @default.
• W2182228627 cites W2025354840 @default.
• W2182228627 cites W2034938962 @default.
• W2182228627 cites W2037312364 @default.
• W2182228627 cites W2038088153 @default.
• W2182228627 cites W2046764993 @default.
• W2182228627 cites W2048748155 @default.
• W2182228627 cites W2054200056 @default.
• W2182228627 cites W2057637468 @default.
• W2182228627 cites W2062102053 @default.
• W2182228627 cites W2068263619 @default.
• W2182228627 cites W2088995803 @default.
• W2182228627 cites W2091584330 @default.
• W2182228627 cites W2094305716 @default.
• W2182228627 cites W2099089793 @default.
• W2182228627 cites W2141947101 @default.
• W2182228627 cites W2142529984 @default.
• W2182228627 cites W2142664783 @default.
• W2182228627 cites W2153890737 @default.
• W2182228627 cites W2160884598 @default.
• W2182228627 cites W4245543343 @default.
• W2182228627 cites W84215808 @default.
• W2182228627 doi "https://doi.org/10.1074/jbc.m114.613406" @default.
• W2182228627 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/4705924" @default.
• W2182228627 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/26378233" @default.
• W2182228627 hasPublicationYear "2015" @default.
• W2182228627 type Work @default.
• W2182228627 sameAs 2182228627 @default.
• W2182228627 citedByCount "18" @default.
• W2182228627 countsByYear W21822286272016 @default.
• W2182228627 countsByYear W21822286272017 @default.
• W2182228627 countsByYear W21822286272018 @default.
• W2182228627 countsByYear W21822286272020 @default.
• W2182228627 countsByYear W21822286272021 @default.
• W2182228627 crossrefType "journal-article" @default.
• W2182228627 hasAuthorship W2182228627A5012877871 @default.
• W2182228627 hasAuthorship W2182228627A5021158593 @default.
• W2182228627 hasAuthorship W2182228627A5028254889 @default.
• W2182228627 hasAuthorship W2182228627A5035130557 @default.
• W2182228627 hasAuthorship W2182228627A5053295842 @default.
• W2182228627 hasAuthorship W2182228627A5059638044 @default.
• W2182228627 hasAuthorship W2182228627A5064162634 @default.
• W2182228627 hasAuthorship W2182228627A5073574165 @default.
• W2182228627 hasAuthorship W2182228627A5080872282 @default.
• W2182228627 hasAuthorship W2182228627A5083697340 @default.
• W2182228627 hasBestOaLocation W21822286271 @default.
• W2182228627 hasConcept C104317684 @default.
• W2182228627 hasConcept C181199279 @default.
• W2182228627 hasConcept C185592680 @default.
• W2182228627 hasConcept C2776087148 @default.
• W2182228627 hasConcept C2779201268 @default.
• W2182228627 hasConcept C523546767 @default.
• W2182228627 hasConcept C54355233 @default.
• W2182228627 hasConcept C553450214 @default.
• W2182228627 hasConcept C55493867 @default.
• W2182228627 hasConcept C86756495 @default.
• W2182228627 hasConcept C86803240 @default.
• W2182228627 hasConceptScore W2182228627C104317684 @default.
• W2182228627 hasConceptScore W2182228627C181199279 @default.
• W2182228627 hasConceptScore W2182228627C185592680 @default.
• W2182228627 hasConceptScore W2182228627C2776087148 @default.
• W2182228627 hasConceptScore W2182228627C2779201268 @default.
• W2182228627 hasConceptScore W2182228627C523546767 @default.
• W2182228627 hasConceptScore W2182228627C54355233 @default.
• W2182228627 hasConceptScore W2182228627C553450214 @default.
• W2182228627 hasConceptScore W2182228627C55493867 @default.
• W2182228627 hasConceptScore W2182228627C86756495 @default.
• W2182228627 hasConceptScore W2182228627C86803240 @default.
• W2182228627 hasFunder F4320320997 @default.
• W2182228627 hasFunder F4320322025 @default.
• W2182228627 hasIssue "49" @default.
• W2182228627 hasLocation W21822286271 @default.
• W2182228627 hasLocation W21822286272 @default.
• W2182228627 hasLocation W21822286273 @default.
• W2182228627 hasOpenAccess W2182228627 @default.
• W2182228627 hasPrimaryLocation W21822286271 @default.
• W2182228627 hasRelatedWork W1581203443 @default.

• next