FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2231149464> ?p ?o ?g. }

• W2231149464 endingPage "25438" @default.
• W2231149464 startingPage "25427" @default.
• W2231149464 abstract "Contraction is crucial in maintaining the differentiated phenotype of myofibroblasts. Contraction is an energy-dependent mechanism that relies on the production of ATP by mitochondria and/or glycolysis. Although the role of mitochondrial biogenesis in the adaptive responses of skeletal muscle to exercise is well appreciated, mechanisms governing energetic adaptation of myofibroblasts are not well understood. Our study demonstrates induction of mitochondrial biogenesis and aerobic glycolysis in response to the differentiation-inducing factor transforming growth factor β1 (TGF-β1). This metabolic reprogramming is linked to the activation of the p38 mitogen-activated protein kinase (MAPK) pathway. Inhibition of p38 MAPK decreased accumulation of active peroxisome proliferator-activated receptor γ coactivator 1α in the nucleus and altered the translocation of mitochondrial transcription factor A to the mitochondria. Genetic or pharmacologic approaches that block mitochondrial biogenesis or glycolysis resulted in decreased contraction and reduced expression of TGF-β1-induced α-smooth muscle actin and collagen α-2(I) but not of fibronectin or collagen α-1(I). These data indicate a critical role for TGF-β1-induced metabolic reprogramming in regulating myofibroblast-specific contractile signaling and support the concept of integrating bioenergetics with cellular differentiation. Contraction is crucial in maintaining the differentiated phenotype of myofibroblasts. Contraction is an energy-dependent mechanism that relies on the production of ATP by mitochondria and/or glycolysis. Although the role of mitochondrial biogenesis in the adaptive responses of skeletal muscle to exercise is well appreciated, mechanisms governing energetic adaptation of myofibroblasts are not well understood. Our study demonstrates induction of mitochondrial biogenesis and aerobic glycolysis in response to the differentiation-inducing factor transforming growth factor β1 (TGF-β1). This metabolic reprogramming is linked to the activation of the p38 mitogen-activated protein kinase (MAPK) pathway. Inhibition of p38 MAPK decreased accumulation of active peroxisome proliferator-activated receptor γ coactivator 1α in the nucleus and altered the translocation of mitochondrial transcription factor A to the mitochondria. Genetic or pharmacologic approaches that block mitochondrial biogenesis or glycolysis resulted in decreased contraction and reduced expression of TGF-β1-induced α-smooth muscle actin and collagen α-2(I) but not of fibronectin or collagen α-1(I). These data indicate a critical role for TGF-β1-induced metabolic reprogramming in regulating myofibroblast-specific contractile signaling and support the concept of integrating bioenergetics with cellular differentiation. Myofibroblasts are key effectors of normal wound healing, and their persistence contributes to the pathogenesis of fibrosis and cancer (1Duffield J.S. Lupher M. Thannickal V.J. Wynn T.A. Host responses in tissue repair and fibrosis.Annu. Rev. Pathol. 2013; 8: 241-276Crossref PubMed Scopus (420) Google Scholar, 2Radisky D.C. Kenny P.A. Bissell M.J. Fibrosis and cancer: do myofibroblasts come also from epithelial cells via EMT?.J. Cell Biochem. 2007; 101: 830-839Crossref PubMed Scopus (281) Google Scholar). The myofibroblast is the primary cell that secretes provisional extracellular matrix proteins and contracts wound margins to facilitate re-epithelialization. Transforming growth factor β-1 (TGF-β1) is the prototypical repair cytokine that induces the expression of cytoskeletal proteins such as α-smooth muscle actin (α-SMA) 2The abbreviations used are: α-SMAα-smooth muscle actinColcollagenPGC-1αperoxisome proliferator-activated receptor γ coactivator 1αTFAMmitochondrial transcription factor AHKIIhexokinase IIVDACvoltage-dependent anion channelOCRoxygen consumption rateECARextracellular acidification rateNTnon-targetingFNfibronectin2-DG2-deoxy-d-glucose. and extracellular matrix proteins that are critical for its contractile/synthetic functions (3Thannickal V.J. Lee D.Y. White E.S. Cui Z. Larios J.M. Chacon R. Horowitz J.C. Day R.M. Thomas P.E. Myofibroblast differentiation by transforming growth factor-β1 is dependent on cell adhesion and integrin signaling via focal adhesion kinase.J. Biol. Chem. 2003; 278: 12384-12389Abstract Full Text Full Text PDF PubMed Scopus (490) Google Scholar); hence, α-SMA expression is used as a marker of myofibroblast differentiation (4Desmoulière A. Chaponnier C. Gabbiani G. Tissue repair, contraction, and the myofibroblast.Wound Repair Regen. 2005; 13: 7-12Crossref PubMed Scopus (710) Google Scholar) in association with the production of extracellular matrix components such as fibronectin and type I collagens (5Phan S.H. Fibroblast phenotypes in pulmonary fibrosis.Am. J. Respir. Cell Mol. Biol. 2003; 29: S87-S92PubMed Google Scholar, 6Leask A. Abraham D.J. TGF-β signaling and the fibrotic response.FASEB J. 2004; 18: 816-827Crossref PubMed Scopus (1962) Google Scholar). α-smooth muscle actin collagen peroxisome proliferator-activated receptor γ coactivator 1α mitochondrial transcription factor A hexokinase II voltage-dependent anion channel oxygen consumption rate extracellular acidification rate non-targeting fibronectin 2-deoxy-d-glucose. TGF-β1 signals via SMAD-dependent and -independent pathways including p38 MAPK, ERK, JNK, and c-Abl (7Derynck R. Zhang Y.E. Smad-dependent and Smad-independent pathways in TGF-β family signalling.Nature. 2003; 425: 577-584Crossref PubMed Scopus (4270) Google Scholar). In concert with TGF-β1-mediated myofibroblast differentiation, contraction of myofibroblasts maintains the differentiated state (8Arora P.D. Narani N. McCulloch C.A. The compliance of collagen gels regulates transforming growth factor-β induction of α-smooth muscle actin in fibroblasts.Am. J. Pathol. 1999; 154: 871-882Abstract Full Text Full Text PDF PubMed Scopus (392) Google Scholar, 9Zhou Y. Huang X. Hecker L. Kurundkar D. Kurundkar A. Liu H. Jin T.H. Desai L. Bernard K. Thannickal V.J. Inhibition of mechanosensitive signaling in myofibroblasts ameliorates experimental pulmonary fibrosis.J. Clin. Investig. 2013; 123: 1096-1108Crossref PubMed Scopus (308) Google Scholar). Indeed, it has been shown that force-induced polymerization of actin stress fibers promotes the translocation of the transcription factor MKL1 to the nucleus where it promotes the expression of α-SMA and collagen α-2(I) (col1A2) (9Zhou Y. Huang X. Hecker L. Kurundkar D. Kurundkar A. Liu H. Jin T.H. Desai L. Bernard K. Thannickal V.J. Inhibition of mechanosensitive signaling in myofibroblasts ameliorates experimental pulmonary fibrosis.J. Clin. Investig. 2013; 123: 1096-1108Crossref PubMed Scopus (308) Google Scholar, 10Sandbo N. Lau A. Kach J. Ngam C. Yau D. Dulin N.O. Delayed stress fiber formation mediates pulmonary myofibroblast differentiation in response to TGF-β.Am. J. Physiol. Lung Cell Mol. Physiol. 2011; 301: L656-L666Crossref PubMed Scopus (78) Google Scholar, 11Scharenberg M.A. Pippenger B.E. Sack R. Zingg D. Ferralli J. Schenk S. Martin I. Chiquet-Ehrismann R. TGF-β-induced differentiation into myofibroblasts involves specific regulation of two MKL1 isoforms.J. Cell Sci. 2014; 127: 1079-1091Crossref PubMed Scopus (72) Google Scholar). This positive feedback loop is important for tissue repair because it sustains myofibroblast differentiation after the acute phase of cytokine-mediated myofibroblast activation. Protein synthesis and contraction are highly energy-dependent processes that likely engage both oxidative phosphorylation and glycolysis. For example, the increased energetic demand encountered in the skeletal muscle cell during endurance training is achieved through an increase in mitochondrial mass (12Fitts R.H. Booth F.W. Winder W.W. Holloszy J.O. Skeletal muscle respiratory capacity, endurance, and glycogen utilization.Am. J. Physiol. 1975; 228: 1029-1033Crossref PubMed Scopus (159) Google Scholar, 13Davies K.J. Packer L. Brooks G.A. Biochemical adaptation of mitochondria, muscle, and whole-animal respiration to endurance training.Arch. Biochem. Biophys. 1981; 209: 539-554Crossref PubMed Scopus (330) Google Scholar, 14Gordon J.W. Rungi A.A. Inagaki H. Hood D.A. Effects of contractile activity on mitochondrial transcription factor A expression in skeletal muscle.J. Appl. Physiol. 2001; 90: 389-396Crossref PubMed Scopus (24) Google Scholar). Both the renewal of damaged mitochondria and increase in mitochondrial mass rely on the stimulation of mitochondrial biogenesis (15Terman A. Kurz T. Navratil M. Arriaga E.A. Brunk U.T. Mitochondrial turnover and aging of long-lived postmitotic cells: the mitochondrial-lysosomal axis theory of aging.Antioxid. Redox Signal. 2010; 12: 503-535Crossref PubMed Scopus (358) Google Scholar). Mitochondrial biogenesis is controlled by the metabolic status of cells and/or external stimuli such as hormones. PGC-1α is a co-activator of transcription that promotes the expression of nuclearly encoded mitochondrial genes involved in mitochondrial biogenesis and/or function (16Wu Z. Puigserver P. Andersson U. Zhang C. Adelmant G. Mootha V. Troy A. Cinti S. Lowell B. Scarpulla R.C. Spiegelman B.M. Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1.Cell. 1999; 98: 115-124Abstract Full Text Full Text PDF PubMed Scopus (3176) Google Scholar). PGC-1α mediates its action on gene expression by binding to NRF-1 and/or NRF-2 upon its phosphorylation (17Scarpulla R.C. Metabolic control of mitochondrial biogenesis through the PGC-1 family regulatory network.Biochim. Biophys. Acta. 2011; 1813: 1269-1278Crossref PubMed Scopus (845) Google Scholar, 18Andersson U. Scarpulla R.C. Pgc-1-related coactivator, a novel, serum-inducible coactivator of nuclear respiratory factor 1-dependent transcription in mammalian cells.Mol. Cell. Biol. 2001; 21: 3738-3749Crossref PubMed Scopus (297) Google Scholar). The activity of PGC-1α is tightly regulated at both the transcriptional and post-translational levels (19Amat R. Planavila A. Chen S.L. Iglesias R. Giralt M. Villarroya F. SIRT1 controls the transcription of the peroxisome proliferator-activated receptor-γ co-activator-1α (PGC-1α) gene in skeletal muscle through the PGC-1α autoregulatory loop and interaction with MyoD.J. Biol. Chem. 2009; 284: 21872-21880Abstract Full Text Full Text PDF PubMed Scopus (168) Google Scholar, 20Fu M.H. Maher A.C. Hamadeh M.J. Ye C. Tarnopolsky M.A. Exercise, sex, menstrual cycle phase, and 17β-estradiol influence metabolism-related genes in human skeletal muscle.Physiol. Genomics. 2009; 40: 34-47Crossref PubMed Scopus (58) Google Scholar, 21Potthoff M.J. Inagaki T. Satapati S. Ding X. He T. Goetz R. Mohammadi M. Finck B.N. Mangelsdorf D.J. Kliewer S.A. Burgess S.C. FGF21 induces PGC-1α and regulates carbohydrate and fatty acid metabolism during the adaptive starvation response.Proc. Natl. Acad. Sci. U.S.A. 2009; 106: 10853-10858Crossref PubMed Scopus (535) Google Scholar, 22Nemoto S. Fergusson M.M. Finkel T. SIRT1 functionally interacts with the metabolic regulator and transcriptional coactivator PGC-1α.J. Biol. Chem. 2005; 280: 16456-16460Abstract Full Text Full Text PDF PubMed Scopus (840) Google Scholar, 23Rodgers J.T. Lerin C. Haas W. Gygi S.P. Spiegelman B.M. Puigserver P. Nutrient control of glucose homeostasis through a complex of PGC-1α and SIRT1.Nature. 2005; 434: 113-118Crossref PubMed Scopus (2563) Google Scholar, 24Lerin C. Rodgers J.T. Kalume D.E. Kim S.H. Pandey A. Puigserver P. GCN5 acetyltransferase complex controls glucose metabolism through transcriptional repression of PGC-1α.Cell Metab. 2006; 3: 429-438Abstract Full Text Full Text PDF PubMed Scopus (351) Google Scholar). PGC-1α contains multiple phosphorylation sites that are targets of different signaling pathways, thus conferring to PGC-1α its role as a signaling integrator (25Li X. Monks B. Ge Q. Birnbaum M.J. Akt/PKB regulates hepatic metabolism by directly inhibiting PGC-1α transcription coactivator.Nature. 2007; 447: 1012-1016Crossref PubMed Scopus (375) Google Scholar, 26Jäger S. Handschin C. St-Pierre J. Spiegelman B.M. AMP-activated protein kinase (AMPK) action in skeletal muscle via direct phosphorylation of PGC-1α.Proc. Natl. Acad. Sci. U.S.A. 2007; 104: 12017-12022Crossref PubMed Scopus (1806) Google Scholar). Mitochondrial transcription factor A (TFAM) is a downstream target gene of PGC-1α (27Larsson N.G. Oldfors A. Holme E. Clayton D.A. Low levels of mitochondrial transcription factor A in mitochondrial DNA depletion.Biochem. Biophys. Res. Commun. 1994; 200: 1374-1381Crossref PubMed Scopus (200) Google Scholar, 28Dong X. Ghoshal K. Majumder S. Yadav S.P. Jacob S.T. Mitochondrial transcription factor A and its downstream targets are up-regulated in a rat hepatoma.J. Biol. Chem. 2002; 277: 43309-43318Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar). TFAM controls the transcription of mitochondrial DNA-encoded genes as well as DNA replication during biogenesis (27Larsson N.G. Oldfors A. Holme E. Clayton D.A. Low levels of mitochondrial transcription factor A in mitochondrial DNA depletion.Biochem. Biophys. Res. Commun. 1994; 200: 1374-1381Crossref PubMed Scopus (200) Google Scholar). TFAM is synthesized as a 29-kDa precursor in the cytoplasm. Upon its import into the mitochondrion, TFAM is cleaved into a shorter polypeptide (25 kDa) to be activated (28Dong X. Ghoshal K. Majumder S. Yadav S.P. Jacob S.T. Mitochondrial transcription factor A and its downstream targets are up-regulated in a rat hepatoma.J. Biol. Chem. 2002; 277: 43309-43318Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar, 29Parisi M.A. Xu B. Clayton D.A. A human mitochondrial transcriptional activator can functionally replace a yeast mitochondrial HMG-box protein both in vivo and in vitro.Mol. Cell. Biol. 1993; 13: 1951-1961Crossref PubMed Scopus (162) Google Scholar, 30Kang D. Kim S.H. Hamasaki N. Mitochondrial transcription factor A (TFAM): roles in maintenance of mtDNA and cellular functions.Mitochondrion. 2007; 7: 39-44Crossref PubMed Scopus (295) Google Scholar, 31Parisi M.A. Clayton D.A. Similarity of human mitochondrial transcription factor 1 to high mobility group proteins.Science. 1991; 252: 965-969Crossref PubMed Scopus (440) Google Scholar). Glycolysis is an alternate pathway to oxidative phosphorylation for ATP production. It converts glucose into pyruvate via a series of enzymatic activities located in the cytosol. Despite its relative inefficiency in producing ATP compared with oxidative phosphorylation (32Erecińska M. Wilson D.F. On the mechanism of regulation of cellular respiration. The dependence of respiration on the cytosolic [ATP],[ADP] and [PI].Adv. Exp. Med. Biol. 1977; 94: 271-278Crossref PubMed Google Scholar, 33Piomboni P. Focarelli R. Stendardi A. Ferramosca A. Zara V. The role of mitochondria in energy production for human sperm motility.Int. J. Androl. 2012; 35: 109-124Crossref PubMed Scopus (266) Google Scholar), glycolysis can respond rapidly to provide both ATP and other metabolites necessary for energetically demanding processes (34Brooks G.A. Cell-cell and intracellular lactate shuttles.J. Physiol. 2009; 587: 5591-5600Crossref PubMed Scopus (474) Google Scholar, 35Vaishnavi S.N. Vlassenko A.G. Rundle M.M. Snyder A.Z. Mintun M.A. Raichle M.E. Regional aerobic glycolysis in the human brain.Proc. Natl. Acad. Sci. U.S.A. 2010; 107: 17757-17762Crossref PubMed Scopus (414) Google Scholar, 36Zheng J. Energy metabolism of cancer: glycolysis versus oxidative phosphorylation (review).Oncol. Lett. 2012; 4: 1151-1157Crossref PubMed Scopus (534) Google Scholar). Indeed, in response to increased energy demand, the stimulation of both oxidative phosphorylation and aerobic glycolysis is now emerging as a characteristic of many cells including those of the immune system and platelets (37Loos J.A. Roos D. Changes in the carbohydrate metabolism of mitogenically stimulated human peripheral lymphocytes. 3. Stimulation by tuberculin and allogeneic cells.Exp. Eye Res. 1973; 79: 136-142PubMed Google Scholar, 38Guppy M. Greiner E. Brand K. The role of the Crabtree effect and an endogenous fuel in the energy metabolism of resting and proliferating thymocytes.Eur. J. Biochem. 1993; 212: 95-99Crossref PubMed Scopus (170) Google Scholar, 39Frauwirth K.A. Riley J.L. Harris M.H. Parry R.V. Rathmell J.C. Plas D.R. Elstrom R.L. June C.H. Thompson C.B. The CD28 signaling pathway regulates glucose metabolism.Immunity. 2002; 16: 769-777Abstract Full Text Full Text PDF PubMed Scopus (1006) Google Scholar, 40Ravi S. Chacko B. Sawada H. Kramer P.A. Johnson M.S. Benavides G.A. O'Donnell V. Marques M.B. Darley-Usmar V.M. Metabolic plasticity in resting and thrombin activated platelets.PLoS One. 2015; 10e0123597Crossref PubMed Scopus (68) Google Scholar). In this study, we present evidence, for the first time, that TGF-β1 induces metabolic reprogramming via the stimulation of mitochondrial biogenesis and glycolysis in human lung fibroblasts in parallel with induction of profibrotic gene expression (41Negmadjanov U. Godic Z. Rizvi F. Emelyanova L. Ross G. Richards J. Holmuhamedov E.L. Jahangir A. TGF-β1-mediated differentiation of fibroblasts is associated with increased mitochondrial content and cellular respiration.PLoS One. 2015; 10e0123046Crossref PubMed Scopus (59) Google Scholar). We show that both TGF-β1-induced mitochondrial biogenesis and glycolysis are required for the expression of α-SMA and Col1A2 via energy-dependent contractile activity that is dependent on p38 MAPK. Our study supports the essential role for the integration of cellular bioenergetics with gene expression to sustain the differentiated phenotype of myofibroblasts. Porcine platelet-derived TGF-β1 was purchased from R&D Systems (Minneapolis, MN), protease inhibitor mixture set III was from EMD Chemicals (San Diego, CA), p38 MAPK inhibitor SB202190 was from Tocris Bioscience (Minneapolis, MN), and MitoTracker® was from Life Technologies. We purchased antibodies to β-actin (clone AC-15), fibronectin (clone IST-4), and α-tubulin (clone B-5-1-2) from Sigma; α-SMA (clone ASM-1) from American Research Products (Belmont, MA); TFAM, total PGC-1α, hexokinase II (HKII), total MLC20, phospho-MLC20, GAPDH, VDAC, p38 MAPK from Cell Signaling Technology (Boston, MA); TOM20 and lamin A/C from Santa Cruz Biotechnology (Dallas, TX); and phospho-PGC-1α from R&D Systems. All other reagents were purchased from Sigma unless otherwise specified. Human fetal lung fibroblasts (IMR-90 cells) at low population doubling (PDL 7) were purchased from Coriell Cell Repositories (Camden, NJ). All cells were cultured in DMEM (Life Technologies) supplemented with 10% fetal calf serum (HyClone Laboratories, Logan, UT), 100 units/ml penicillin, 100 μg/ml streptomycin, and 1.25 μg/ml amphotericin B at 37 °C in 5% CO2, 95% air. Cells treated with TGF-β1 were cultured in serum-free medium for 24 h prior to and during treatment. We prepared cell lysates in radioimmune precipitation assay buffer (150 mm NaCl, 1.0% IGEPAL® CA-630, 0.5% sodium deoxycholate, 0.1% SDS, 50 mm Tris, pH 8.0; Sigma-Aldrich), and cytosolic and nuclear lysates were prepared using the Pierce NE-PER kit according to the manufacturer's recommendations. Mitochondria were isolated using the Mitochondria Isolation kit for mammalian cells (Thermo Scientific). The total protein concentration of lysates was quantitated using a Micro BCA Protein Assay kit (Pierce) or the DC Protein Assay kit (Bio-Rad). Lysates were then subjected to SDS-PAGE under reducing conditions, and Western immunoblotting was performed as described previously (3Thannickal V.J. Lee D.Y. White E.S. Cui Z. Larios J.M. Chacon R. Horowitz J.C. Day R.M. Thomas P.E. Myofibroblast differentiation by transforming growth factor-β1 is dependent on cell adhesion and integrin signaling via focal adhesion kinase.J. Biol. Chem. 2003; 278: 12384-12389Abstract Full Text Full Text PDF PubMed Scopus (490) Google Scholar). Immunoblots were imaged using an Amersham Biosciences 600 Imager (GE Healthcare). Signals were quantitated using ImageQuant TL software. The ratio of mitochondrial to nuclear DNA was assessed using the Human Mitochondrial DNA Monitoring Primer Set Ratio kit (Takara Bio, Mountain View, CA). Total RNA was isolated from cells using the RNeasy® Mini kit (Qiagen, Valencia, CA) and reverse transcribed using iScript Reverse Transcription SuperMix for RT-quantitative PCR (Bio-Rad). Real time PCRs were performed using SYBR® Green PCR Master Mix (Life Technologies) and gene-specific primer pairs for collagen 1A1, collagen 1A2, fibronectin, α-SMA, TFAM, and 18S rRNA (for primer sequences, see Table 1). Reactions were carried out for 40 cycles (95 °C for 15 s and 60 °C for 1 min) in a StepOnePlus Real Time PCR System (Life Technologies). Real time PCR data are expressed for each target gene as 2−ΔΔCt versus endogenous 18S rRNA with error bars representing the standard error of the mean for three experiments. Two-tailed Student's t tests were used for pairwise comparisons.TABLE 1Primer sequencesGene, accession numberPrimer sequence (5′–3′)Product sizebpCol1A1, NM_000088.3Forward, CGAAGACATCCCACCAATCACCT129Reverse, AGATCACGTCATCGCACAACACCTFN (all variants)Forward, TCCACAAGCGTCATGAAGAG104Reverse, CTCTGAATCCTGGCATTGGTα-SMA, NM_001498Forward, TCCTCATCCTCCCTTGAGAA107Reverse, ATGAAGGATGGCTGGAACAGTFAM, NM_003201.2Forward, CATCTGTCTTGGCAAGTTGTCC194Reverse, CCACTCCGCCCTATAAGCATC18S rRNA, NR_003286.2Forward, GTCTGCCCTATCAACTTTCG111Reverse, ATGTGGTAGCCGTTTCTCAGCol1A2, NM_000089.3Forward, GGTTACGATGGAGACTTCTACAGG127Reverse, CAGGAGTAAGAAGGGTCTCAATCTG Open table in a new tab A plasmid encoding a dominant negative form of p38 MAPK (pCMV-p38DN) was transfected into IMR-90 cells using Lipofectamine 2000 (Life Technologies) according to the manufacturer's instructions (1:2 ratio of DNA (in μg) to Lipofectamine 2000 (in μl)). IMR-90 cells were incubated overnight in DNA-lipid complexes, and then cells were allowed to recover for 24 h in DMEM containing 10% FBS prior to serum starvation and TGF-β1 treatment. siRNA targeting TFAM as well as non-targeting control (Life Technologies; for siRNA sequences, see Table 2) was transfected into lung fibroblasts using Lipofectamine RNAiMAX (Life Technologies) at a final concentration of 100 nm.TABLE 2siRNA sequencesGene, accession numbersiRNA sequence (5′–3′)TFAM, NM_015760Sense, GCGUUGGAGGGAACUUCCUGAUUCAAntisense, UGAAUCAGGAAGUUCCCUCCAACGC Open table in a new tab Cells were plated on Seahorse Extracellular Analyzer XF96 plates. Cells were washed in XF assay buffer (DMEM with 1 mm pyruvate, 5.5 mm d-glucose, 4 mm l-glutamine, pH 7.4) and brought to 180-μl final volume in this assay medium. Bioenergetic measurements were interpreted and performed as described (42Dranka B.P. Benavides G.A. Diers A.R. Giordano S. Zelickson B.R. Reily C. Zou L. Chatham J.C. Hill B.G. Zhang J. Landar A. Darley-Usmar V.M. Assessing bioenergetic function in response to oxidative stress by metabolic profiling.Free Radic. Biol. Med. 2011; 51: 1621-1635Crossref PubMed Scopus (313) Google Scholar). In short, the basal oxygen consumption rate (OCR) was measured for 24 min after which oligomycin (1 μg/ml), carbonyl cyanide p-trifluoromethoxyphenylhydrazone (0.6 μm), and antimycin A (10 μm) were injected sequentially. The extracellular acidification rate (ECAR) was measured simultaneously. This assay was performed on the Extracellular Analyzer as adapted from Salabei et al. (43Salabei J.K. Gibb A.A. Hill B.G. Comprehensive measurement of respiratory activity in permeabilized cells using extracellular flux analysis.Nat. Protoc. 2014; 9: 421-438Crossref PubMed Scopus (208) Google Scholar). In short, cells were washed and brought to 180-μl final volume in mannitol and sucrose (MAS) buffer (70 mm sucrose, 220 mm mannitol, 10 mm KH2PO4, 5 mm MgCl2, 2 mm HEPES, 1 mm EGTA, pH 7.2). After three basal measurements were acquired, saponin (30 μg/ml) together with pyruvate (5 mm), malate (2.5 mm), and ADP (1 mm) were injected. Sequentially rotenone (1 μm), succinate (10 mm), ADP (1 mm), and then antimycin A (10 μm) were injected. After cell harvesting, lung fibroblasts were mixed at a density of 2·105 cells/ml in a solution composed of 8 volumes of rat tail collagen type I (BD Biosciences), 1 volume of 10× Ham's F-12 (Life Technologies), and 1 volume of reconstitution buffer (2% NaHCO3, 4.77% HEPES). The solution was poured into a 24-well plate (0.5 ml/well), and gelation was performed at 37 °C for 30 min. Gels were then overlaid with 1.5 ml of 1% serum-containing cell culture medium. The next day gels were treated with or without TGF-β1. Statistical analysis was performed using GraphPad software. The data are presented as mean ± S.E. Statistical comparisons were made by performing unpaired Student's t tests unless otherwise indicated. To determine potential changes in cellular bioenergetics in TGF-β1-differentiated myofibroblasts, we analyzed OCRs and ECARs of normal human diploid lung fibroblasts (IMR-90) treated without or with TGF-β1 (2.5 ng/ml for 48 h) (3Thannickal V.J. Lee D.Y. White E.S. Cui Z. Larios J.M. Chacon R. Horowitz J.C. Day R.M. Thomas P.E. Myofibroblast differentiation by transforming growth factor-β1 is dependent on cell adhesion and integrin signaling via focal adhesion kinase.J. Biol. Chem. 2003; 278: 12384-12389Abstract Full Text Full Text PDF PubMed Scopus (490) Google Scholar). TGF-β1 enhanced overall bioenergetics with a marked increase in basal OCR, ATP-linked respiration, maximal and reserve capacity, proton leak, and non-mitochondrial OCR (Fig. 1, A and C). Furthermore, TGF-β1 also increased ECAR from 16 ± 0.23 milli-pH units/min/10,000 cells in the unstimulated state to 30 ± 0.55 milli-pH units/min/10,000 cells in the TGF-β1-stimulated state (Fig. 1B). Interestingly, when mitochondrial ATP production was inhibited with oligomycin, the increase in ECAR was 63% higher in the TGF-β1-treated cells compared with the control, consistent with a greater capacity for glycolysis (Fig. 1B). Plotting OCR as a function of ECAR showed TGF-β1-induced metabolic reprogramming with induction of mitochondrial respiration and glycolysis resulting in a condition of aerobic glycolysis (Fig. 1D). The increase in mitochondrial respiration could be due to an increase either in mitochondrial mass or in substrate supply to the electron transport chain. To delineate the mechanism of this increase in mitochondrial respiration, the functioning of complex I or II was measured using a mitochondrial assay where the plasma membrane of fibroblasts was permeabilized and exogenous respiratory substrates were delivered to the electron transport chain. In this assay, after basal OCR was measured, saponin, ADP, succinate (complex II-linked substrate), pyruvate, and malate (complex I-linked substrate) were injected to stimulate respiration (Fig. 1E). Next, rotenone was injected to quantify complex I-linked respiration followed by antimycin A to measure complex II-linked respiration. TGF-β1 induced a small, but significant, increase in complex I-linked respiration without a significant change in complex II-linked OCR at 48 h after treatment (Fig. 1E). Next, we determined whether TGF-β1-induced mitochondrial biogenesis is associated with alterations in mitochondrial distribution and abundance. Staining of the mitochondrial compartment (with the fluorescent dye MitoTracker) demonstrated that the mitochondrial population was relatively homogeneous and mainly localized to the perinuclear region in unstimulated cells; in contrast, there was an apparent increase in mitochondrial abundance with a more diffuse cytoplasmic staining in TGF-β1-differentiated myofibroblasts (Fig. 2A). To determine whether these apparent changes in mitochondrial abundance are linked to mitochondrial biogenesis, we analyzed the effect of TGF-β1 on the expression of mitochondrial biogenesis markers. TGF-β1 induced a time-dependent increase in phosphorylated PGC-1α, a transcriptional co-activator that regulates nuclearly encoded mitochondrial genes (16Wu Z. Puigserver P. Andersson U. Zhang C. Adelmant G. Mootha V. Troy A. Cinti S. Lowell B. Scarpulla R.C. Spiegelman B.M. Mechanisms controlling mitochondrial biogenesis and respiration through the thermogenic coactivator PGC-1.Cell. 1999; 98: 115-124Abstract Full Text Full Text PDF PubMed Scopus (3176) Google Scholar) (Fig. 2B). Phosphorylation of PGC-1α occurred as early as 15 min after exposure to TGF-β1. Phosphorylation of PGC-1α was increased by 9.71-fold (n = 4, p < 0.05) compared with baseline following 48-h treatment with TGF-β1. VDAC resides in the outer membrane of the mitochondria where it participates in metabolism and, under conditions of stress, in the formation of the mitochondrial permeability transition pore (44Baines C.P. Kaiser R.A. Sheiko T. Craigen W.J. Molkentin J.D. Voltage-dependent anion channels are dispensable for mitochondrial-dependent cell death.Nat. Cell Biol. 2007; 9: 550-555Crossref PubMed Scopus (772) Google Scholar, 45Gellerich F.N. Wagner M. Kapischke M. Wicker U. Brdiczka D. Effect of macromolecules on the regulation of the mitochondrial outer membrane pore and the activity of adenylate kinase in the inter-membrane space.Biochim. Biophys. Acta. 1993; 1142: 217-227Crossref PubMed Scopus (55) Google Scholar, 46Hodge T. Colombini M. Regulation of metabolite flux through voltage-gating of VDAC channels.J. Membr. Biol. 1997; 157: 271-279Crossref PubMed Scopus (224) Google Scholar, 47Vander Heiden M.G. Chandel N.S. Li X.X. Schumacker P.T. Colombini M. Thompson C.B. Outer mitochondrial membrane permeability can regulate coupled respiration and cell survival.Proc. Natl. Acad. Sci" @default.
• W2231149464 created "2016-06-24" @default.
• W2231149464 creator A5028568020 @default.
• W2231149464 creator A5035915835 @default.
• W2231149464 creator A5035960627 @default.
• W2231149464 creator A5038836699 @default.
• W2231149464 creator A5040812011 @default.
• W2231149464 creator A5041032763 @default.
• W2231149464 creator A5062506120 @default.
• W2231149464 creator A5063627071 @default.
• W2231149464 creator A5069929604 @default.
• W2231149464 creator A5081550304 @default.
• W2231149464 creator A5090740656 @default.
• W2231149464 date "2015-10-01" @default.
• W2231149464 modified "2023-10-12" @default.
• W2231149464 title "Metabolic Reprogramming Is Required for Myofibroblast Contractility and Differentiation" @default.
• W2231149464 cites W1505584712 @default.
• W2231149464 cites W1616394907 @default.
• W2231149464 cites W1791035026 @default.
• W2231149464 cites W1903750968 @default.
• W2231149464 cites W1930630118 @default.
• W2231149464 cites W1965916788 @default.
• W2231149464 cites W1966760994 @default.
• W2231149464 cites W1968477506 @default.
• W2231149464 cites W1971082641 @default.
• W2231149464 cites W1972788770 @default.
• W2231149464 cites W1977413052 @default.
• W2231149464 cites W1977815598 @default.
• W2231149464 cites W1980404619 @default.
• W2231149464 cites W1982158297 @default.
• W2231149464 cites W1982810858 @default.
• W2231149464 cites W1985348238 @default.
• W2231149464 cites W1990416017 @default.
• W2231149464 cites W1993235686 @default.
• W2231149464 cites W1993987541 @default.
• W2231149464 cites W1994981454 @default.
• W2231149464 cites W2004107033 @default.
• W2231149464 cites W2007691559 @default.
• W2231149464 cites W2008710537 @default.
• W2231149464 cites W2011951281 @default.
• W2231149464 cites W2015497307 @default.
• W2231149464 cites W2016193552 @default.
• W2231149464 cites W2017946623 @default.
• W2231149464 cites W2019789560 @default.
• W2231149464 cites W2026198465 @default.
• W2231149464 cites W2028339345 @default.
• W2231149464 cites W2035653659 @default.
• W2231149464 cites W2036229829 @default.
• W2231149464 cites W2039552979 @default.
• W2231149464 cites W2046751492 @default.
• W2231149464 cites W2048549839 @default.
• W2231149464 cites W2050979875 @default.
• W2231149464 cites W2053512383 @default.
• W2231149464 cites W2053837765 @default.
• W2231149464 cites W2057257618 @default.
• W2231149464 cites W2057637682 @default.
• W2231149464 cites W2058768220 @default.
• W2231149464 cites W2062262478 @default.
• W2231149464 cites W2067322059 @default.
• W2231149464 cites W2067958598 @default.
• W2231149464 cites W2072742323 @default.
• W2231149464 cites W2073888506 @default.
• W2231149464 cites W2077645437 @default.
• W2231149464 cites W2079598623 @default.
• W2231149464 cites W2090038499 @default.
• W2231149464 cites W2095434093 @default.
• W2231149464 cites W2096007038 @default.
• W2231149464 cites W2098246822 @default.
• W2231149464 cites W2099486691 @default.
• W2231149464 cites W2118231442 @default.
• W2231149464 cites W2122808924 @default.
• W2231149464 cites W2123115740 @default.
• W2231149464 cites W2124612536 @default.
• W2231149464 cites W2138240713 @default.
• W2231149464 cites W2145968706 @default.
• W2231149464 cites W2149395040 @default.
• W2231149464 cites W2152101492 @default.
• W2231149464 cites W2155446034 @default.
• W2231149464 cites W2160694063 @default.
• W2231149464 cites W2161549180 @default.
• W2231149464 cites W2162406958 @default.
• W2231149464 cites W2171715833 @default.
• W2231149464 cites W2474050726 @default.
• W2231149464 doi "https://doi.org/10.1074/jbc.m115.646984" @default.
• W2231149464 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/4646190" @default.
• W2231149464 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/26318453" @default.
• W2231149464 hasPublicationYear "2015" @default.
• W2231149464 type Work @default.
• W2231149464 sameAs 2231149464 @default.
• W2231149464 citedByCount "133" @default.
• W2231149464 countsByYear W22311494642016 @default.
• W2231149464 countsByYear W22311494642017 @default.
• W2231149464 countsByYear W22311494642018 @default.
• W2231149464 countsByYear W22311494642019 @default.
• W2231149464 countsByYear W22311494642020 @default.
• W2231149464 countsByYear W22311494642021 @default.
• W2231149464 countsByYear W22311494642022 @default.
• W2231149464 countsByYear W22311494642023 @default.

• next