FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2232424200> ?p ?o ?g. }

• W2232424200 endingPage "2583" @default.
• W2232424200 startingPage "2583" @default.
• W2232424200 abstract "2583 Background: Cancer/testis (CTA) antigens expression is highly tissue-restricted, immunogenic in cancer patients, and are novel targets for cancer vaccine.These CTA are expressed in different tumors and normal testes, but not in other normal tissues. Transmembrane phosphatase with tensin homology (TPTE) is a novel, 2761 bp long CTA located on chromosome 21p11 and shares significant homology with tumor suppressor protein PTEN. Our study goals were to determine TPTE expression in epithelial ovarian carcinoma (EOC) and examine for correlation with clinical outcome. Methods: Frozen specimens were obtained from 100 patients with EOC treated between 1995 and 2003. Following isolation of total RNA, one-step reverse transcriptase PCR (RT-PCR) was performed on the EOC tissues, 8 cancer cell lines (IOSE, HOSE, OVCA-3, OV-2774, SKOV-6, OVCA-429 and SKOV-3) and 16 normal tissues. A 433 bp TPTE specific PCR product was amplified using TPTE specific sense 5’TTTATTCGATTCCTCGTTATGTACG3’ and antisense 5’ACATAATTCTTTCCCAGAAGGG3’ primers. Glyceraldehyde-3-phosphodehydrogenase specific PCR amplification was used a control. The χ2 test and Kaplan-Meier method were used for statistical analysis. Statistical significance was determined by the log-rank test. Results: TPTE was not expressed in any of the normal tissues (including brain, heart, kidney, spleen, lungs) but was expressed in 35 out of 100 (35%) EOC tissues. All cancer cell lines except SKOV-6 expressed TPTE. There were no significant relationships between stage, grade, histology and TPTE +ve and TPTE -ve patients.The median follow up for all patients was 32 months (range 0.5–119 months). Median survival in TPTE negative patients was 40 months (CI:32,48) versus 55 months (CI: 44,66) in TPTE positive patients (not significant). Conclusions: TPTE is expressed in a high proportion of EOC patients. Although there was no significant difference in overall survival in TPTE+ve and TPTE-ve patients, its lack of expression in normal tissues, homology to PTEN and its potential role in tumorigenesis makes TPTE an attractive target for antigen specific immunotherapy for EOC. We are evaluating immunogenicity of TPTE for development of polyvalent CTA vaccine therapy for EOC. No significant financial relationships to disclose." @default.
• W2232424200 created "2016-06-24" @default.
• W2232424200 creator A5001434487 @default.
• W2232424200 creator A5004522197 @default.
• W2232424200 creator A5009400324 @default.
• W2232424200 creator A5013098713 @default.
• W2232424200 creator A5045548671 @default.
• W2232424200 creator A5056321055 @default.
• W2232424200 creator A5058171676 @default.
• W2232424200 creator A5083223329 @default.
• W2232424200 creator A5089344430 @default.
• W2232424200 date "2005-06-01" @default.
• W2232424200 modified "2023-10-12" @default.
• W2232424200 title "TPTE “Cancer/Testis” antigen is a candidate target for immunotherapy in epithelial ovarian carcinoma" @default.
• W2232424200 doi "https://doi.org/10.1200/jco.2005.23.16_suppl.2583" @default.
• W2232424200 hasPublicationYear "2005" @default.
• W2232424200 type Work @default.
• W2232424200 sameAs 2232424200 @default.
• W2232424200 citedByCount "1" @default.
• W2232424200 crossrefType "journal-article" @default.
• W2232424200 hasAuthorship W2232424200A5001434487 @default.
• W2232424200 hasAuthorship W2232424200A5004522197 @default.
• W2232424200 hasAuthorship W2232424200A5009400324 @default.
• W2232424200 hasAuthorship W2232424200A5013098713 @default.
• W2232424200 hasAuthorship W2232424200A5045548671 @default.
• W2232424200 hasAuthorship W2232424200A5056321055 @default.
• W2232424200 hasAuthorship W2232424200A5058171676 @default.
• W2232424200 hasAuthorship W2232424200A5083223329 @default.
• W2232424200 hasAuthorship W2232424200A5089344430 @default.
• W2232424200 hasConcept C121608353 @default.
• W2232424200 hasConcept C126322002 @default.
• W2232424200 hasConcept C142724271 @default.
• W2232424200 hasConcept C147483822 @default.
• W2232424200 hasConcept C203014093 @default.
• W2232424200 hasConcept C2777421810 @default.
• W2232424200 hasConcept C2777546739 @default.
• W2232424200 hasConcept C2780427987 @default.
• W2232424200 hasConcept C502942594 @default.
• W2232424200 hasConcept C71924100 @default.
• W2232424200 hasConceptScore W2232424200C121608353 @default.
• W2232424200 hasConceptScore W2232424200C126322002 @default.
• W2232424200 hasConceptScore W2232424200C142724271 @default.
• W2232424200 hasConceptScore W2232424200C147483822 @default.
• W2232424200 hasConceptScore W2232424200C203014093 @default.
• W2232424200 hasConceptScore W2232424200C2777421810 @default.
• W2232424200 hasConceptScore W2232424200C2777546739 @default.
• W2232424200 hasConceptScore W2232424200C2780427987 @default.
• W2232424200 hasConceptScore W2232424200C502942594 @default.
• W2232424200 hasConceptScore W2232424200C71924100 @default.
• W2232424200 hasIssue "16_suppl" @default.
• W2232424200 hasLocation W22324242001 @default.
• W2232424200 hasOpenAccess W2232424200 @default.
• W2232424200 hasPrimaryLocation W22324242001 @default.
• W2232424200 hasRelatedWork W2014435840 @default.
• W2232424200 hasRelatedWork W2069482181 @default.
• W2232424200 hasRelatedWork W2171632125 @default.
• W2232424200 hasRelatedWork W2353260778 @default.
• W2232424200 hasRelatedWork W2365364931 @default.
• W2232424200 hasRelatedWork W2418638721 @default.
• W2232424200 hasRelatedWork W3003270674 @default.
• W2232424200 hasRelatedWork W3034140415 @default.
• W2232424200 hasRelatedWork W3167258268 @default.
• W2232424200 hasRelatedWork W35388512 @default.
• W2232424200 hasVolume "23" @default.
• W2232424200 isParatext "false" @default.
• W2232424200 isRetracted "false" @default.
• W2232424200 magId "2232424200" @default.
• W2232424200 workType "article" @default.