FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2285209545> ?p ?o ?g. }

• W2285209545 endingPage "9172" @default.
• W2285209545 startingPage "9161" @default.
• W2285209545 abstract "Ubiquitination is a post-translational modification that regulates most cellular pathways and processes, including degradation of proteins by the proteasome. Substrate ubiquitination is controlled at various stages, including through its reversal by deubiquitinases (DUBs). A critical outcome of this process is the recycling of monoubiquitin. One DUB whose function has been proposed to include monoubiquitin recycling is USP5. Here, we investigated whether Drosophila USP5 is important for maintaining monoubiquitin in vivo. We found that the fruit fly orthologue of USP5 has catalytic preferences similar to its human counterpart and that this DUB is necessary during fly development. Our biochemical and genetic experiments indicate that reduction of USP5 does not lead to monoubiquitin depletion in developing flies. Also, introduction of exogenous ubiquitin does not suppress developmental lethality caused by loss of endogenous USP5. Our work indicates that a primary physiological role of USP5 is not to recycle monoubiquitin for reutilization, but that it may involve disassembly of conjugated ubiquitin to maintain proteasome function. Ubiquitination is a post-translational modification that regulates most cellular pathways and processes, including degradation of proteins by the proteasome. Substrate ubiquitination is controlled at various stages, including through its reversal by deubiquitinases (DUBs). A critical outcome of this process is the recycling of monoubiquitin. One DUB whose function has been proposed to include monoubiquitin recycling is USP5. Here, we investigated whether Drosophila USP5 is important for maintaining monoubiquitin in vivo. We found that the fruit fly orthologue of USP5 has catalytic preferences similar to its human counterpart and that this DUB is necessary during fly development. Our biochemical and genetic experiments indicate that reduction of USP5 does not lead to monoubiquitin depletion in developing flies. Also, introduction of exogenous ubiquitin does not suppress developmental lethality caused by loss of endogenous USP5. Our work indicates that a primary physiological role of USP5 is not to recycle monoubiquitin for reutilization, but that it may involve disassembly of conjugated ubiquitin to maintain proteasome function. Ubiquitination is an important post-translational modification of numerous proteins in the cell, where it is involved in the regulation of various processes ranging from DNA transcription to protein degradation. Three different classes of enzymes are responsible for carrying out this modification: E1 (ubiquitin-activating enzymes), E2 (ubiquitin-conjugating enzymes), and E3 (ubiquitin ligases) (1.Pickart C.M. Ubiquitin in chains.Trends Biochem. Sci. 2000; 25: 544-548Abstract Full Text Full Text PDF PubMed Scopus (375) Google Scholar). Through the coordinated action of these proteins, a ubiquitin molecule is conjugated most commonly to a lysine residue of a substrate protein through an isopeptide bond. Because ubiquitin itself has seven lysine residues, which are available for isopeptide bond formation, and because ubiquitin moieties can also be connected “head to tail,” ubiquitin chains of different conformations are generated (2.Pickart C.M. Fushman D. Polyubiquitin chains: polymeric protein signals.Curr. Opin Chem. Biol. 2004; 8: 610-616Crossref PubMed Scopus (830) Google Scholar, 3.Ristic G. Tsou W.L. Todi S.V. An optimal ubiquitin-proteasome pathway in the nervous system: the role of deubiquitinating enzymes.Front Mol. Neurosci. 2014; 7: 72Crossref PubMed Scopus (60) Google Scholar). Different chains impart specific outcomes on the fate of the protein to which they are conjugated. For example, Lys48-linked ubiquitin targets proteins for proteasomal degradation, whereas Lys63-linked species have been associated with autophagy and other non-proteasomally dependent events (4.Thrower J.S. Hoffman L. Rechsteiner M. Pickart C.M. Recognition of the polyubiquitin proteolytic signal.EMBO J. 2000; 19: 94-102Crossref PubMed Scopus (1309) Google Scholar5.Hao R. Nanduri P. Rao Y. Panichelli R.S. Ito A. Yoshida M. Yao T.P. Proteasomes activate aggresome disassembly and clearance by producing unanchored ubiquitin chains.Mol. Cell. 2013; 51: 819-828Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar, 6.Nathan J.A. Kim H.T. Ting L. Gygi S.P. Goldberg A.L. Why do cellular proteins linked to K63-polyubiquitin chains not associate with proteasomes?.EMBO J. 2013; 32: 552-565Crossref PubMed Scopus (171) Google Scholar7.Komander D. Clague M.J. Urbé S. Breaking the chains: structure and function of the deubiquitinases.Nat. Rev. Mol. Cell Biol. 2009; 10: 550-563Crossref PubMed Scopus (1450) Google Scholar). Ubiquitination and ubiquitin recycling are tightly controlled to fine-tune the process, to bring a cellular event to an end, to regulate protein fate, and to recycle ubiquitin for reuse. The reversal of ubiquitination is carried out by a class of proteases known as deubiquitinating enzymes (DUBs). 2The abbreviations used are: DUBdeubiquitinating enzymeUSP5ubiquitin-specific protease 5DmUSP5D. melanogaster ubiquitin-specific protease 5CHIPC terminus of HSC70-interacting proteinqRTquantitative real time. DUBs are divided into five families, based on similarity in their catalytic domains: ubiquitin-specific proteases, ubiquitin C-terminal hydrolases, Machado-Joseph disease proteins, otubain proteases, and the JAB1/MPN/Mov34 metalloenzymes. Nearly 100 genes encoding DUBs have been identified in humans, but the functions of many of them remain to be discovered (3.Ristic G. Tsou W.L. Todi S.V. An optimal ubiquitin-proteasome pathway in the nervous system: the role of deubiquitinating enzymes.Front Mol. Neurosci. 2014; 7: 72Crossref PubMed Scopus (60) Google Scholar, 7.Komander D. Clague M.J. Urbé S. Breaking the chains: structure and function of the deubiquitinases.Nat. Rev. Mol. Cell Biol. 2009; 10: 550-563Crossref PubMed Scopus (1450) Google Scholar8.Todi S.V. Paulson H.L. Balancing act: deubiquitinating enzymes in the nervous system.Trends Neurosci. 2011; 34: 370-382Abstract Full Text Full Text PDF PubMed Scopus (108) Google Scholar, 9.Clague M.J. Coulson J.M. Urbé S. Cellular functions of the DUBs.J. Cell Sci. 2012; 125: 277-286Crossref PubMed Scopus (163) Google Scholar10.Clague M.J. Barsukov I. Coulson J.M. Liu H. Rigden D.J. Urbé S. Deubiquitylases from genes to organism.Physiol. Rev. 2013; 93: 1289-1315Crossref PubMed Scopus (313) Google Scholar). deubiquitinating enzyme ubiquitin-specific protease 5 D. melanogaster ubiquitin-specific protease 5 C terminus of HSC70-interacting protein quantitative real time. Ubiquitin-specific protease 5 (USP5, also known as isopeptidase T) is one DUB whose structural properties are well understood. USP5 is reportedly an exopeptidase that hydrolyzes isopeptide bonds in polyubiquitin from the free C-terminal end to produce monoubiquitin, which can then be reconjugated to substrate proteins (11.Wilkinson K.D. Tashayev V.L. O'Connor L.B. Larsen C.N. Kasperek E. Pickart C.M. Metabolism of the polyubiquitin degradation signal: structure, mechanism, and role of isopeptidase T.Biochemistry. 1995; 34: 14535-14546Crossref PubMed Scopus (261) Google Scholar, 12.Reyes-Turcu F.E. Horton J.R. Mullally J.E. Heroux A. Cheng X. Wilkinson K.D. The ubiquitin binding domain ZnF UBP recognizes the C-terminal diglycine motif of unanchored ubiquitin.Cell. 2006; 124: 1197-1208Abstract Full Text Full Text PDF PubMed Scopus (241) Google Scholar13.Reyes-Turcu F.E. Shanks J.R. Komander D. Wilkinson K.D. Recognition of polyubiquitin isoforms by the multiple ubiquitin binding modules of isopeptidase T.J. Biol. Chem. 2008; 283: 19581-19592Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar). Depletion of USP5 orthologues in yeast and in mammalian cells leads to accumulation of unanchored ubiquitin chains and causes proteasomal inhibition (14.Amerik A. Swaminathan S. Krantz B.A. Wilkinson K.D. Hochstrasser M. In vivo disassembly of free polyubiquitin chains by yeast Ubp14 modulates rates of protein degradation by the proteasome.EMBO J. 1997; 16: 4826-4838Crossref PubMed Scopus (198) Google Scholar). These and other findings place USP5 at the proteasome: before a protein is degraded by the proteasome, the ubiquitin chain signaling its degradation is removed en bloc by another DUB, RPN11/POH1, leaving unanchored polyubiquitin. USP5 processes this unanchored chain to yield monoubiquitin (3.Ristic G. Tsou W.L. Todi S.V. An optimal ubiquitin-proteasome pathway in the nervous system: the role of deubiquitinating enzymes.Front Mol. Neurosci. 2014; 7: 72Crossref PubMed Scopus (60) Google Scholar, 10.Clague M.J. Barsukov I. Coulson J.M. Liu H. Rigden D.J. Urbé S. Deubiquitylases from genes to organism.Physiol. Rev. 2013; 93: 1289-1315Crossref PubMed Scopus (313) Google Scholar). Thus, this DUB is thought of as a ubiquitin recycler, helping to maintain a monoubiquitin pool for reutilization (7.Komander D. Clague M.J. Urbé S. Breaking the chains: structure and function of the deubiquitinases.Nat. Rev. Mol. Cell Biol. 2009; 10: 550-563Crossref PubMed Scopus (1450) Google Scholar, 15.Grou C.P. Pinto M.P. Mendes A.V. Domingues P. Azevedo J.E. The de novo synthesis of ubiquitin: identification of deubiquitinases acting on ubiquitin precursors.Sci. Rep. 2015; 5: 12836Crossref PubMed Scopus (66) Google Scholar, 16.Kovács L. Nagy O. Pál M. Udvardy A. Popescu O. Deák P. Role of the deubiquitylating enzyme DmUsp5 in coupling ubiquitin equilibrium to development and apoptosis in Drosophila melanogaster.PLoS One. 2015; 10: e0120875Crossref PubMed Scopus (13) Google Scholar). Most ubiquitin is found in conjugated forms in various tissues tested, leaving only a small portion available in the unconjugated, monoubiquitin pool (16.Kovács L. Nagy O. Pál M. Udvardy A. Popescu O. Deák P. Role of the deubiquitylating enzyme DmUsp5 in coupling ubiquitin equilibrium to development and apoptosis in Drosophila melanogaster.PLoS One. 2015; 10: e0120875Crossref PubMed Scopus (13) Google Scholar, 17.Kaiser S.E. Riley B.E. Shaler T.A. Trevino R.S. Becker C.H. Schulman H. Kopito R.R. Protein standard absolute quantification (PSAQ) method for the measurement of cellular ubiquitin pools.Nat. Methods. 2011; 8: 691-696Crossref PubMed Scopus (166) Google Scholar18.Oh C. Yoon J.H. Park S. Yoo Y.J. Simultaneous quantification of total and conjugated ubiquitin levels in a single immunoblot.Anal. Biochem. 2013; 443: 153-155Crossref PubMed Scopus (4) Google Scholar). Because there is persistent demand for protein modification through ubiquitination, there is a constant need to generate monoubiquitin through recycling or through new synthesis via ubiquitin-encoding genes. It is not entirely clear whether a primary role for USP5 in vivo is monoubiquitin maintenance. Here, we tested this possibility in the fruit fly Drosophila melanogaster, whose USP5 is necessary during development (16.Kovács L. Nagy O. Pál M. Udvardy A. Popescu O. Deák P. Role of the deubiquitylating enzyme DmUsp5 in coupling ubiquitin equilibrium to development and apoptosis in Drosophila melanogaster.PLoS One. 2015; 10: e0120875Crossref PubMed Scopus (13) Google Scholar, 19.Tsou W.L. Sheedlo M.J. Morrow M.E. Blount J.R. McGregor K.M. Das C. Todi S.V. Systematic analysis of the physiological importance of deubiquitinating enzymes.PLoS One. 2012; 7: e43112Crossref PubMed Scopus (52) Google Scholar, 20.Wang C.H. Chen G.C. Chien C.T. The deubiquitinase Leon/USP5 regulates ubiquitin homeostasis during Drosophila development.Biochem. Biophys. Res. Commun. 2014; 452: 369-375Crossref PubMed Scopus (15) Google Scholar). Our biochemical and genetic experiments indicate that Drosophila USP5 is not necessary for maintaining a ready pool of monoubiquitin in vivo. RNAi-1 and RNAi-2 targeting USP5 were from the Vienna Drosophila RNAi Center (21.Dietzl G. Chen D. Schnorrer F. Su K.C. Barinova Y. Fellner M. Gasser B. Kinsey K. Oppel S. Scheiblauer S. Couto A. Marra V. Keleman K. Dickson B.J. A genome-wide transgenic RNAi library for conditional gene inactivation in Drosophila.Nature. 2007; 448: 151-156Crossref PubMed Scopus (1972) Google Scholar). These two fly lines contain the same targeting sequence inserted at different chromosomal sites. RNAi-3, the UAS-monoubiquitin overexpression line, and the Gal80ts line were from the Bloomington Drosophila Stock Center. The UAS-USP14 line was from FlyORF. The UAS-CL1-GFP line was a generous gift from Dr. Udai Pandey (University of Pittsburgh), the actin-Gal4 and the sqh-Gal4 lines were a generous gift from Dr. Daniel Eberl (University of Iowa), and the da-Gal4 line was generously donated by Dr. R. J. Wessells (Wayne State University). Flies were maintained at 25 °C and ∼40–60% humidity in regulated diurnal environments. Where noted in figures and legends, the flies were maintained at 18 and 30 °C, ∼40–60% humidity under diurnal cycle for Gal80 experiments. Fly lines are listed in Table 1.TABLE 1Drosophila linesStocksSourceIDDescriptionw[1118]; P{GD6741}v17567Vienna Drosophila RNAi Center17567DmUSP5 UAS-RNAi-1w[1118]; P{GD6741}v17568Vienna Drosophila RNAi Center17568DmUSP5 UAS-RNAi-2y[1] v[1]; P{TRiP.JF02163}attP2Bloomington Drosophila Stock Center31886DmUSP5 UAS-RNAi-3y[1] v[1]; P{y[+t7.7] = CaryP}attP2Bloomington Drosophila Stock Center36303Host strain for RNAi-3w[1118]Vienna Drosophila RNAi Center60000Host strain for RNAi-1, -2w[*]; UAS-HA-UbiquitinBloomington Drosophila Stock Center32055Expresses HA-tagged ubiquitin under UAS controlM{UAS-CG5384.ORF.3xHA}ZH-86FbFlyORFF001032Expresses HA-tagged USP14 under UAS controlw[*]; tubP-Gal80tsBloomington Drosophila Stock Center7018Temperature-sensitive Gal80 that is expressed under the control of the αTub84B promoterw[*]; UAS-CL1-GFPDr. Udai PandeyGFP with CL1 degron, reporter of ubiquitin-dependent proteasome activity, under UAS controlw[*]; sqh-Gal4Dr. Daniel EberlUbiquitous driverw[*]; actin-Gal4Dr. Daniel EberlUbiquitous driverw[*]; da-Gal4Dr. R. J. WessellsUbiquitous driver Open table in a new tab Larvae, pupae, or flies, as indicated in figures and legends, were homogenized in boiling SDS lysis buffer (50 mm Tris, pH 6.8, 2% SDS, 10% glycerol, and 100 mm DTT), sonicated, boiled for 10 min, centrifuged for 10 min at 13,000 × g at room temperature, loaded onto SDS-PAGE gels, electrophoresed at 160–170 V, and transferred onto PVDF membranes (Bio-Rad) for Western blotting, as previously described (19.Tsou W.L. Sheedlo M.J. Morrow M.E. Blount J.R. McGregor K.M. Das C. Todi S.V. Systematic analysis of the physiological importance of deubiquitinating enzymes.PLoS One. 2012; 7: e43112Crossref PubMed Scopus (52) Google Scholar, 22.Blount J.R. Burr A.A. Denuc A. Marfany G. Todi S.V. Ubiquitin-specific protease 25 functions in endoplasmic reticulum-associated degradation.PLoS One. 2012; 7: e36542Crossref PubMed Scopus (48) Google Scholar23.Blount J.R. Tsou W.L. Ristic G. Burr A.A. Ouyang M. Galante H. Scaglione K.M. Todi S.V. Ubiquitin-binding site 2 of ataxin-3 prevents its proteasomal degradation by interacting with Rad23.Nat. Commun. 2014; 5: 4638Crossref PubMed Scopus (46) Google Scholar, 24.Tsou W.L. Hosking R.R. Burr A.A. Sutton J.R. Ouyang M. Du X. Gomez C.M. Todi S.V. DnaJ-1 and karyopherin α3 suppress degeneration in a new Drosophila model of spinocerebellar Ataxia type 6.Hum. Mol. Genet. 2015; 24: 4385-4396Crossref PubMed Scopus (29) Google Scholar25.Tsou W.L. Ouyang M. Hosking R.R. Sutton J.R. Blount J.R. Burr A.A. Todi S.V. The deubiquitinase ataxin-3 requires Rad23 and DnaJ-1 for its neuroprotective role in Drosophila melanogaster.Neurobiol Dis. 2015; 82: 12-21Crossref PubMed Scopus (35) Google Scholar). 10 larvae, 5 pupae, or 5 adults were collected per group in 15 μl of lysis buffer per larva, 20 μl of lysis buffer per pupa, or 30 μl of buffer per adult. For direct blue staining of PVDF membranes, 0.1% DB71 (Sigma-Aldrich) stock solution in ultra pure water was dissolved in 40% ethanol and 10% acetic acid solvent to a final concentration of 0.01%, and membrane was immersed for 5 min, rinsed briefly with solvent, then ultra pure water, and air dried. Coomassie Blue staining was conducted as described before (26.Scaglione K.M. Zavodszky E. Todi S.V. Patury S. Xu P. Rodríguez-Lebrón E. Fischer S. Konen J. Djarmati A. Peng J. Gestwicki J.E. Paulson H.L. Ube2w and ataxin-3 coordinately regulate the ubiquitin ligase CHIP.Mol. Cell. 2011; 43: 599-612Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar, 27.Scaglione K.M. Basrur V. Ashraf N.S. Konen J.R. Elenitoba-Johnson K.S. Todi S.V. Paulson H.L. The ubiquitin-conjugating enzyme (E2) Ube2w ubiquitinates the N terminus of substrates.J. Biol. Chem. 2013; 288: 18784-18788Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar). Western blots were imaged with a charge-coupled device-equipped VersaDoc 5000MP system (Bio-Rad) (22.Blount J.R. Burr A.A. Denuc A. Marfany G. Todi S.V. Ubiquitin-specific protease 25 functions in endoplasmic reticulum-associated degradation.PLoS One. 2012; 7: e36542Crossref PubMed Scopus (48) Google Scholar, 23.Blount J.R. Tsou W.L. Ristic G. Burr A.A. Ouyang M. Galante H. Scaglione K.M. Todi S.V. Ubiquitin-binding site 2 of ataxin-3 prevents its proteasomal degradation by interacting with Rad23.Nat. Commun. 2014; 5: 4638Crossref PubMed Scopus (46) Google Scholar). Quantification of signals from subsaturated blots was conducted with Quantity One Software (Bio-Rad) with universal background subtraction. Experimental lanes were normalized to their respective controls. Student's t tests (one- or two-tailed, as appropriate) or analysis of variance with Tukey's post hoc correction were used for statistical comparisons. Anti-ubiquitin (DAKO rabbit polyclonal, 1:500, catalog no. Z0458), P4D1 (mouse monoclonal, 1:500, Santa Cruz Biotechnology, catalog no. SC2017, used only in Fig. 3C), anti-tubulin (mouse monoclonal, 1:5,000, Sigma-Aldrich, catalog no. T5168), anti-actin (JLA20 mouse monoclonal, 1:500, Developmental Studies Hybridoma Bank), anti-HA (Y11, rabbit polyclonal, 1:1,000, Santa Cruz Biotechnology, catalog no. SC805), anti-GFP (mouse monoclonal, 1:1,000, Roche, catalog no. 11814460001), anti-CHIP (rabbit monoclonal, 1:1,000, Cell Signaling Technology, catalog no. 2080S), anti-HSP70 (mouse monoclonal, 1:1,000, Rockland, catalog no. 200–301-A27), anti-cyclin A (A12 mouse monoclonal, 1:100, Developmental Studies Hybridoma Bank), anti-Sin3 (rabbit polyclonal, 1:2,000), anti-VCP (valosin-containing protein; rabbit monoclonal, 1:1,000; Cell Signaling Technology catalog no. 2648S) peroxidase-conjugated secondary antibodies (goat anti-rabbit and goat anti-mouse, 1:5,000; Jackson Immunoresearch). Sin3 antibody was a generous gift from Dr. Lori Pile (Wayne State University) (28.Pile L.A. Wassarman D.A. Chromosomal localization links the SIN3-RPD3 complex to the regulation of chromatin condensation, histone acetylation and gene expression.EMBO J. 2000; 19: 6131-6140Crossref PubMed Scopus (71) Google Scholar). The JLA20 and A12 antibodies were procured from the Developmental Studies Hybridoma Bank, created by the NICHD, National Institutes of Health and maintained at the Department of Biology of the University of Iowa (Iowa City, IA). JLA20 was deposited to the Developmental Studies Hybridoma Bank by J. J.-C Lin. A12 was deposited to the Developmental Studies Hybridoma Bank by C. F. Lehner. DmUSP5 was cloned in two fragments from a Drosophila w1118 cDNA library generated in our laboratory. Fragment A was PCR-amplified by using forward primer (5′-GTT TAT GAG AAA AGA GCT GCC TAC A-3′) and reverse primer (5′-CAA TAC TGC TGT ACT TTC CCG ACT-3′). Fragment B was PCR-amplified by using forward primer (5′- GGC AAC TCC TGC TAC ATA AAC AG-3′) and reverse primer (5′- CGA ATA ATA TTA GCT TGT GGG ACT G-3′). The fragments were ligated and inserted into pCR Blunt II TOPO vector (ThermoFisher). Full-length DmUSP5 was then subcloned into pGEX6p1 (GE Healthcare). The human USP5 construct was purchased from Addgene, a generous gift of the Arrowsmith Lab (plasmid 25299). DmUSP5 in pGEX6p1 and human USP5 in pET28 were transformed into BL21 Escherichia coli. Individual colonies were grown at 37 °C overnight in LB with ampicillin or kanamycin, as needed. 10 ml was used to inoculate 500 ml of LB and was grown for an additional 3 h at 37 °C. Protein expression was induced by 0.5 mm of isopropyl-1-β-d-galactopyranoside (A. G. Scientific) for 2 h at 30 °C. DmUSP5 was purified by GST pulldown. Bacterial cells were pelleted by centrifugation and resuspended in NETN lysis buffer (50 mm Tris, pH 7.5, 150 mm NaCl, 0.5% Nonidet P-40), sonicated, and then centrifuged for 20 min at 4 °C. 250 μl of glutathione-Sepharose beads (GE Healthcare) were washed with NETN, and lysates were added to beads and tumbled at 4 °C. The beads were then washed with NETN buffer thrice followed by two PBS washes. Prescission Protease (GE Healthcare) with 1% DTT was used to elute the bead-bound protein. His-tagged human USP5 was purified with nickel beads. Pelleted bacterial cells were resuspended in buffer A (50 mm Tris, pH 7.5, 150 mm NaCl), sonicated, and centrifuged. 400 μl of nickel-nitrilotriacetic acid beads (Qiagen) were washed in buffer A and incubated with lysates. The beads were then rinsed twice each with buffers A, B (50 mm Tris, pH 7.5, 1 m NaCl, 20 mm immidazole), and C (50 mm Tris, pH 7.5, 100 mm NaCl, 20 mm imidazole, 0.5% Triton X-100). Protein was eluted with buffer C containing 300 mm imidazole and 1% DTT. Catalytically inactive DmUSP5 was created using the QuikChange mutagenisis kit (Agilent) (23.Blount J.R. Tsou W.L. Ristic G. Burr A.A. Ouyang M. Galante H. Scaglione K.M. Todi S.V. Ubiquitin-binding site 2 of ataxin-3 prevents its proteasomal degradation by interacting with Rad23.Nat. Commun. 2014; 5: 4638Crossref PubMed Scopus (46) Google Scholar). The catalytic cysteine at position 341 was mutated to an alanine. Recombinant protein concentration was determined using NanoDrop and Coomassie Blue staining of SDS-PAGE gels. 50 nm of recombinant DmUSP5 or human USP5 was added to kinase buffer (0.5 m Tris pH 7.5, 0.5 m KCl, 0.2% DTT) with 1 μm of ubiquitin chains with specific linkages for a total reaction volume of 60 μl. Reactions were incubated at 37 °C for human USP5 or 25 °C for fly USP5, and 15 μl were taken from each reaction at the indicated time points. The reaction was stopped by the addition of 10 μl of sample loading buffer and boiled for 2 min. DUB reactions were also repeated at 37 °C for Drosophila USP5, with similar results to those at 25 °C. Ubiquitin chains were purchased from Boston Biochem. CHIP and HSP70 ubiquitination was carried out as previously described (26.Scaglione K.M. Zavodszky E. Todi S.V. Patury S. Xu P. Rodríguez-Lebrón E. Fischer S. Konen J. Djarmati A. Peng J. Gestwicki J.E. Paulson H.L. Ube2w and ataxin-3 coordinately regulate the ubiquitin ligase CHIP.Mol. Cell. 2011; 43: 599-612Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar, 27.Scaglione K.M. Basrur V. Ashraf N.S. Konen J.R. Elenitoba-Johnson K.S. Todi S.V. Paulson H.L. The ubiquitin-conjugating enzyme (E2) Ube2w ubiquitinates the N terminus of substrates.J. Biol. Chem. 2013; 288: 18784-18788Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar) for 1 h at 37 °C in 100 μl of kinase buffer. Ubmix (2.5 mm ATP, 2.5 mm MgCl2, 100 nm Ube1, and 250 μm ubiquitin), 1 μm E2 (Ube2w for monoubiquitinated CHIP or UbcH5c for polyubiquitinated CHIP and HSP70), 1 μm CHIP, and 1 μm HSP70. The reactions were stopped by the addition of excess EDTA, and 50 nm (final) DmUSP5 or human USP5 was added to the complex. Reaction time points were separated on 4–20% polyacrylamide gels and analyzed by Western blotting. Total RNA was extracted using TRIzol reagent (Invitrogen), followed by treatment with TURBO DNase (Ambion) to eliminate contaminating DNA. A high capacity kit (ABI) was used to perform reverse transcription. Messenger RNA levels were quantified with PlusOne real time quantitative system using Fast SYBR Green (ABI). rp49 was used as a control. All quantitative real time (qRT)-PCR primers are listed in Table 2.TABLE 2qRT-PCR primers usedTargetForward primer 5′-3′Reverse primer 5′-3′Primers usedrp49AGATCGTGAAGAAGCGCACCAAGCACCAGGAACTTCTTGAATCCGGbap1/calypsoCAACAACAGTCTCAGCCACAATGACGAATATCTCAGCAGTTGTCTCrpn11CTCAATCGCCACTACTACTCGATCATAACCTTGTCCACCTTCTCCTuchGTGCCGGTAATTGTGTGTAGAAGAATCCATTCCAAGGTGTCATCuch-l5/uchl3ACGGTGCTGGAAATTGGTGTCTCATTGAAGAAGATGTTCTCCCGATCCAGusp1ACCTTGCGCTGCTACAGTCTACGCTCTTGAGCCTCTTCAATTCTusp5GTACGAGATCAAGGACACGTACAGGTCAGATTAAGCCAGAGGTTGTTGusp8GCATTACAAGTCACCAACACCTTCCCAGATTCTTCAGTCCAGTCAGTusp14ACTCCTGTCAAATTCATTGAGGACCAAATATAGACTTCATGGCAGACGusp32TTGATCTGTTCTACGGCCAGTTAGTACTTGCAATCGGAGTTCAGACusp20–33CTTGTGGAGTACATAGCAGAGCAGCTGCTGCTGAAGTGACTGGTATTusp47ACGTATTCCCATCAAAATTCTGTCTCGCTGATCTGTGATAATGAAAGTCG2960CTCTCTTTTCCCTTTTTCTTTGTGGACTCCTTCTGAATGTTGTAGTCG5271CGCACCCTCTCTGACTATAACATTCCGTTCTCGTCAACCTTGTAGTATCG32744GGACGTCCGAGCAAGTAAAAATGGCTCAACCTCCAAAGTGCG11624CTTCGTCTCCGTGGTGGTATAGGGTGGACTCCTTCTGGATCL1-GFPACGTAAACGGCCACAAGTTCAAGTCGTGCTGCTTCATGTGAlternative DmUSP5 primers used, with similar resultsusp5GGCGGCCAAATACGTAAATACGTCCTTGTAGATGGGAGGAusp5CTCCGCACCTGGATAAGAAGCGGTCAGATTAAGCCAGAGGusp5TCGGATGTGTTCTCCTACCCCCATCGACTTCTCGCTCTTC Open table in a new tab CG12082 is the Drosophila gene whose product most closely aligns with mammalian USP5 (19.Tsou W.L. Sheedlo M.J. Morrow M.E. Blount J.R. McGregor K.M. Das C. Todi S.V. Systematic analysis of the physiological importance of deubiquitinating enzymes.PLoS One. 2012; 7: e43112Crossref PubMed Scopus (52) Google Scholar). Like its human counterpart, CG12082 contains the ubiquitin-specific protease (USP) domain, the ubiquitin-associated domains that bind to ubiquitin moieties in polyubiquitin chains, and a zinc finger-like region (11.Wilkinson K.D. Tashayev V.L. O'Connor L.B. Larsen C.N. Kasperek E. Pickart C.M. Metabolism of the polyubiquitin degradation signal: structure, mechanism, and role of isopeptidase T.Biochemistry. 1995; 34: 14535-14546Crossref PubMed Scopus (261) Google Scholar, 12.Reyes-Turcu F.E. Horton J.R. Mullally J.E. Heroux A. Cheng X. Wilkinson K.D. The ubiquitin binding domain ZnF UBP recognizes the C-terminal diglycine motif of unanchored ubiquitin.Cell. 2006; 124: 1197-1208Abstract Full Text Full Text PDF PubMed Scopus (241) Google Scholar13.Reyes-Turcu F.E. Shanks J.R. Komander D. Wilkinson K.D. Recognition of polyubiquitin isoforms by the multiple ubiquitin binding modules of isopeptidase T.J. Biol. Chem. 2008; 283: 19581-19592Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar, 29.Avvakumov G.V. Walker J.R. Xue S. Allali-Hassani A. Asinas A. Nair U.B. Fang X. Zuo X. Wang Y.X. Wilkinson K.D. Dhe-Paganon S. Two ZnF-UBP domains in isopeptidase T (USP5).Biochemistry. 2012; 51: 1188-1198Crossref PubMed Scopus (36) Google Scholar, 30.Falquet L. Paquet N. Frutiger S. Hughes G.J. Hoang-Van K. Jaton J.C. A human de-ubiquitinating enzyme with both isopeptidase and peptidase activities in vitro.FEBS Lett. 1995; 359: 73-77Crossref PubMed Scopus (43) Google Scholar31.Raasi S. Varadan R. Fushman D. Pickart C.M. Diverse polyubiquitin interaction properties of ubiquitin-associated domains.Nat. Struct. Mol. Biol. 2005; 12: 708-714Crossref PubMed Scopus (276) Google Scholar) (Fig. 1A). Recombinant, human USP5 has been reported to hydrolyze polyubiquitin chains of different linkages in vitro (11.Wilkinson K.D. Tashayev V.L. O'Connor L.B. Larsen C.N. Kasperek E. Pickart C.M. Metabolism of the polyubiquitin degradation signal: structure, mechanism, and role of isopeptidase T.Biochemistry. 1995; 34: 14535-14546Crossref PubMed Scopus (261) Google Scholar, 12.Reyes-Turcu F.E. Horton J.R. Mullally J.E. Heroux A. Cheng X. Wilkinson K.D. The ubiquitin binding domain ZnF UBP recognizes the C-terminal diglycine motif of unanchored ubiquitin.Cell. 2006; 124: 1197-1208Abstract Full Text Full Text PDF PubMed Scopus (241) Google Scholar13.Reyes-Turcu F.E. Shanks J.R. Komander D. Wilkinson K.D. Recognition of polyubiquitin isoforms by the multiple ubiquitin binding modules of isopeptidase T.J. Biol. Chem. 2008; 283: 19581-19592Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar, 29.Avvakumov G.V. Walker J.R. Xue S. Allali-Hassani A. Asinas A. Nair U.B. Fang X. Zuo X. Wang Y.X. Wilkinson K.D. Dhe-Paganon S. Two ZnF-UBP domains in isopeptidase T (USP5).Biochemistry. 2012; 51: 1188-1198Crossref PubMed Scopus (36) Google Scholar, 30.Falquet L. Paquet N. Frutiger S. Hughes G.J. Hoang-Van K. Jaton J.C. A human de-ubiquitinating enzyme with both isopeptidase and peptidase activities in vitro.FEBS Lett. 1995; 359: 73-77Crossref PubMed Scopus (43) Google Scholar31.Raasi S. Varadan R. Fushman D. Pickart C.M. Diverse polyubiquitin interaction properties of ubiquitin-associated domains.Nat. Struct. Mol. Biol. 2005; 12: 708-714Crossref PubMed Scopus (276) Google Scholar). We began our studies of Drosophila USP5 (DmUSP5) by comparing ubiquitin chain cleavage preferences between it and the human counterpart in vitro. We carried out deubiquitination reactions at 37 °C, optimal for human USP5, and 25 °C, optimal for Drosophila USP5, although the same results were also obtained at 37 °C (Fig. 1 and data not shown). We observed that DmUSP5 and human USP5 both hydrolyze unanchored polyubiquitin chains of different linkages (Fig. 1B). The recombinant proteases have different proficiencies: Lys11, Lys48, Lys63, and linear (head to tail) species were cleaved more rapidly than Lys6- and Lys29-linked diubiquitin. Both DUBs were also able to cleave rapidly di- and tetraubiquitin chains (Fig. 1B). We noticed that as Lys6 and Lys33 diubiquitin" @default.
• W2285209545 created "2016-06-24" @default.
• W2285209545 creator A5001553962 @default.
• W2285209545 creator A5015909717 @default.
• W2285209545 creator A5038439202 @default.
• W2285209545 creator A5047849537 @default.
• W2285209545 creator A5065336130 @default.
• W2285209545 creator A5089877121 @default.
• W2285209545 date "2016-04-01" @default.
• W2285209545 modified "2023-10-14" @default.
• W2285209545 title "USP5 Is Dispensable for Monoubiquitin Maintenance in Drosophila" @default.
• W2285209545 cites W1080799868 @default.
• W2285209545 cites W1968055671 @default.
• W2285209545 cites W1970826261 @default.
• W2285209545 cites W1997369314 @default.
• W2285209545 cites W1998684648 @default.
• W2285209545 cites W1999442278 @default.
• W2285209545 cites W2004134367 @default.
• W2285209545 cites W2006089315 @default.
• W2285209545 cites W2006307886 @default.
• W2285209545 cites W2009182668 @default.
• W2285209545 cites W2013339424 @default.
• W2285209545 cites W2015978979 @default.
• W2285209545 cites W2024352715 @default.
• W2285209545 cites W2029287748 @default.
• W2285209545 cites W2029827764 @default.
• W2285209545 cites W2036933501 @default.
• W2285209545 cites W2044347239 @default.
• W2285209545 cites W2046867940 @default.
• W2285209545 cites W2050039220 @default.
• W2285209545 cites W2050237470 @default.
• W2285209545 cites W2051670105 @default.
• W2285209545 cites W2052302154 @default.
• W2285209545 cites W2055361823 @default.
• W2285209545 cites W2055886209 @default.
• W2285209545 cites W2056373544 @default.
• W2285209545 cites W2060222742 @default.
• W2285209545 cites W2061671463 @default.
• W2285209545 cites W2068067496 @default.
• W2285209545 cites W2077292361 @default.
• W2285209545 cites W2081092282 @default.
• W2285209545 cites W2086085629 @default.
• W2285209545 cites W2087437632 @default.
• W2285209545 cites W2090913462 @default.
• W2285209545 cites W2096056184 @default.
• W2285209545 cites W2101090646 @default.
• W2285209545 cites W2105006635 @default.
• W2285209545 cites W2110021200 @default.
• W2285209545 cites W2110643873 @default.
• W2285209545 cites W2118225942 @default.
• W2285209545 cites W2124622589 @default.
• W2285209545 cites W2126308141 @default.
• W2285209545 cites W2128296472 @default.
• W2285209545 cites W2131423447 @default.
• W2285209545 cites W2139947061 @default.
• W2285209545 cites W2141402394 @default.
• W2285209545 cites W2143129177 @default.
• W2285209545 cites W2150972545 @default.
• W2285209545 cites W2169018921 @default.
• W2285209545 cites W264011536 @default.
• W2285209545 doi "https://doi.org/10.1074/jbc.m115.703504" @default.
• W2285209545 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/4861482" @default.
• W2285209545 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/26917723" @default.
• W2285209545 hasPublicationYear "2016" @default.
• W2285209545 type Work @default.
• W2285209545 sameAs 2285209545 @default.
• W2285209545 citedByCount "10" @default.
• W2285209545 countsByYear W22852095452016 @default.
• W2285209545 countsByYear W22852095452017 @default.
• W2285209545 countsByYear W22852095452018 @default.
• W2285209545 countsByYear W22852095452019 @default.
• W2285209545 countsByYear W22852095452020 @default.
• W2285209545 countsByYear W22852095452022 @default.
• W2285209545 crossrefType "journal-article" @default.
• W2285209545 hasAuthorship W2285209545A5001553962 @default.
• W2285209545 hasAuthorship W2285209545A5015909717 @default.
• W2285209545 hasAuthorship W2285209545A5038439202 @default.
• W2285209545 hasAuthorship W2285209545A5047849537 @default.
• W2285209545 hasAuthorship W2285209545A5065336130 @default.
• W2285209545 hasAuthorship W2285209545A5089877121 @default.
• W2285209545 hasBestOaLocation W22852095451 @default.
• W2285209545 hasConcept C104317684 @default.
• W2285209545 hasConcept C185592680 @default.
• W2285209545 hasConcept C2776041557 @default.
• W2285209545 hasConcept C2780104201 @default.
• W2285209545 hasConcept C54355233 @default.
• W2285209545 hasConcept C86803240 @default.
• W2285209545 hasConcept C95444343 @default.
• W2285209545 hasConceptScore W2285209545C104317684 @default.
• W2285209545 hasConceptScore W2285209545C185592680 @default.
• W2285209545 hasConceptScore W2285209545C2776041557 @default.
• W2285209545 hasConceptScore W2285209545C2780104201 @default.
• W2285209545 hasConceptScore W2285209545C54355233 @default.
• W2285209545 hasConceptScore W2285209545C86803240 @default.
• W2285209545 hasConceptScore W2285209545C95444343 @default.
• W2285209545 hasFunder F4320337359 @default.
• W2285209545 hasIssue "17" @default.
• W2285209545 hasLocation W22852095451 @default.

• next