FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2285655593> ?p ?o ?g. }

• W2285655593 endingPage "6545" @default.
• W2285655593 startingPage "6534" @default.
• W2285655593 abstract "The small GTPase DiRas1 has tumor-suppressive activities, unlike the oncogenic properties more common to small GTPases such as K-Ras and RhoA. Although DiRas1 has been found to be a tumor suppressor in gliomas and esophageal squamous cell carcinomas, the mechanisms by which it inhibits malignant phenotypes have not been fully determined. In this study, we demonstrate that DiRas1 binds to SmgGDS, a protein that promotes the activation of several oncogenic GTPases. In silico docking studies predict that DiRas1 binds to SmgGDS in a manner similar to other small GTPases. SmgGDS is a guanine nucleotide exchange factor for RhoA, but we report here that SmgGDS does not mediate GDP/GTP exchange on DiRas1. Intriguingly, DiRas1 acts similarly to a dominant-negative small GTPase, binding to SmgGDS and inhibiting SmgGDS binding to other small GTPases, including K-Ras4B, RhoA, and Rap1A. DiRas1 is expressed in normal breast tissue, but its expression is decreased in most breast cancers, similar to its family member DiRas3 (ARHI). DiRas1 inhibits RhoA- and SmgGDS-mediated NF-κB transcriptional activity in HEK293T cells. We also report that DiRas1 suppresses basal NF-κB activation in breast cancer and glioblastoma cell lines. Taken together, our data support a model in which DiRas1 expression inhibits malignant features of cancers in part by nonproductively binding to SmgGDS and inhibiting the binding of other small GTPases to SmgGDS. The small GTPase DiRas1 has tumor-suppressive activities, unlike the oncogenic properties more common to small GTPases such as K-Ras and RhoA. Although DiRas1 has been found to be a tumor suppressor in gliomas and esophageal squamous cell carcinomas, the mechanisms by which it inhibits malignant phenotypes have not been fully determined. In this study, we demonstrate that DiRas1 binds to SmgGDS, a protein that promotes the activation of several oncogenic GTPases. In silico docking studies predict that DiRas1 binds to SmgGDS in a manner similar to other small GTPases. SmgGDS is a guanine nucleotide exchange factor for RhoA, but we report here that SmgGDS does not mediate GDP/GTP exchange on DiRas1. Intriguingly, DiRas1 acts similarly to a dominant-negative small GTPase, binding to SmgGDS and inhibiting SmgGDS binding to other small GTPases, including K-Ras4B, RhoA, and Rap1A. DiRas1 is expressed in normal breast tissue, but its expression is decreased in most breast cancers, similar to its family member DiRas3 (ARHI). DiRas1 inhibits RhoA- and SmgGDS-mediated NF-κB transcriptional activity in HEK293T cells. We also report that DiRas1 suppresses basal NF-κB activation in breast cancer and glioblastoma cell lines. Taken together, our data support a model in which DiRas1 expression inhibits malignant features of cancers in part by nonproductively binding to SmgGDS and inhibiting the binding of other small GTPases to SmgGDS. The tumor-suppressive small GTPase DiRas1 binds the noncanonical guanine nucleotide exchange factor SmgGDS and antagonizes SmgGDS interactions with oncogenic small GTPases.Journal of Biological ChemistryVol. 291Issue 20PreviewVOLUME 291 (2016) PAGES 6534–6545 Full-Text PDF Open Access Small GTPases, including oncogenic Rho and Ras family members, are important in the development and progression of a number of malignancies (reviewed in Refs. 1Alan J.K. Lundquist E.A. Mutationally activated Rho GTPases in cancer.Small GTPases. 2013; 4: 159-163Crossref PubMed Scopus (64) Google Scholar, 2Bos J.L. ras oncogenes in human cancer: a review.Cancer Res. 1989; 49: 4682-4689PubMed Google Scholar3Pylayeva-Gupta Y. Grabocka E. Bar-Sagi D. RAS oncogenes: weaving a tumorigenic web.Nat. Rev. Cancer. 2011; 11: 761-774Crossref PubMed Scopus (1219) Google Scholar). Small GTPase activation depends upon binding to GTP, which is facilitated when guanine nucleotide exchange factors (GEFs) 2The abbreviations used are: GEF, guanine nucleotide exchange factor; DN, dominant negative; GAP, GTPase activation protein; IRS, immunoreactive score; MANT, N-methylanthraniloyl; PBR, polybasic region; IHC, immunohistochemical. promote the exchange of GDP for GTP. Inactivation of small GTPases is promoted by GTPase-activating proteins (GAPs) that increase the rate of hydrolysis of GTP to GDP. Altering the levels or availability of GEFs and GAPs for small GTPases can modulate their activation in a number of cancers. Novel ways in which to alter the balance of these proteins may prove to be important therapeutically for a variety of malignancies. SmgGDS (Rap1GDS1) is a noncanonical GEF for RhoA and RhoC (4Hamel B. Monaghan-Benson E. Rojas R.J. Temple B.R. Marston D.J. Burridge K. Sondek J. SmgGDS is a guanine nucleotide exchange factor that specifically activates RhoA and RhoC.J. Biol. Chem. 2011; 286: 12141-12148Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar) and also promotes the pro-oncogenic functions of several other small GTPases with C-terminal polybasic regions (PBRs) (5Berg T.J. Gastonguay A.J. Lorimer E.L. Kuhnmuench J.R. Li R. Fields A.P. Williams C.L. Splice variants of SmgGDS control small GTPase prenylation and membrane localization.J. Biol. Chem. 2010; 285: 35255-35266Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). There are two predominant isoforms of SmgGDS, SmgGDS-607 and SmgGDS-558, which differ by one armadillo domain (5Berg T.J. Gastonguay A.J. Lorimer E.L. Kuhnmuench J.R. Li R. Fields A.P. Williams C.L. Splice variants of SmgGDS control small GTPase prenylation and membrane localization.J. Biol. Chem. 2010; 285: 35255-35266Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). Recent studies have demonstrated that SmgGDS-558 plays a more significant role than SmgGDS-607 in activating RhoA in breast cancer cells, despite lower levels of endogenous SmgGDS-558 protein (6Hauser A.D. Bergom C. Schuld N.J. Chen X. Lorimer E.L. Huang J. Mackinnon A.C. Williams C.L. The SmgGDS splice variant SmgGDS-558 is a key promoter of tumor growth and RhoA signaling in breast cancer.Mol. Cancer Res. 2014; 12: 130-142Crossref PubMed Scopus (21) Google Scholar, 7Schuld N.J. Hauser A.D. Gastonguay A.J. Wilson J.M. Lorimer E.L. Williams C.L. SmgGDS-558 regulates the cell cycle in pancreatic, non-small cell lung, and breast cancers.Cell Cycle. 2014; 13: 941-952Crossref PubMed Scopus (17) Google Scholar). In addition, SmgGDS promotes RhoA-mediated NF-κB transcriptional activity (6Hauser A.D. Bergom C. Schuld N.J. Chen X. Lorimer E.L. Huang J. Mackinnon A.C. Williams C.L. The SmgGDS splice variant SmgGDS-558 is a key promoter of tumor growth and RhoA signaling in breast cancer.Mol. Cancer Res. 2014; 12: 130-142Crossref PubMed Scopus (21) Google Scholar, 8Zhi H. Yang X.J. Kuhnmuench J. Berg T. Thill R. Yang H. See W.A. Becker C.G. Williams C.L. Li R. SmgGDS is up-regulated in prostate carcinoma and promotes tumour phenotypes in prostate cancer cells.J. Pathol. 2009; 217: 389-397Crossref PubMed Scopus (22) Google Scholar, 9Tew G.W. Lorimer E.L. Berg T.J. Zhi H. Li R. Williams C.L. SmgGDS regulates cell proliferation, migration, and NF-κB transcriptional activity in non-small cell lung carcinoma.J. Biol. Chem. 2008; 283: 963-976Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar), which is critical to cancer cell growth and proliferation (10Nogueira L. Ruiz-Ontañon P. Vazquez-Barquero A. Moris F. Fernandez-Luna J.L. The NFκB pathway: a therapeutic target in glioblastoma.Oncotarget. 2011; 2: 646-653Crossref PubMed Scopus (106) Google Scholar). Although the unique DiRas (Distinct subgroup of the Ras family) family of small GTPases shares homology with the pro-oncogenic Ras GTPases, it has tumor-suppressive actions. DiRas1 (also known as Di-Ras1 or Rig) has been reported to be a tumor suppressor in gliomas (11Kontani K. Tada M. Ogawa T. Okai T. Saito K. Araki Y. Katada T. Di-Ras, a distinct subgroup of ras family GTPases with unique biochemical properties.J. Biol. Chem. 2002; 277: 41070-41078Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar, 12Ellis C.A. Vos M.D. Howell H. Vallecorsa T. Fults D.W. Clark G.J. Rig is a novel Ras-related protein and potential neural tumor suppressor.Proc. Natl. Acad. Sci. U.S.A. 2002; 99: 9876-9881Crossref PubMed Scopus (54) Google Scholar) and in esophageal squamous cell carcinomas (13Zhu Y.-H. Fu L. Chen L. Qin Y.-R. Liu H. Xie F. Zeng T. Dong S.-S. Li J. Li Y. Dai Y. Xie D. Guan X.-Y. Downregulation of the novel tumor suppressor DIRAS1 predicts poor prognosis in esophageal squamous cell carcinoma.Cancer Res. 2013; 73: 2298-2309Crossref PubMed Scopus (45) Google Scholar). DiRas1 is closely related to its family members DiRas2 (Di-Ras2) and DiRas3 (ARHI, Noey2) (11Kontani K. Tada M. Ogawa T. Okai T. Saito K. Araki Y. Katada T. Di-Ras, a distinct subgroup of ras family GTPases with unique biochemical properties.J. Biol. Chem. 2002; 277: 41070-41078Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar). DiRas2 appears to be predominantly expressed in the brain (11Kontani K. Tada M. Ogawa T. Okai T. Saito K. Araki Y. Katada T. Di-Ras, a distinct subgroup of ras family GTPases with unique biochemical properties.J. Biol. Chem. 2002; 277: 41070-41078Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar), whereas DiRas3 is a tumor suppressor in breast and ovarian cancers (14Yu Y. Luo R. Lu Z. Wei Feng W. Badgwell D. Issa J.-P. Rosen D.G. Liu J. Bast Jr, R.C. Biochemistry and biology of ARHI (DIRAS3), an imprinted tumor suppressor gene whose expression is lost in ovarian and breast cancers.Methods Enzymol. 2006; 407: 455-468Crossref PubMed Scopus (62) Google Scholar). It has not been determined whether DiRas1, like DiRas3, is also expressed in normal breast tissue and lost in a proportion of breast cancers. Moreover, the mechanisms by which DiRas1 inhibits tumor growth are not fully characterized. Overexpression of DiRas1 inhibits Ras-mediated transformation of NIH3T3 cells and inhibits the growth of glioblastoma and esophageal squamous cell cancer cell lines (12Ellis C.A. Vos M.D. Howell H. Vallecorsa T. Fults D.W. Clark G.J. Rig is a novel Ras-related protein and potential neural tumor suppressor.Proc. Natl. Acad. Sci. U.S.A. 2002; 99: 9876-9881Crossref PubMed Scopus (54) Google Scholar, 13Zhu Y.-H. Fu L. Chen L. Qin Y.-R. Liu H. Xie F. Zeng T. Dong S.-S. Li J. Li Y. Dai Y. Xie D. Guan X.-Y. Downregulation of the novel tumor suppressor DIRAS1 predicts poor prognosis in esophageal squamous cell carcinoma.Cancer Res. 2013; 73: 2298-2309Crossref PubMed Scopus (45) Google Scholar). In addition, DiRas1 signaling diminished BAD serine phosphorylation, which can promote cell death, and decreased matrix metalloproteinase 2/9 expression (13Zhu Y.-H. Fu L. Chen L. Qin Y.-R. Liu H. Xie F. Zeng T. Dong S.-S. Li J. Li Y. Dai Y. Xie D. Guan X.-Y. Downregulation of the novel tumor suppressor DIRAS1 predicts poor prognosis in esophageal squamous cell carcinoma.Cancer Res. 2013; 73: 2298-2309Crossref PubMed Scopus (45) Google Scholar). In esophageal cancers, DiRas1 appeared to decrease ERK1/2 and MAPK-mediated signals, leading to increased cell death, decreased migration, and decreased invasion (13Zhu Y.-H. Fu L. Chen L. Qin Y.-R. Liu H. Xie F. Zeng T. Dong S.-S. Li J. Li Y. Dai Y. Xie D. Guan X.-Y. Downregulation of the novel tumor suppressor DIRAS1 predicts poor prognosis in esophageal squamous cell carcinoma.Cancer Res. 2013; 73: 2298-2309Crossref PubMed Scopus (45) Google Scholar). DiRas1 may function via nonproductive associations with effectors or activators of pro-oncogenic small GTPases, similar to how Rap1A (15Sakoda T. Kaibuchi K. Kishi K. Kishida S. Doi K. Hoshino M. Hattori S. Takai Y. smg/rap1/Krev-1 p21s inhibit the signal pathway to the c-fos promoter/enhancer from c-Ki-ras p21 but not from c-raf-1 kinase in NIH3T3 cells.Oncogene. 1992; 7: 1705-1711PubMed Google Scholar) and Rheb (16Aspuria P.-J. Tamanoi F. The Rheb family of GTP-binding proteins.Cell. Signal. 2004; 16: 1105-1112Crossref PubMed Scopus (166) Google Scholar) antagonize Ras signaling. DiRas1 was reported to bind to the effector domain of C-RAF in cells (12Ellis C.A. Vos M.D. Howell H. Vallecorsa T. Fults D.W. Clark G.J. Rig is a novel Ras-related protein and potential neural tumor suppressor.Proc. Natl. Acad. Sci. U.S.A. 2002; 99: 9876-9881Crossref PubMed Scopus (54) Google Scholar), but a yeast two-hybrid screen detected no association between DiRas1 and C-RAF or B-RAF (11Kontani K. Tada M. Ogawa T. Okai T. Saito K. Araki Y. Katada T. Di-Ras, a distinct subgroup of ras family GTPases with unique biochemical properties.J. Biol. Chem. 2002; 277: 41070-41078Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar). Interestingly, a number of Ras- and Rap-specific GEFs and GAPs did not mediate GTP exchange or hydrolysis of DiRas1, although Rap1GAP1/2 could hydrolyze GTP on DiRas1 (17Gasper R. Sot B. Wittinghofer A. GTPase activity of Di-Ras proteins is stimulated by Rap1GAP proteins.Small GTPases. 2010; 1: 133-141Crossref PubMed Scopus (16) Google Scholar). We hypothesize that rather than sequestering effectors for pro-oncogenic small GTPases, DiRas1 may act as a tumor suppressor by sequestering GEFs for these small GTPases. Here, we identified DiRas1 as a binding partner for SmgGDS. Our in silico docking analysis predicted that DiRas1 can compete with other small GTPases, such as RhoA and K-Ras4B, for SmgGDS binding. Consistent with this prediction, DiRas1 potently inhibited interactions of SmgGDS with a broad range of pro-oncogenic small GTPases, including RhoA, K-Ras4B, and Rap1A. In addition, DiRas1 inhibited basal and RhoA-mediated NF-κB activity in HEK293T, glioblastoma, and breast cancer cell lines. Taken together, these findings identify a novel way in which the tumor suppressive GTPase DiRas1 represses signals mediated by several pro-oncogenic Ras and Rho family GTPases. Constructs encoding N-terminal Myc-tagged or HA-tagged small GTPases and C-terminal HA-tagged SmgGDS constructs were created as described previously (5Berg T.J. Gastonguay A.J. Lorimer E.L. Kuhnmuench J.R. Li R. Fields A.P. Williams C.L. Splice variants of SmgGDS control small GTPase prenylation and membrane localization.J. Biol. Chem. 2010; 285: 35255-35266Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar, 18Lanning C.C. Ruiz-Velasco R. Williams C.L. Novel mechanism of the co-regulation of nuclear transport of SmgGDS and Rac1.J. Biol. Chem. 2003; 278: 12495-12506Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar, 19Lanning C.C. Daddona J.L. Ruiz-Velasco R. Shafer S.H. Williams C.L. The Rac1 C-terminal polybasic region regulates the nuclear localization and protein degradation of Rac1.J. Biol. Chem. 2004; 279: 44197-44210Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar). DiRas1 cDNA constructs in the pcDNA3.1 vector were purchased from cDNA.org, and dominant-negative mutants were purchased from Top Gene Technologies. RhoA and SmgGDS cDNAs in pLIC-His were kind gifts from John Sondek (University of North Carolina) and were created as described previously (20Rossman K.L. Worthylake D.K. Snyder J.T. Siderovski D.P. Campbell S.L. Sondek J. A crystallographic view of interactions between Dbs and Cdc42: PH domain-assisted guanine nucleotide exchange.EMBO J. 2002; 21: 1315-1326Crossref PubMed Scopus (187) Google Scholar, 21Snyder J.T. Worthylake D.K. Rossman K.L. Betts L. Pruitt W.M. Siderovski D.P. Der C.J. Sondek J. Structural basis for the selective activation of Rho GTPases by Dbl exchange factors.Nat. Struct. Biol. 2002; 9: 468-475Crossref PubMed Scopus (191) Google Scholar22Stols L. Gu M. Dieckman L. Raffen R. Collart F.R. Donnelly M.I. A new vector for high-throughput, ligation-independent cloning encoding a tobacco etch virus protease cleavage site.Protein Expr. Purif. 2002; 25: 8-15Crossref PubMed Scopus (428) Google Scholar). Full-length DiRas1 in pLIC-His or pETM11 was created by subcloning DiRas1 from DiRas1-pcDNA3.1 (Top Gene Technologies). All cDNA sequences were verified by DNA sequencing of the entire ORF. HEK293T, U87, T47D, and MCF-7 cells were obtained from the American Type Culture Collection, and U251 cells were obtained from Sigma. Cells were maintained in high glucose DMEM with l-glutamine medium with 10% heat-inactivated FBS, except for MCF-7 cells, which were maintained as indicated by the American Type Culture Collection. Cell cultures were supplemented with penicillin and streptomycin (Life Technologies). All cDNAs were transfected into cells using Lipofectamine 2000 (Life Technologies) according to the manufacturer's protocol. A model for SmgGDS-607 (UniProt P52306-1) was created using the I-TASSER 2.1 standalone modeler (23Roy A. Kucukural A. Zhang Y. I-TASSER: a unified platform for automated protein structure and function prediction.Nat. Protoc. 2010; 5: 725-738Crossref PubMed Scopus (4688) Google Scholar). The 607 isoform was then manually converted into the SmgGDS-558 isoform (P52306-2) followed by loop reconstructions using YASARA homology modeling (24Krieger E. Joo K. Lee J. Lee J. Raman S. Thompson J. Tyka M. Baker D. Karplus K. Improving physical realism, stereochemistry, and side-chain accuracy in homology modeling: Four approaches that performed well in CASP8.Proteins. 2009; 77: 114-122Crossref PubMed Scopus (938) Google Scholar). A model for DiRas1 (O95057, amino acids 1–195) was created using YASARA homology modeling. Global docking of DiRas1 (ligand) to SmgGDS-558 (receptor) was performed using AutoDock (25Morris G.M. Huey R. Lindstrom W. Sanner M.F. Belew R.K. Goodsell D.S. Olson A.J. AutoDock4 and AutoDockTools4: automated docking with selective receptor flexibility.J. Comput. Chem. 2009; 30: 2785-2791Crossref PubMed Scopus (13691) Google Scholar), calculating 50 docking predictions on five receptor ensembles for a total of 250 docking predictions. Following cluster analysis of the docking results in YASARA, the top 10 conformations were energy minimized using the NOVA force field (26Krieger E. Koraimann G. Vriend G. Increasing the precision of comparative models with YASARA NOVA: a self-parameterizing force field.Proteins. 2002; 47: 393-402Crossref PubMed Scopus (1168) Google Scholar), with water added to 0.997 g/ml, and a final energy minimization with the AMBER03 (27Duan Y. Wu C. Chowdhury S. Lee M.C. Xiong G. Zhang W. Yang R. Cieplak P. Luo R. Lee T. Caldwell J. Wang J. Kollman P. A point-charge force field for molecular mechanics simulations of proteins based on condensed-phase quantum mechanical calculations.J. Comput. Chem. 2003; 24: 1999-2012Crossref PubMed Scopus (3737) Google Scholar) force field was performed. Binding energy for the top 10 conformations was determined in kcal/mol, factoring out water. The electrostatic surface for DiRas1 was calculated with a static Poisson-Boltzmann Solver. Models for RhoA, K-Ras4B, and Rap1A were then structurally aligned against the top docking conformation of DiRas1 using the MUSTANG algorithm (28Konagurthu A.S. Whisstock J.C. Stuckey P.J. Lesk A.M. MUSTANG: a multiple structural alignment algorithm.Proteins. 2006; 64: 559-574Crossref PubMed Scopus (543) Google Scholar). HA-SmgGDS-558 cDNA constructs alone or in combination with cDNA constructs encoding Myc-tagged WT GTPases were transfected into HEK293T cells. Constructs encoding DiRas1 with an HA tag (rather than a Myc tag) were also used in some experiments. After 24 h, the cells were lysed and immunoprecipitated with HA-conjugated agarose beads (Sigma), and the immunoprecipitates were subjected to Western blotting. The indicated cDNAs were transcribed and translated using the TnT quick coupled transcription/translation system (Promega) with [35S]methionine per the manufacturer's instructions. Translated proteins were then incubated and immunoprecipitated using anti-HA antibody, separated by SDS-PAGE, and examined by autoradiography, as described previously (19Lanning C.C. Daddona J.L. Ruiz-Velasco R. Shafer S.H. Williams C.L. The Rac1 C-terminal polybasic region regulates the nuclear localization and protein degradation of Rac1.J. Biol. Chem. 2004; 279: 44197-44210Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar). Equal numbers of transfected cells were boiled in Laemmli sample buffer and subjected to electrophoresis using precast Bis-Tris 3–20% gels (Life Technologies) or 10% SDS-PAGE gels (for transcription and translation assays). The proteins were transferred to PVDF and immunoblotted using antibodies against SmgGDS (BD Transduction Laboratories; 612511), GAPDH (Santa Cruz Biotechnology; sc-32233), Myc (Covance; PRB-150P), HA (Covance; MMS-101P), RhoA (Cytoskeleton; ARH03-A), and DiRas1 (Proteintech; 12634-AP). Bound antibodies were visualized using HRP-linked secondary antibodies (GE Healthcare), as previously described (6Hauser A.D. Bergom C. Schuld N.J. Chen X. Lorimer E.L. Huang J. Mackinnon A.C. Williams C.L. The SmgGDS splice variant SmgGDS-558 is a key promoter of tumor growth and RhoA signaling in breast cancer.Mol. Cancer Res. 2014; 12: 130-142Crossref PubMed Scopus (21) Google Scholar). SmgGDS and GTPase constructs were produced in BL21 (DE3) Escherichia coli, as previously described (4Hamel B. Monaghan-Benson E. Rojas R.J. Temple B.R. Marston D.J. Burridge K. Sondek J. SmgGDS is a guanine nucleotide exchange factor that specifically activates RhoA and RhoC.J. Biol. Chem. 2011; 286: 12141-12148Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar). After harvesting and lysing bacterial cells, the His6-tagged proteins were purified via Ni2+ affinity chromatography. The proteins were then concentrated, and the final protein concentration was determined using A280 or the bisinchoninic acid protein assay (Pierce) per the manufacturer's instructions prior to storage at −80 °C. The ability of SmgGDS to mediate guanine nucleotide exchange was determined using the fluorescent nucleotide analog N-methylanthraniloyl (MANT)-GTP as previously described (29Rojas R.J. Kimple R.J. Rossman K.L. Siderovski D.P. Sondek J. Established and emerging fluorescence-based assays for G-protein function: Ras-superfamily GTPases.Comb. Chem. High Throughput Screen. 2003; 6: 409-418Crossref PubMed Scopus (35) Google Scholar). Exchange assays were performed with a LS-55 fluorescence spectrometer (PerkinElmer Life Sciences) with λex = 360 nm and λem = 430 nm and slits of 5 nm. The exchange buffer contained 50 mm NaCl, 20 mm Tris-HCl (pH 8.0), 5 mm MgCl2, 5% glycerol, 1 mm DTT, and 400 nm MANT-GTP. The exchange buffer, containing either SmgGDS (final concentration, 20 μm) or EDTA (final concentration, 10 μm), was allowed to equilibrate to reach baseline before RhoA or DiRas1 was added (2 μm) at the indicated times. SmgGDS-558 was biotinylated with NHS-PEG4-Biotin (Thermo Scientific) at a 1:1 molar ratio, diluted to 50 ng/μl in binding buffer (50 mm Hepes, pH 7.8, 150 mm NaCl, 2 mm TECP, 2 mm MgCl2, 20 μm GDP, and 0.25 mg/ml BSA) before binding to streptavidin probes using an Octet Red (ForteBio) 96-well biolayer interferometry analysis system. After washing in binding buffer (180 s), SmgGDS-loaded probes were cycled through wells in the following order: binding buffer (baseline, 120 s), RhoA or DiRas1 (association, 900 s), binding buffer (dissociation, 600 s), and binding buffer with 1 m NaCl (regeneration, 180 s). The cycle was repeated for each concentration of GTPase tested. After subtracting the signal from a control probe without SmgGDS, the steady-state response at equilibrium during each association phase was fit to the following equation by nonlinear regression to determine Kd: Response at equilibrium = Ymax * [GTPase]/(Kd + [GTPase]). Tissue microarrays of archival normal breast tissue and breast cancers were analyzed, with two cores per sample represented on the arrays. For noncancerous brain tissue, archived frozen tissue from surgery in epileptic patients was obtained from the Medical College of Wisconsin Brain and Spinal Cord Tissue Bank. All protocols were approved by the Medical College of Wisconsin Institutional Review Board. IHC staining was performed on tissues fixed in 10% neutral-buffered formalin. After dewaxing, the samples were treated with antigen retrieval solution (10 mm citrate buffer, pH 6.0) for 10 min at 95 °C. Endogenous peroxidase was blocked using hydrogen peroxide followed by a serum block (Vector Laboratories). DiRas1 staining (1:300; Sigma; HPA050164) or isotype control staining was performed overnight at 4 °C. A biotinylated secondary antibody, Vectastain ABC kit, and diaminobenzidine peroxidase substrate (Vector Laboratories) were used with hematoxylin counterstain (Invitrogen). For human cortex tissue, a pathologist (A. C. M.) determined the localization of positive staining. Normal human breast tissue samples were verified by a practicing breast pathologist (I. A.-B.). For human breast tissue and breast cancer samples, staining was classified as previously described (8Zhi H. Yang X.J. Kuhnmuench J. Berg T. Thill R. Yang H. See W.A. Becker C.G. Williams C.L. Li R. SmgGDS is up-regulated in prostate carcinoma and promotes tumour phenotypes in prostate cancer cells.J. Pathol. 2009; 217: 389-397Crossref PubMed Scopus (22) Google Scholar). Briefly, the cells were assigned a score based on intensity: 0 (negative), 1 (weak), 2 (moderate), or 3 (strong). The percent positive cells in normal ductal tissue or tumor cells was scored as: 0 (0%), 1 (<10%), 2 (11–50%), 3 (51–75%), and 4 (76–100%). Each blinded sample was scored by a trained technician and a physician, and the average score was calculated. Each sample was then assigned an immunoreactive score (IRS), which is the product of the intensity and percent positive scores (8Zhi H. Yang X.J. Kuhnmuench J. Berg T. Thill R. Yang H. See W.A. Becker C.G. Williams C.L. Li R. SmgGDS is up-regulated in prostate carcinoma and promotes tumour phenotypes in prostate cancer cells.J. Pathol. 2009; 217: 389-397Crossref PubMed Scopus (22) Google Scholar). U87, U251, T47D, and MCF7 cells were transfected with the indicated cDNAs, as well as both the pNifty-Luciferase NF-κB luciferase reporter (Invivogen) and β-gal reporter plasmids in 48-well plates using Lipofectamine 2000 (Life Technologies), as previously described (6Hauser A.D. Bergom C. Schuld N.J. Chen X. Lorimer E.L. Huang J. Mackinnon A.C. Williams C.L. The SmgGDS splice variant SmgGDS-558 is a key promoter of tumor growth and RhoA signaling in breast cancer.Mol. Cancer Res. 2014; 12: 130-142Crossref PubMed Scopus (21) Google Scholar). HEK293T cells were transfected with the indicated cDNAs, as well as the pNifty-Luc NF-κB luciferase reporter plasmid in 6-well plates. After 24 h, luminescence was quantified by adding luciferin (0.15 mg/ml) to each well and measuring luminescence with a FLUOstar Omega plate reader. Transfection efficiency/cell number was normalized by cell counting (HEK293T cells) after luminescence measurements or by measuring β-gal activity by washing cells with PBS, incubating the wells with a β-gal reagent (Pierce) for 30 min, and measuring absorbance at 405 nm. NF-κB activity was calculated using the luminescence value divided by the optical density and normalized to values obtained for the vector-transfected cells. Total RNA was extracted from U87 and U251 cells transfected with vector or DiRas1 for 72 h using Quick RNA Mini Prep (Zymo Research) and was reverse transcribed with iScript cDNA synthesis kit (Bio-Rad) according to themanufacturer's instructions. PCR was carried out to detect levels of IL-8 and r18S using a GeneMate GCL-48 Thermal Cycler. Three independent experiments were performed to analyze the relative gene expression. PCR primers are as follows: IL-8, CTTGGCAGCCTTCCTGATTTCT and GTTTTCCTTGGGGTCCAGACAG and r18S, TGAGGCCATGATTAAGAGGG and AGTCGGCATCGTTTATGGTC. The results are the means ± S.E. Symbols above a column indicate a statistical comparison between the control and experimental group by unpaired Student's t test, Mann-Whitney U test, or one-way analysis of variance with Dunnett's multiple comparison test, as indicated in the figure legends. p values less than 0.05 were considered significant. The RhoGEF SmgGDS is predominantly expressed as a long form (SmgGDS-607) or a splice variant lacking one of its armadillo domains (SmgGDS-558) (5Berg T.J. Gastonguay A.J. Lorimer E.L. Kuhnmuench J.R. Li R. Fields A.P. Williams C.L. Splice variants of SmgGDS control small GTPase prenylation and membrane localization.J. Biol. Chem. 2010; 285: 35255-35266Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). We aimed to identify novel proteins interacting with SmgGDS by utilizing LC/MS to detect proteins that co-immunoprecipitated with SmgGDS-558-HA and SmgGDS-607-HA in HEK293T cells. Among the proteins that co-precipitated with HA-tagged SmgGDS, we identified the small GTPase DiRas1, a poorly characterized Ras family small GTPase with tumor-suppressive functions (11Kontani K. Tada M. Ogawa T. Okai T. Saito K. Araki Y. Katada T. Di-Ras, a distinct subgroup of ras family GTPases with unique biochemical properties.J. Biol. Chem. 2002; 277: 41070-41078Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar, 12Ellis C.A. Vos M.D. Howell H. Vallecorsa T. Fults D.W. Clark G.J. Rig is a novel Ras-related protein and potential neural tumor suppressor.Proc. Natl. Acad. Sci. U.S.A. 2002; 99: 9876-9881Crossref PubMed Scopus (54) Google Scholar13Zhu Y.-H. Fu L. Chen L. Qin Y.-R. Liu H. Xie F. Zeng T. Dong S.-S. Li J. Li Y. Dai Y. Xie D. Guan X.-Y. Downregulation of the novel tumor suppressor DIRAS1 predicts poor prognosis in esophageal squamous cell carcinoma.Cancer Res. 2013; 73: 2298-2309Crossref PubMed Scopus (45) Google Scholar). We confirmed that DiRas1 interacts with SmgGDS in HEK293T cells by immunoprecipitating" @default.
• W2285655593 created "2016-06-24" @default.
• W2285655593 creator A5018282904 @default.
• W2285655593 creator A5018513331 @default.
• W2285655593 creator A5019144458 @default.
• W2285655593 creator A5020231342 @default.
• W2285655593 creator A5020694375 @default.
• W2285655593 creator A5043876626 @default.
• W2285655593 creator A5051142807 @default.
• W2285655593 creator A5060424549 @default.
• W2285655593 creator A5062407037 @default.
• W2285655593 creator A5065859249 @default.
• W2285655593 creator A5069690158 @default.
• W2285655593 creator A5070879471 @default.
• W2285655593 creator A5076229181 @default.
• W2285655593 creator A5081449694 @default.
• W2285655593 date "2016-03-01" @default.
• W2285655593 modified "2023-10-17" @default.
• W2285655593 title "The Tumor-suppressive Small GTPase DiRas1 Binds the Noncanonical Guanine Nucleotide Exchange Factor SmgGDS and Antagonizes SmgGDS Interactions with Oncogenic Small GTPases" @default.
• W2285655593 cites W1538993303 @default.
• W2285655593 cites W1607794022 @default.
• W2285655593 cites W1970527559 @default.
• W2285655593 cites W1973944553 @default.
• W2285655593 cites W1998991259 @default.
• W2285655593 cites W2005415901 @default.
• W2285655593 cites W2008736686 @default.
• W2285655593 cites W2022322056 @default.
• W2285655593 cites W2024089966 @default.
• W2285655593 cites W2031901496 @default.
• W2285655593 cites W2037312364 @default.
• W2285655593 cites W2037844242 @default.
• W2285655593 cites W2059598052 @default.
• W2285655593 cites W2060073899 @default.
• W2285655593 cites W2069123478 @default.
• W2285655593 cites W2069369960 @default.
• W2285655593 cites W2078318856 @default.
• W2285655593 cites W2078475797 @default.
• W2285655593 cites W2080062782 @default.
• W2285655593 cites W2080590768 @default.
• W2285655593 cites W2085082922 @default.
• W2285655593 cites W2092585609 @default.
• W2285655593 cites W2094585531 @default.
• W2285655593 cites W2099099776 @default.
• W2285655593 cites W2105668062 @default.
• W2285655593 cites W2108342792 @default.
• W2285655593 cites W2108627006 @default.
• W2285655593 cites W2115635793 @default.
• W2285655593 cites W2127811150 @default.
• W2285655593 cites W2143970578 @default.
• W2285655593 cites W2146375441 @default.
• W2285655593 cites W2147641326 @default.
• W2285655593 cites W2153637044 @default.
• W2285655593 cites W2168091755 @default.
• W2285655593 doi "https://doi.org/10.1074/jbc.m115.696831" @default.
• W2285655593 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/4865938" @default.
• W2285655593 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/27197236" @default.
• W2285655593 hasPublicationYear "2016" @default.
• W2285655593 type Work @default.
• W2285655593 sameAs 2285655593 @default.
• W2285655593 citedByCount "24" @default.
• W2285655593 countsByYear W22856555932017 @default.
• W2285655593 countsByYear W22856555932018 @default.
• W2285655593 countsByYear W22856555932019 @default.
• W2285655593 countsByYear W22856555932021 @default.
• W2285655593 countsByYear W22856555932022 @default.
• W2285655593 countsByYear W22856555932023 @default.
• W2285655593 crossrefType "journal-article" @default.
• W2285655593 hasAuthorship W2285655593A5018282904 @default.
• W2285655593 hasAuthorship W2285655593A5018513331 @default.
• W2285655593 hasAuthorship W2285655593A5019144458 @default.
• W2285655593 hasAuthorship W2285655593A5020231342 @default.
• W2285655593 hasAuthorship W2285655593A5020694375 @default.
• W2285655593 hasAuthorship W2285655593A5043876626 @default.
• W2285655593 hasAuthorship W2285655593A5051142807 @default.
• W2285655593 hasAuthorship W2285655593A5060424549 @default.
• W2285655593 hasAuthorship W2285655593A5062407037 @default.
• W2285655593 hasAuthorship W2285655593A5065859249 @default.
• W2285655593 hasAuthorship W2285655593A5069690158 @default.
• W2285655593 hasAuthorship W2285655593A5070879471 @default.
• W2285655593 hasAuthorship W2285655593A5076229181 @default.
• W2285655593 hasAuthorship W2285655593A5081449694 @default.
• W2285655593 hasBestOaLocation W22856555931 @default.
• W2285655593 hasConcept C104317684 @default.
• W2285655593 hasConcept C126619667 @default.
• W2285655593 hasConcept C185592680 @default.
• W2285655593 hasConcept C207332259 @default.
• W2285655593 hasConcept C2778301229 @default.
• W2285655593 hasConcept C2780298669 @default.
• W2285655593 hasConcept C512185932 @default.
• W2285655593 hasConcept C55493867 @default.
• W2285655593 hasConcept C62478195 @default.
• W2285655593 hasConcept C86803240 @default.
• W2285655593 hasConcept C95444343 @default.
• W2285655593 hasConceptScore W2285655593C104317684 @default.
• W2285655593 hasConceptScore W2285655593C126619667 @default.
• W2285655593 hasConceptScore W2285655593C185592680 @default.
• W2285655593 hasConceptScore W2285655593C207332259 @default.
• W2285655593 hasConceptScore W2285655593C2778301229 @default.

• next