FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2290697801> ?p ?o ?g. }

• W2290697801 endingPage "9086" @default.
• W2290697801 startingPage "9073" @default.
• W2290697801 abstract "B1 B cells secrete most of the circulating natural antibodies and are considered key effector cells of the innate immune response. However, B1 cell-associated antibodies often cross-react with self-antigens, which leads to autoimmunity, and B1 cells have been implicated in cancer. How B1 cell activity is regulated remains unclear. We show that the Ikaros transcription factor is a major negative regulator of B1 cell development and function. Using conditional knock-out mouse models to delete Ikaros at different locations, we show that Ikaros-deficient mice exhibit specific and significant increases in splenic and bone marrow B1 cell numbers, and that the B1 progenitor cell pool is increased ∼10-fold in the bone marrow. Ikaros-null B1 cells resemble WT B1 cells at the molecular and cellular levels, but show a down-regulation of signaling components important for inhibiting proliferation and immunoglobulin production. Ikaros-null B1 cells hyper-react to TLR4 stimulation and secrete high amounts of IgM autoantibodies. These results indicate that Ikaros is required to limit B1 cell homeostasis in the adult. B1 B cells secrete most of the circulating natural antibodies and are considered key effector cells of the innate immune response. However, B1 cell-associated antibodies often cross-react with self-antigens, which leads to autoimmunity, and B1 cells have been implicated in cancer. How B1 cell activity is regulated remains unclear. We show that the Ikaros transcription factor is a major negative regulator of B1 cell development and function. Using conditional knock-out mouse models to delete Ikaros at different locations, we show that Ikaros-deficient mice exhibit specific and significant increases in splenic and bone marrow B1 cell numbers, and that the B1 progenitor cell pool is increased ∼10-fold in the bone marrow. Ikaros-null B1 cells resemble WT B1 cells at the molecular and cellular levels, but show a down-regulation of signaling components important for inhibiting proliferation and immunoglobulin production. Ikaros-null B1 cells hyper-react to TLR4 stimulation and secrete high amounts of IgM autoantibodies. These results indicate that Ikaros is required to limit B1 cell homeostasis in the adult. B1 B cells are an important part of the innate immune response because they spontaneously secrete natural, polyreactive IgM antibodies in the absence of infection (1.Manohar V. Brown E. Leiserson W.M. Chused T.M. Expression of Lyt-1 by a subset of B lymphocytes.J. Immunol. 1982; 129: 532-538PubMed Google Scholar, 2.Hayakawa K. Hardy R.R. Parks D.R. Herzenberg L.A. The “Ly-1 B” cell subpopulation in normal immunodefective, and autoimmune mice.J. Exp. Med. 1983; 157: 202-218Crossref PubMed Scopus (674) Google Scholar). In the mouse, they differ from conventional B2 B cells (follicular and marginal zone) in that they do not express CD21 and CD23, and express only low levels of B220 and IgD but high levels of IgM. B1 cells are abundant in the peritoneal and pleural cavities where they can be further divided into B1a (CD19+CD5+CD11b+) and B1b (CD19+CD5−CD11b+) cells. Splenic B1 cells are CD19+CD43+CD5+. The majority of B1 cells develop early in utero from fetal liver progenitor cells, and they are maintained over time in the adult through self-renewal. However, Lin−CD93+CD19+B220lo bone marrow B1 progenitor cells have been identified (3.Montecino-Rodriguez E. Leathers H. Dorshkind K. Identification of a B-1 B cell-specified progenitor.Nat. Immunol. 2006; 7: 293-301Crossref PubMed Scopus (338) Google Scholar). In addition, B cell receptor (BCR) 6The abbreviations used are: BCRB cell receptorT-ALLT cell acute lymphoblastic lymphomas/leukemiasBMbone marrowFOfollicularMZmarginal zonePECperitoneal cavityTAMtamoxifen4OHT4-hydroxytamoxifenB-ALLB cell acute lymphoblastic leukemias. signal strength appears to be important for B1 cell generation, as strong signals increase B1 cell numbers and weak signals decrease their numbers (4.Lam K.P. Rajewsky K. B cell antigen receptor specificity and surface density together determine B-1 versus B-2 cell development.J. Exp. Med. 1999; 190: 471-477Crossref PubMed Scopus (185) Google Scholar, 5.Casola S. Otipoby K.L. Alimzhanov M. Humme S. Uyttersprot N. Kutok J.L. Carroll M.C. Rajewsky K. B cell receptor signal strength determines B cell fate.Nat. Immunol. 2004; 5: 317-327Crossref PubMed Scopus (461) Google Scholar). B cell receptor T cell acute lymphoblastic lymphomas/leukemias bone marrow follicular marginal zone peritoneal cavity tamoxifen 4-hydroxytamoxifen B cell acute lymphoblastic leukemias. Because natural antibodies are polyreactive, they also bind to self-antigens and contribute to autoimmunity, suggesting that B1 cells must be tightly regulated during homeostasis. In addition, because they comprise the first wave of B cell development, B1 cells may be linked to childhood leukemias. Work in recent years have begun to reveal a network of transcriptional regulators important for B1 cell development and function. Among them, members of the classical NFκB pathway (e.g. p50, Malt1, Carma1, Ikk complex), downstream of the BCR, have been shown to be essential for B1 cell development (6.Pedersen G.K. Adori M. Karlsson Hedestam G.B. NF-κB signaling in B-1 cell development.Ann. N.Y. Acad. Sci. 2015; 1362: 39-47Crossref PubMed Scopus (10) Google Scholar). The RNA-binding protein Lin28b, and its downstream effectors Let-7 and Arid3a, were revealed to promote fetal B1 cell lymphopoiesis (7.Yuan J. Nguyen C.K. Liu X. Kanellopoulou C. Muljo S.A. Lin28b reprograms adult bone marrow hematopoietic progenitors to mediate fetal-like lymphopoiesis.Science. 2012; 335: 1195-1200Crossref PubMed Scopus (238) Google Scholar, 8.Zhou Y. Li Y.S. Bandi S.R. Tang L. Shinton S.A. Hayakawa K. Hardy R.R. Lin28b promotes fetal B lymphopoiesis through the transcription factor Arid3a.J. Exp. Med. 2015; 212: 569-580Crossref PubMed Scopus (86) Google Scholar). Similarly, Ebf1 is required, and its overexpression induces B1 cell development at the expense of B2 cells (9.Györy I. Boller S. Nechanitzky R. Mandel E. Pott S. Liu E. Grosschedl R. Transcription factor Ebf1 regulates differentiation stage-specific signaling, proliferation, and survival of B cells.Genes Dev. 2012; 26: 668-682Crossref PubMed Scopus (104) Google Scholar, 10.Vilagos B. Hoffmann M. Souabni A. Sun Q. Werner B. Medvedovic J. Bilic I. Minnich M. Axelsson E. Jaritz M. Busslinger M. Essential role of EBF1 in the generation and function of distinct mature B cell types.J. Exp. Med. 2012; 209: 775-792Crossref PubMed Scopus (89) Google Scholar). In contrast, PU.1 (encoded by Spi1) has been reported to keep B2 cells from “switching” to the B1 cell lineage (11.Ye M. Ermakova O. Graf T. PU.1 is not strictly required for B cell development and its absence induces a B-2 to B-1 cell switch.J. Exp. Med. 2005; 202: 1411-1422Crossref PubMed Scopus (67) Google Scholar), and Pax5 and E2a (encoded by Tcf3) have been shown to be important for B2 cell identity (12.Cobaleda C. Schebesta A. Delogu A. Busslinger M. Pax5: the guardian of B cell identity and function.Nat. Immunol. 2007; 8: 463-470Crossref PubMed Scopus (440) Google Scholar, 13.Lin Y.C. Jhunjhunwala S. Benner C. Heinz S. Welinder E. Mansson R. Sigvardsson M. Hagman J. Espinoza C.A. Dutkowski J. Ideker T. Glass C.K. Murre C. A global network of transcription factors, involving E2A, EBF1 and Foxo1, that orchestrates B cell fate.Nat. Immunol. 2010; 11: 635-643Crossref PubMed Scopus (379) Google Scholar). Blimp1 (encoded by Prmd1) and Xbp1 are required for B1 (and B2) cell immunoglobulin secretion (14.Savitsky D. Calame K. B-1 B lymphocytes require Blimp-1 for immunoglobulin secretion.J. Exp. Med. 2006; 203: 2305-2314Crossref PubMed Scopus (74) Google Scholar), while Irf4 is required for IgM secretion by splenic B1 cells (15.Holodick N.E. Tumang J.R. Rothstein T.L. Immunoglobulin secretion by B1 cells: differential intensity and IRF4-dependence of spontaneous IgM secretion by peritoneal and splenic B1 cells.Eur. J. Immunol. 2010; 40: 3007-3016Crossref PubMed Scopus (51) Google Scholar). Interestingly, NFκB, Lin28b/Let-7/Arid3a, Ebf1, Blimp1, and Xbp1 all work to positively regulate B1 cell development and function. Regulators that limit B1 cell activity are still poorly understood. Ikaros, encoded by the Ikzf1 gene, is a zinc finger DNA-binding protein, that is a key transcriptional regulator and tumor suppressor in B cells. It is required for the specification and development of all B cell lineages (16.Wang J.H. Nichogiannopoulou A. Wu L. Sun L. Sharpe A.H. Bigby M. Georgopoulos K. Selective defects in the development of the fetal and adult lymphoid system in mice with an Ikaros null mutation.Immunity. 1996; 5: 537-549Abstract Full Text PDF PubMed Scopus (503) Google Scholar, 17.Allman D. Sambandam A. Kim S. Miller J.P. Pagan A. Well D. Meraz A. Bhandoola A. Thymopoiesis independent of common lymphoid progenitors.Nat. Immunol. 2003; 4: 168-174Crossref PubMed Scopus (450) Google Scholar), and plays specific roles in pre-pro-B and pre-B cells to activate RAG1,2 expression, mediate chromatin accessibility during immunoglobulin gene rearrangement and allelic exclusion at the Igk locus (18.Kirstetter P. Thomas M. Dierich A. Kastner P. Chan S. Ikaros is critical for B cell differentiation and function.Eur. J. Immunol. 2002; 32: 720-730Crossref PubMed Scopus (120) Google Scholar19.Liu Z. Widlak P. Zou Y. Xiao F. Oh M. Li S. Chang M.Y. Shay J.W. Garrard W.T. A recombination silencer that specifies heterochromatin positioning and ikaros association in the immunoglobulin κ locus.Immunity. 2006; 24: 405-415Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar, 20.Thompson E.C. Cobb B.S. Sabbattini P. Meixlsperger S. Parelho V. Liberg D. Taylor B. Dillon N. Georgopoulos K. Jumaa H. Smale S.T. Fisher A.G. Merkenschlager M. Ikaros DNA-binding proteins as integral components of B cell developmental-stage-specific regulatory circuits.Immunity. 2007; 26: 335-344Abstract Full Text Full Text PDF PubMed Scopus (141) Google Scholar, 21.Reynaud D. Demarco I.A. Reddy K.L. Schjerven H. Bertolino E. Chen Z. Smale S.T. Winandy S. Singh H. Regulation of B cell fate commitment and immunoglobulin heavy-chain gene rearrangements by Ikaros.Nat. Immunol. 2008; 9: 927-936Crossref PubMed Scopus (200) Google Scholar, 22.Heizmann B. Kastner P. Chan S. Ikaros is absolutely required for pre-B cell differentiation by attenuating IL-7 signals.J. Exp. Med. 2013; 210: 2823-2832Crossref PubMed Scopus (64) Google Scholar23.Schwickert T.A. Tagoh H. Gültekin S. Dakic A. Axelsson E. Minnich M. Ebert A. Werner B. Roth M. Cimmino L. Dickins R.A. Zuber J. Jaritz M. Busslinger M. Stage-specific control of early B cell development by the transcription factor Ikaros.Nat. Immunol. 2014; 15: 283-293Crossref PubMed Scopus (146) Google Scholar). In mature B2 cells, Ikaros directs Ig class switch recombination (24.Sellars M. Reina-San-Martin B. Kastner P. Chan S. Ikaros controls isotype selection during immunoglobulin class switch recombination.J. Exp. Med. 2009; 206: 1073-1087Crossref PubMed Scopus (58) Google Scholar). It functions both as a transcriptional repressor and activator, and acts at least in part through its association with Polycomb repressive complex 2 (25.Oravecz A. Apostolov A. Polak K. Jost B. Le Gras S. Chan S. Kastner P. Ikaros mediates gene silencing in T cells through Polycomb repressive complex 2.Nat. Commun. 2015; 6: 8823Crossref PubMed Scopus (45) Google Scholar), NuRD and SWI/SNF complexes (26.Kim J. Sif S. Jones B. Jackson A. Koipally J. Heller E. Winandy S. Viel A. Sawyer A. Ikeda T. Kingston R. Georgopoulos K. Ikaros DNA-binding proteins direct formation of chromatin remodeling complexes in lymphocytes.Immunity. 1999; 10: 345-355Abstract Full Text Full Text PDF PubMed Scopus (483) Google Scholar, 27.Sridharan R. Smale S.T. Predominant interaction of both Ikaros and Helios with the NuRD complex in immature thymocytes.J. Biol. Chem. 2007; 282: 30227-30238Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar). In pre-B cells, Ikaros activates the transcription of genes important for pre-BCR and BCR signaling, cell survival, and cell migration, as well as that of B cell regulators like Pax5, Foxo1, and Ebf1 (22.Heizmann B. Kastner P. Chan S. Ikaros is absolutely required for pre-B cell differentiation by attenuating IL-7 signals.J. Exp. Med. 2013; 210: 2823-2832Crossref PubMed Scopus (64) Google Scholar, 28.Ferreirós-Vidal I. Carroll T. Taylor B. Terry A. Liang Z. Bruno L. Dharmalingam G. Khadayate S. Cobb B.S. Smale S.T. Spivakov M. Srivastava P. Petretto E. Fisher A.G. Merkenschlager M. Genome-wide identification of Ikaros targets elucidates its contribution to mouse B-cell lineage specification and pre-B-cell differentiation.Blood. 2013; 121: 1769-1782Crossref PubMed Scopus (80) Google Scholar). Thus Ikaros modulates B cell function at multiple stages. Here, we reveal a novel function for Ikaros as a major negative regulator of B1 cell development and function in the adult bone marrow and spleen. The IkL/L and Ikf/f mouse lines have been described (18.Kirstetter P. Thomas M. Dierich A. Kastner P. Chan S. Ikaros is critical for B cell differentiation and function.Eur. J. Immunol. 2002; 32: 720-730Crossref PubMed Scopus (120) Google Scholar, 22.Heizmann B. Kastner P. Chan S. Ikaros is absolutely required for pre-B cell differentiation by attenuating IL-7 signals.J. Exp. Med. 2013; 210: 2823-2832Crossref PubMed Scopus (64) Google Scholar). IkL/L mice were backcrossed 10 generations onto the C57Bl/6 background and analyzed at 6–8 weeks of age. Ikf/f mice were crossed with CD21-Cre, CD19-Cre, or R26-CreERT2 tg animals (29.Rickert R.C. Roes J. Rajewsky K. B lymphocyte-specific, Cre-mediated mutagenesis in mice.Nucleic Acids Res. 1997; 25: 1317-1318Crossref PubMed Scopus (575) Google Scholar, 30.Kraus M. Alimzhanov M.B. Rajewsky N. Rajewsky K. Survival of resting mature B lymphocytes depends on BCR signaling via the Igα/β heterodimer.Cell. 2004; 117: 787-800Abstract Full Text Full Text PDF PubMed Scopus (440) Google Scholar31.Badea T.C. Wang Y. Nathans J. A noninvasive genetic/pharmacologic strategy for visualizing cell morphology and clonal relationships in the mouse.J. Neurosci. 2003; 23: 2314-2322Crossref PubMed Google Scholar). Ikaros was deleted in adult Ikf/f R26-CreERT2+ mice after daily intraperitoneal injections of tamoxifen (50 mg/kg weight of mouse, dissolved in sunflower oil) for 3 days. Female MRL/lpr mice were purchased from Harlan. FO B cells were sorted (B220+CD23hiCD21lo; >98% purity) on a FACSVantage S.E. option DiVa (BD Biosciences, San Jose, CA) or a FACSAria II SORP (BD Biosciences), or enriched by depletion of CD43+ cells followed by positive selection of CD23+ cells with MACS beads (>90% purity; Miltenyi Biotech, Bergisch Gladbach, Germany). Both methods gave similar results. B1 B cells were sorted (CD19+CD43+) on a FACSAria II SORP (BD Biosciences). For BM cultures, 1 × 106 CD19+ BM B cells were co-cultured on S17 stromal cells in Iscove's medium supplemented with 10% FCS, 2 mm l-glutamine, 1× non-essential amino acids, 50 μm 2-mercaptoethanol (2-ME), 1% antibiotics plus cytokines IL-7 (7% of supernatant from mIL-7 cDNA-transfected J558L cells), SCF (10 ng/ml; Peprotech, Rocky Hill, NJ) and Flt-3 ligand (2.5% of supernatant from mFlt3L cDNA-transfected B16 cells). For proliferation assays, cells were labeled with CFSE (5 μg/ml; Sigma) and 2.5–3 × 104 cells were cultured in complete medium (RPMI 1640, 10% FCS, 25 mm HEPES, 1 mm sodium pyruvate, 2 mm l-glutamine, 1× non-essential amino acids, 50 μm 2-ME, 1% antibiotics). Cells were stimulated with 10 μg/ml goat anti-mouse IgM F(ab′)2 (Jackson ImmunoResearch, West Grove, PA), 2–10 μg/ml mouse anti-CD40 (eBiosience, San Diego, CA), 10 ng/ml IL-4 (Peprotech), and 25 μg/ml LPS (Escherichia coli 0111:B4; Sigma). For intracellular staining cells were fixed with 2% paraformaldehyde (PFA) and permeabilized with methanol. For cell viability assays, DiOC6 (Molecular Probes, Eugene, OR) was added at 50 nm. For cell cycle staining, PFA fixed cells were permeabilized with 0.1% saponin, and stained with anti-Ki67-AF700 (BD Biosciences) and DAPI (2 μg/ml). The following reagents were used: anti-B220-PE-Cy7, anti-CD19-PerCP-Cy5.5, anti-CD21-APC or -FITC, anti-CD23-PE-Cy7, anti-CD43-FITC, -PECy7 or -PE, anti-IgD-FITC, anti-CD11b-APC, anti-TCRαβ-biotin, anti-TCRγδ-biotin, and streptavidin (SA)-APC-Cy7 from BD Biosciences; anti-CD16/32, anti-CD23-biotin, anti-CD3ϵ-biotin, anti-CD71-biotin, anti-Gr-1-biotin, anti-NK1.1-biotin, anti-CD8-biotin, anti-CD5-biotin, anti-CD5-FITC, and anti-CD93-APC from eBioscience; anti-CD59-biotin from BMA Biomedical (Augst, Switzerland); anti-IgM-PE, -FITC or -APC, and SA-PE from Jackson ImmunoResearch; anti-rabbit IgG (H+L)-biotin from Vector Laboratories (Burlingame, CA); SA-Alexa Fluor 405 and anti-rat IgG-Qdot 605 from Invitrogen (Carlsbad, CA). Lin− cells were defined by staining with a mixture of antibodies for mature hematopoietic lineage marker including CD3ϵ, CD11b, CD59, CD71, Gr-1, NK1.1, TCRαβ, TCRγδ, CD8, and IgM. Cells were analyzed with a FACSCalibur and FACS LSR II (BD Biosciences) and FlowJo software (TreeStar, Ashland, OR). ELISAs of sera were performed as described (33.Lacotte S. Dumortier H. Décossas M. Briand J.P. Muller S. Identification of new pathogenic players in lupus: autoantibody-secreting cells are present in nephritic kidneys of (NZBxNZW)F1 mice.J. Immunol. 2010; 184: 3937-3945Crossref PubMed Scopus (26) Google Scholar). Briefly, polystyrene plates (MaxiSorb; Nunc, Rochester, NY) were coated ON at 37 °C with the following antigens: dsDNA (100 ng/ml in 25 mm citrate buffer, pH 5.4; Sigma) and mouse chromatin extracted and purified from mouse lymphocytic leukemia cells L1210 (200 ng/ml expressed as dsDNA concentration in PBS, pH 7.2). Mouse sera (diluted 1:250 in PBS containing 0.05% Tween-20 (T) and 1% BSA) were added for 1 h, followed by goat anti-mouse IgG (diluted 1:2 × 104 in PBS-T; Fcγ specific; Jackson ImmunoResearch) supplemented with goat anti-mouse IgG3 (diluted 1:7,500; Fcγ specific; Nordic Immunology, Tilburg, Netherlands) or by goat anti-mouse IgM (diluted 1:2 × 104; μ chain specific F(ab′)2; Jackson ImmunoResearch) conjugated to horseradish peroxidase. After a 30-min incubation at 37 °C, H2O2 and 3,3′,5,5′-tetramethyl benzidine were added as substrate and chromogen, respectively, for 15 min. The reaction was stopped, and the absorbance was measured at 450 nm. For ELISAs of cell culture supernatants, polystyrene plates (MaxiSorb; Nunc) were coated overnight at 4 °C with the following antigens: salmon dsDNA (100 μg/ml in PBS, pH 7.2; Sigma) or mouse chromatin (15 μg/ml) extracted and purified from total mouse splenocytes as described (34.Huang J. Huen M.S. Kim H. Leung C.C. Glover J.N. Yu X. Chen J. RAD18 transmits DNA damage signalling to elicit homologous recombination repair.Nat. Cell Biol. 2009; 11: 592-603Crossref PubMed Scopus (224) Google Scholar). Plates were blocked with 3% BSA in PBS containing 0.05% Tween-20 1h at 37 °C. Supernatants (undiluted) or mouse sera (diluted 1:250 in PBS containing 0.05% Tween-20 and 1% BSA) were added for 2 h at room temperature followed by goat anti-mouse IgM (diluted 1:2 × 104; μ chain specific F(ab′)2; Jackson ImmunoResearch) conjugated to alkaline phosphatase. After a 2-h incubation at room temperature, p-nitrophenyl phosphate was added as substrate for 20 min and the absorbance measured at 405 nm. Assays were performed by indirect immunofluorescence with HEp-2 cells (HEp-2 substrate slides; Zeus Scientific, Raritan, NJ). HEp-2 cell-coated slides were incubated for 30 min at room temperature with diluted sera, washed 2× in PBS and visualized by fluorescence microscopy with FITC-labeled anti-mouse IgG or IgM (1:100). Controls included negative and positive sera from BALB/c and MRL/lpr mice, respectively. Whole cell lysates were separated by SDS-PAGE and transferred to PVDF membranes (Millipore, Billerica, MA). The following antibodies were used: anti-Ikaros (rabbit polyclonal antibody generated against the C terminus of Ikaros; in-house), anti-β-actin (Sigma), anti-rabbit, and anti-mouse HRP (Jackson Immunoresearch). Blots were revealed with Immobilon Western Chemiluminescent HRP substrate (Millipore). RNA was extracted using RNeasy kit (Qiagen, Hombrechtikon, Switzerland). RNA was reverse described with Superscript Reverse Transcriptase (Invitrogen). RT-qPCR was performed with 1 cycle at 95 °C for 15 min, then 50 cycles of 95 °C for 10 s, 60 °C or 63 °C for 10 s and 72 °C for 15 s with SYBR Green PCR MasterMix (Sigma or Roche) on an LC480 light cycler (Roche, Basel, Switzerland). The following primers were used: Irf4 (5′-AAGGCAAGTT CCGAGAAGGG, 5′-TTATGAACCTGCTGGGCT GG), Pax5 (5′-CAGATGTAGTCCGCCAAAGGATAG, 5′-ATGC CACTGATGGAGTATGAGGAG CC), Tcf3 (5′-ATACAGCGAAGGTGCCCACT, 5′-CTCAAGGT GCCAACACTGGT), Ebf1 (5′-CTA TGTGCGC CTCATCGACT, 5′-CATGATCTCGT GTGTGAG CAA), Rapgef4 (5′-CAAGGAGAATGTCCCTTC AGAGA, 5′-CCGCGAGTGAACACAGGAT), Nrp2 (5′-GACTTCATTGAGATTCGGGATGG, 5′-AACTTGATGTATAACACGGAGCC), Tmem176b (5′-ACTGTCCGGCCAGGTATCAT, 5′-TGCCTGATTAAGCTGTTCACAC), Gna15 (5′-AAGAGCGCGAGGAATTGAAAC, 5′-GAGTA GCCCACACCGTGAATG), Slamf9 (5′-TTCAA AACAACATTGCCATCGTG, 5′-CCCAGGTCAG ATTGCTAATATGC), Bcl2 (5′-GTCGCTACCGT CGTGACTTC, 5′-CAGACATGCACCTACCCA GC), Bcl2l1 (5′-GACAAGGAGATGCAGGTATT GG, 5′-TCCCGTAGAGATCCACAAAAGT). The primers for Spi1 (11.Ye M. Ermakova O. Graf T. PU.1 is not strictly required for B cell development and its absence induces a B-2 to B-1 cell switch.J. Exp. Med. 2005; 202: 1411-1422Crossref PubMed Scopus (67) Google Scholar), Prmd1 and Xbp1 (14.Savitsky D. Calame K. B-1 B lymphocytes require Blimp-1 for immunoglobulin secretion.J. Exp. Med. 2006; 203: 2305-2314Crossref PubMed Scopus (74) Google Scholar), Slpi (35.Nakamura A. Mori Y. Hagiwara K. Suzuki T. Sakakibara T. Kikuchi T. Igarashi T. Ebina M. Abe T. Miyazaki J. Takai T. Nukiwa T. Increased susceptibility to LPS-induced endotoxin shock in secretory leukoprotease inhibitor (SLPI)-deficient mice.J. Exp. Med. 2003; 197: 669-674Crossref PubMed Scopus (112) Google Scholar), Tyrobp (36.Weigelt K. Ernst W. Walczak Y. Ebert S. Loenhardt T. Klug M. Rehli M. Weber B.H. Langmann T. Dap12 expression in activated microglia from retinoschisin-deficient retina and its PU.1-dependent promoter regulation.J Leukoc Biol. 2007; 82: 1564-1574Crossref PubMed Scopus (31) Google Scholar), Pirb (37.Arita K. Endo S. Kaifu T. Kitaguchi K. Nakamura A. Ohmori H. Kohu K. Satake M. Takai T. Transcriptional activation of the Pirb gene in B cells by PU.1 and Runx3.J. Immunol. 2011; 186: 7050-7059Crossref PubMed Scopus (9) Google Scholar), Mcl1 (38.Hernández P.P. Mahlakõiv T. Yang I. Schwierzeck V. Nguyen N. Guendel F. Gronke K. Ryffel B. Hölscher C. Dumoutier L. Renauld J.C. Suerbaum S. Staeheli P. Diefenbach A. Interferon-lambda and interleukin 22 act synergistically for the induction of interferon-stimulated genes and control of rotavirus infection.Nat Immunol. 2015; 16: 698-707Crossref PubMed Scopus (213) Google Scholar), Ikzf1, and Hprt (22.Heizmann B. Kastner P. Chan S. Ikaros is absolutely required for pre-B cell differentiation by attenuating IL-7 signals.J. Exp. Med. 2013; 210: 2823-2832Crossref PubMed Scopus (64) Google Scholar) were used as described. Total RNA was extracted with the RNeasy Micro kit (Qiagen). RNA quality was verified with a 2100 Bioanalyzer (Agilent, Santa Clara, CA). Biotinylated single strand cDNA targets were prepared from 150 ng of total RNA with the Ambion WT Expression Kit and the Affymetrix GeneChip® WT Terminal Labeling Kit. After fragmentation and end-labeling, 1.9 μg of cDNAs were hybridized to Affymetrix GeneChip® Mouse Gene 1.0 ST arrays using standard procedures. Raw data were processed with the Robust Multiarray Average (RMA) algorithm. Microarray data are available in the GEO Data Bank (GSE 75827). The ChIP protocol was adapted from the Millipore ChIP Assay Kit (17–295) with minor modifications and described (25.Oravecz A. Apostolov A. Polak K. Jost B. Le Gras S. Chan S. Kastner P. Ikaros mediates gene silencing in T cells through Polycomb repressive complex 2.Nat. Commun. 2015; 6: 8823Crossref PubMed Scopus (45) Google Scholar). Shortly, BH1-Ik1-ER-Bcl2 pre-B cells (22.Heizmann B. Kastner P. Chan S. Ikaros is absolutely required for pre-B cell differentiation by attenuating IL-7 signals.J. Exp. Med. 2013; 210: 2823-2832Crossref PubMed Scopus (64) Google Scholar) were treated with 4OHT for 24 h in the absence of IL-7 to induce Ikaros function. After crosslinking, the chromatin was sonicated to 300–500 bp using a Bioruptor 200 (Diagenode, Denville, NJ) and cleared by centrifugation. After pre-cleaning with protein A-Sepharose, the lysate was incubated overnight with the anti-Ikaros antibody. Precipitation was carried out using protein A-magnetic beads. De-crosslinked DNA was purified using the iPure Kit (Diagenode). ChIP-sequencing was performed as described (25.Oravecz A. Apostolov A. Polak K. Jost B. Le Gras S. Chan S. Kastner P. Ikaros mediates gene silencing in T cells through Polycomb repressive complex 2.Nat. Commun. 2015; 6: 8823Crossref PubMed Scopus (45) Google Scholar). To evaluate mature B cell populations in vivo, we first analyzed IkL/L mice carrying a germline hypomorphic Ikzf1 mutation. IkL/L cells express functional Ikaros proteins at ∼10% of levels detected in WT cells (18.Kirstetter P. Thomas M. Dierich A. Kastner P. Chan S. Ikaros is critical for B cell differentiation and function.Eur. J. Immunol. 2002; 32: 720-730Crossref PubMed Scopus (120) Google Scholar, 39.Dumortier A. Jeannet R. Kirstetter P. Kleinmann E. Sellars M. dos Santos N.R. Thibault C. Barths J. Ghysdael J. Punt J.A. Kastner P. Chan S. Notch activation is an early and critical event during T-cell leukemogenesis in Ikaros-deficient mice.Mol. Cell. Biol. 2006; 26: 209-220Crossref PubMed Scopus (131) Google Scholar). Although IkL/L mice die from T cell-acute lymphoblastic lymphomas/leukemias (T-ALL) at 4–6 months of age, the animals used here (6–8 weeks old) showed no signs of transformation in the thymus, as defined by CD4 and CD8 profiling, T cell receptor Vα and Vβ chain usage, and the absence of a deregulated Notch pathway (39.Dumortier A. Jeannet R. Kirstetter P. Kleinmann E. Sellars M. dos Santos N.R. Thibault C. Barths J. Ghysdael J. Punt J.A. Kastner P. Chan S. Notch activation is an early and critical event during T-cell leukemogenesis in Ikaros-deficient mice.Mol. Cell. Biol. 2006; 26: 209-220Crossref PubMed Scopus (131) Google Scholar, 40.Kleinmann E. Geimer Le Lay A.S. Sellars M. Kastner P. Chan S. Ikaros represses the transcriptional response to Notch signaling in T-cell development.Mol. Cell. Biol. 2008; 28: 7465-7475Crossref PubMed Scopus (65) Google Scholar). In addition, mice with B cell-specific null mutations for Ikzf1 were analyzed (22.Heizmann B. Kastner P. Chan S. Ikaros is absolutely required for pre-B cell differentiation by attenuating IL-7 signals.J. Exp. Med. 2013; 210: 2823-2832Crossref PubMed Scopus (64) Google Scholar). Ikf/f mice were crossed with CD19-Cre tg animals to activate the Cre recombinase from the bone marrow (BM) pro-B cell stage, and with CD21-Cre tg mice to activate Cre activity from the splenic T2 B cell stage (29.Rickert R.C. Roes J. Rajewsky K. B lymphocyte-specific, Cre-mediated mutagenesis in mice.Nucleic Acids Res. 1997; 25: 1317-1318Crossref PubMed Scopus (575) Google Scholar, 30.Kraus M. Alimzhanov M.B. Rajewsky N. Rajewsky K. Survival of resting mature B lymphocytes depends on BCR signaling via the Igα/β heterodimer.Cell. 2004; 117: 787-800Abstract Full Text Full Text PDF PubMed Scopus (440) Google Scholar, 32.Srinivas S. Watanabe T. Lin C.S. William C.M. Tanabe Y. Jessell T.M. Costantini F. Cre reporter strains produced by targeted insertion of EYFP and ECFP into the ROSA26 locus.BMC Dev. Biol. 2001; 1: 4Crossref PubMed Scopus (2305) Google Scholar). Deletion of the floxed Ikzf1 alleles at these stages did not grossly affect B cell differentiation in the BM, although Ikf/f CD19-Cre+ (CD19 cKO) mice showed an increase in pro- and large pre-B cells and a corresponding decrease in B220+CD43− cells, suggesting a bottleneck in differentiation, in line with the requirement for Ikaros in pre-B cell development (Fig. 1A) (22.Heizmann B. Kastner P. Chan S. Ikaros is absolutely required for pre-B cell differentiation by attenuating IL-7 signals.J. Exp. Med. 2013; 210: 2823-2832Crossref PubMed Scopus (64) Google Scholar). In the spleen, Ikaros proteins were detected in WT B cell populations (Fig. 1B) (22.Heizmann B. Kastner P. Chan S. Ikaros is absolutely required for pre-B cell differentiation by attenuating IL-7 signals.J. Exp. Med. 2013; 210: 2823-2832Crossref PubMed Scopus (64) Google Scholar), but they were selectively absent in splenic B cells of both CD19 cKO and Ikf/f CD21-Cre+ (CD21 cKO) mice (Fig. 1C). Splenic B cell populations were analyzed in the different mutant mice by flow cytometry. While total splenocyte numbers were reduced in IkL/L mice, as previously described (18.Kirstetter P. Thomas M. Dierich A. Kastner P. Chan S. Ikaros is critical for B cell differentiation and function.Eur. J. Immunol. 2002; 32: 720-730Crossref PubMed Scopus (120) Google Scholar), they were slightly increased or similar in CD19 and CD21 cKO animals, respectively, compared with control mice (Fig. 1D). CD19+ B cells were also reduced in the IkL/L spleens but not in the cKO organs, suggesting that mature B cell numbers in general are not directly affected by Ikaros loss (Fig. 1D). Nonetheless, some B cell subsets were altered (Fig. 1, E and F). IkL/L spleens contained less CD19+CD21loCD23hi follicular (FO) but more CD19+CD21hiCD23lo marginal zone (MZ) B cells, while cKO spleens contained" @default.
• W2290697801 created "2016-06-24" @default.
• W2290697801 creator A5003904292 @default.
• W2290697801 creator A5020972410 @default.
• W2290697801 creator A5031644471 @default.
• W2290697801 creator A5045670409 @default.
• W2290697801 creator A5047130487 @default.
• W2290697801 creator A5052971123 @default.
• W2290697801 creator A5058133935 @default.
• W2290697801 creator A5084882779 @default.
• W2290697801 creator A5089651460 @default.
• W2290697801 date "2016-04-01" @default.
• W2290697801 modified "2023-10-18" @default.
• W2290697801 title "Ikaros Is a Negative Regulator of B1 Cell Development and Function" @default.
• W2290697801 cites W1538926863 @default.
• W2290697801 cites W1793506120 @default.
• W2290697801 cites W1829141962 @default.
• W2290697801 cites W1935937600 @default.
• W2290697801 cites W1964539717 @default.
• W2290697801 cites W1968346082 @default.
• W2290697801 cites W1968373260 @default.
• W2290697801 cites W1973638185 @default.
• W2290697801 cites W1982905137 @default.
• W2290697801 cites W1985187876 @default.
• W2290697801 cites W1985772010 @default.
• W2290697801 cites W1987529064 @default.
• W2290697801 cites W1989067124 @default.
• W2290697801 cites W1989645452 @default.
• W2290697801 cites W2000270871 @default.
• W2290697801 cites W2001797125 @default.
• W2290697801 cites W2008418299 @default.
• W2290697801 cites W2009442193 @default.
• W2290697801 cites W2011211211 @default.
• W2290697801 cites W2019881883 @default.
• W2290697801 cites W2021740276 @default.
• W2290697801 cites W2022586694 @default.
• W2290697801 cites W2027226325 @default.
• W2290697801 cites W2031580483 @default.
• W2290697801 cites W2039739637 @default.
• W2290697801 cites W2040296648 @default.
• W2290697801 cites W2059911212 @default.
• W2290697801 cites W2061307900 @default.
• W2290697801 cites W2061372381 @default.
• W2290697801 cites W2075130635 @default.
• W2290697801 cites W2076826608 @default.
• W2290697801 cites W2081870862 @default.
• W2290697801 cites W2082849113 @default.
• W2290697801 cites W2086816939 @default.
• W2290697801 cites W2088907802 @default.
• W2290697801 cites W2093984973 @default.
• W2290697801 cites W2098712005 @default.
• W2290697801 cites W2099752901 @default.
• W2290697801 cites W2109627278 @default.
• W2290697801 cites W2111589879 @default.
• W2290697801 cites W2114959940 @default.
• W2290697801 cites W2117001717 @default.
• W2290697801 cites W2119973905 @default.
• W2290697801 cites W2122510983 @default.
• W2290697801 cites W2122571618 @default.
• W2290697801 cites W2126766896 @default.
• W2290697801 cites W2127149724 @default.
• W2290697801 cites W2128587758 @default.
• W2290697801 cites W2136858141 @default.
• W2290697801 cites W2149589020 @default.
• W2290697801 cites W2151546344 @default.
• W2290697801 cites W2152501554 @default.
• W2290697801 cites W2153596758 @default.
• W2290697801 cites W2153622268 @default.
• W2290697801 cites W2154888744 @default.
• W2290697801 cites W2155011488 @default.
• W2290697801 cites W2159136295 @default.
• W2290697801 cites W2161179716 @default.
• W2290697801 cites W2165133752 @default.
• W2290697801 cites W2166773843 @default.
• W2290697801 cites W2191507484 @default.
• W2290697801 cites W811079526 @default.
• W2290697801 doi "https://doi.org/10.1074/jbc.m115.704239" @default.
• W2290697801 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/4861476" @default.
• W2290697801 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/26841869" @default.
• W2290697801 hasPublicationYear "2016" @default.
• W2290697801 type Work @default.
• W2290697801 sameAs 2290697801 @default.
• W2290697801 citedByCount "20" @default.
• W2290697801 countsByYear W22906978012018 @default.
• W2290697801 countsByYear W22906978012019 @default.
• W2290697801 countsByYear W22906978012020 @default.
• W2290697801 countsByYear W22906978012021 @default.
• W2290697801 countsByYear W22906978012022 @default.
• W2290697801 countsByYear W22906978012023 @default.
• W2290697801 crossrefType "journal-article" @default.
• W2290697801 hasAuthorship W2290697801A5003904292 @default.
• W2290697801 hasAuthorship W2290697801A5020972410 @default.
• W2290697801 hasAuthorship W2290697801A5031644471 @default.
• W2290697801 hasAuthorship W2290697801A5045670409 @default.
• W2290697801 hasAuthorship W2290697801A5047130487 @default.
• W2290697801 hasAuthorship W2290697801A5052971123 @default.
• W2290697801 hasAuthorship W2290697801A5058133935 @default.
• W2290697801 hasAuthorship W2290697801A5084882779 @default.

• next