FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2335103587> ?p ?o ?g. }

• W2335103587 endingPage "e61" @default.
• W2335103587 startingPage "e59" @default.
• W2335103587 abstract "Urinary CXCL9 and CXCL10 levels have been described as up-regulated in kidney transplant recipients (KTRs) during acute rejection (AR), suggesting that urinary CXCR3-binding chemokines may be of predictive and diagnostic value (1, 2). Indeed, high pretransplant serum CXCL9 and CXCL10 levels were found to be associated with lower 5-year graft survival rates and AR within the first year after kidney transplantation, a finding interpreted as suggesting that pretransplant CXCR3-binding chemokine assessment may identify patients at risk for AR and graft loss (3, 4). In the latter two studies, KTRs receiving induction therapy were excluded from the analysis, potentially obscuring the clinical usefulness of these findings, because the majority of KTRs now receive some form of induction therapy (5). To address this issue, we have investigated whether pretransplant serum CXCL9 and CXCL10 levels are also predictive for AR in KTRs receiving basiliximab or alemtuzumab induction therapy as risk stratification based on biomarkers is of great potential benefit for KTRs. Sixty-four KTRs, 44 receiving basiliximab, tacrolimus, and steroids, with azathioprine or mycophenolate mofetil, and 20 receiving alemtuzumab, tacrolimus, and mycophenolate mofetil were enrolled. Of this cohort, 10 patients experienced a biopsy-proven AR episode and 2 patients had an AR episode diagnosed by clinical criteria without biopsy confirmation within the first year after transplantation. Pretransplant serum samples were assayed in duplicate for CXCL9 and CXCL10 levels by enzyme-linked immunosorbent assay (R&D Systems, Abingdon, UK) following the manufacturer's instructions. Total leukocyte CXCR3 (ABI assay ID Hs00171041 m1) and hypoxanthine phosphoribosyltransferase (HPRT) (forward primer TGCTTTCCTTGGTCAGGCAGTA, reverse primer TCCAACAAAGTCTGGCTTATATCCA, and probe TCAAGGTCGCAAGCTTGCTGGTGAAA) gene expression were determined using standard real-time reverse-transcriptase polymerase chain reaction techniques. For statistical analysis, the Mann-Whitney U test was used, and P values less than 0.05 were considered significant. Results in the text are expressed as mean±standard deviation. Pretransplant demographics were similar between patients with and without AR, except for gender distribution (data not shown). End-stage renal disease patients had significantly higher CXCL9 levels and similar CXCL10 levels compared with healthy controls (data not shown). When patients were grouped based on the occurrence of AR within 1 year after transplantation, no significant difference in CXCL9 levels (296.4±452.9 vs. 150.1±88.4, P=not significant; Fig. 1A) or CXCL10 levels (158.2±91.2 vs. 103.2±32.9, P=not significant; Fig. 1B) between nonrejecting patients and patients with AR was observed.FIGURE 1.: Pretransplant serum CXCL9 and CXCL10 levels are not associated with acute rejection (AR) within the first year after transplantation in kidney transplant recipients (KTRs) treated with alemtuzumab or basiliximab induction therapy. (A) Pretransplant CXCL9 and (B) CXCL10 levels were similar in KTRs experiencing an AR episode within the first year after transplantation (n=12), compared with patients who did not experience AR (n=52). Horizontal bars indicate mean values. (C) Published cutoff levels fail to define patients at risk for AR (4). Dashed lines represent cutoff levels for CXCL9 and CXCL10 (272.1 and 133.2 pg/mL, respectively). Open triangles represent patients experiencing an AR episode within the first year after transplantation; closed circles represent patients who did not experience an AR episode. (D) Alemtuzumab induction therapy efficiently depletes lymphocytes. The absolute number of lymphocytes from alemtuzumab-treated kidney transplant recipients were obtained from clinical laboratory reports (n=3). (E) Alemtuzumab diminishes CXCR3 expression levels in peripheral blood. Total leukocyte gene expression of CXCR3 normalized for expression of the household gene HPRT was determined by reverse-transcriptase polymerase chain reaction in renal transplant patients receiving alemtuzumab induction therapy before and up to 12 weeks after transplantation (n=3).Rotondi et al. (4) described cutoff values for CXCL9 and CXCL10 of 272.1 and 133.2 pg/mL, respectively, as useful for identifying patients with higher immunologic risk. To explore the lack of predictive value of CXCL9 and CXCL10 levels for AR in the patient cohort analyzed in this study, separately and combined, we stratified into high and low CXCL9 and CXCL10 levels based on these cutoff values. Only 1 patient had high CXCL9 levels, 20 patients had high CXCL10 levels, and 11 patients had high levels of both (Fig. 1C). The sole patient with high CXCL9 levels did not develop AR, whereas two patients with high CXCL10 levels (10%) and one patient with high levels of both (9%) experienced AR. For the patients with only high CXCL10 levels, it should be noted that CXCL10 levels were just above the cutoff (133.4 and 147.1 pg/mL, respectively). The finding that CXCR3-binding chemokine levels fail to predict AR in alemtuzumab-treated KTRs may be explained by the rapid lymphocyte depletion (6) (Fig. 1D). Consequently, cells responsive to CXCL9 and CXCL10 are lost, confirmed by decreased CXCR3 gene expression (Fig. 1E). Basiliximab does not cause lymphocyte depletion but impairs T-cell activation by interleukin- 2Rα-chain blockade (7). Because activation is required for CXCR3 expression (8), basiliximab may prevent CXCR3 expression, rendering T cells unresponsive to CLCL9 and CXCL10 signaling. At the time of writing, two patients lost their grafts, one because of AR and one because of cytomegalovirus infection. The former had CXCL9 and CXCL10 levels below the cutoff values, and the latter had CXCL10 levels above the cutoff value (205.9 pg/mL). The demonstration that pretransplant serum CXCL9 and CXCL10 levels failed to predict AR in patients receiving basiliximab or alemtuzumab induction therapy stresses the importance of performing biomarker studies in patients receiving different immunosuppressive regimens. To be widely applicable, any biomarker should be capable of defining patients at risk irrespective of the immunosuppressive regimen. Sebastiaan Heidt1 Sushma Shankar1 Anand S.R. Muthusamy2 David San Segundo1 Kathryn J. Wood1 1 Transplant Research Immunology Group Nuffield Department of Surgical Sciences University of Oxford Oxford, United Kingdom 2 Oxford Transplant Centre Nuffield Department of Surgical Sciences University of Oxford Oxford, United Kingdom" @default.
• W2335103587 created "2016-06-24" @default.
• W2335103587 creator A5017033909 @default.
• W2335103587 creator A5050506872 @default.
• W2335103587 creator A5060617394 @default.
• W2335103587 creator A5077981386 @default.
• W2335103587 creator A5080127337 @default.
• W2335103587 date "2011-04-27" @default.
• W2335103587 modified "2023-10-14" @default.
• W2335103587 title "Pretransplant Serum CXCL9 and CXCL10 Levels Fail to Predict Acute Rejection in Kidney Transplant Recipients Receiving Induction Therapy" @default.
• W2335103587 cites W1500954694 @default.
• W2335103587 cites W1556405737 @default.
• W2335103587 cites W1786912546 @default.
• W2335103587 cites W1918207093 @default.
• W2335103587 cites W2040206548 @default.
• W2335103587 cites W2046591654 @default.
• W2335103587 cites W2115083462 @default.
• W2335103587 cites W2315162536 @default.
• W2335103587 doi "https://doi.org/10.1097/tp.0b013e318210de6b" @default.
• W2335103587 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/21475065" @default.
• W2335103587 hasPublicationYear "2011" @default.
• W2335103587 type Work @default.
• W2335103587 sameAs 2335103587 @default.
• W2335103587 citedByCount "17" @default.
• W2335103587 countsByYear W23351035872012 @default.
• W2335103587 countsByYear W23351035872013 @default.
• W2335103587 countsByYear W23351035872014 @default.
• W2335103587 countsByYear W23351035872015 @default.
• W2335103587 countsByYear W23351035872016 @default.
• W2335103587 countsByYear W23351035872019 @default.
• W2335103587 countsByYear W23351035872020 @default.
• W2335103587 countsByYear W23351035872021 @default.
• W2335103587 countsByYear W23351035872023 @default.
• W2335103587 crossrefType "journal-article" @default.
• W2335103587 hasAuthorship W2335103587A5017033909 @default.
• W2335103587 hasAuthorship W2335103587A5050506872 @default.
• W2335103587 hasAuthorship W2335103587A5060617394 @default.
• W2335103587 hasAuthorship W2335103587A5077981386 @default.
• W2335103587 hasAuthorship W2335103587A5080127337 @default.
• W2335103587 hasConcept C126322002 @default.
• W2335103587 hasConcept C126894567 @default.
• W2335103587 hasConcept C12823836 @default.
• W2335103587 hasConcept C13373296 @default.
• W2335103587 hasConcept C17502307 @default.
• W2335103587 hasConcept C203014093 @default.
• W2335103587 hasConcept C25532541 @default.
• W2335103587 hasConcept C2776914184 @default.
• W2335103587 hasConcept C2777630719 @default.
• W2335103587 hasConcept C2779338263 @default.
• W2335103587 hasConcept C2780303639 @default.
• W2335103587 hasConcept C2780653079 @default.
• W2335103587 hasConcept C2781307858 @default.
• W2335103587 hasConcept C2909675724 @default.
• W2335103587 hasConcept C2911091166 @default.
• W2335103587 hasConcept C5858377 @default.
• W2335103587 hasConcept C71924100 @default.
• W2335103587 hasConcept C90924648 @default.
• W2335103587 hasConceptScore W2335103587C126322002 @default.
• W2335103587 hasConceptScore W2335103587C126894567 @default.
• W2335103587 hasConceptScore W2335103587C12823836 @default.
• W2335103587 hasConceptScore W2335103587C13373296 @default.
• W2335103587 hasConceptScore W2335103587C17502307 @default.
• W2335103587 hasConceptScore W2335103587C203014093 @default.
• W2335103587 hasConceptScore W2335103587C25532541 @default.
• W2335103587 hasConceptScore W2335103587C2776914184 @default.
• W2335103587 hasConceptScore W2335103587C2777630719 @default.
• W2335103587 hasConceptScore W2335103587C2779338263 @default.
• W2335103587 hasConceptScore W2335103587C2780303639 @default.
• W2335103587 hasConceptScore W2335103587C2780653079 @default.
• W2335103587 hasConceptScore W2335103587C2781307858 @default.
• W2335103587 hasConceptScore W2335103587C2909675724 @default.
• W2335103587 hasConceptScore W2335103587C2911091166 @default.
• W2335103587 hasConceptScore W2335103587C5858377 @default.
• W2335103587 hasConceptScore W2335103587C71924100 @default.
• W2335103587 hasConceptScore W2335103587C90924648 @default.
• W2335103587 hasIssue "8" @default.
• W2335103587 hasLocation W23351035871 @default.
• W2335103587 hasLocation W23351035872 @default.
• W2335103587 hasOpenAccess W2335103587 @default.
• W2335103587 hasPrimaryLocation W23351035871 @default.
• W2335103587 hasRelatedWork W2032759048 @default.
• W2335103587 hasRelatedWork W2335103587 @default.
• W2335103587 hasRelatedWork W2417597819 @default.
• W2335103587 hasRelatedWork W2540384661 @default.
• W2335103587 hasRelatedWork W2773607685 @default.
• W2335103587 hasRelatedWork W2898973131 @default.
• W2335103587 hasRelatedWork W3031156917 @default.
• W2335103587 hasRelatedWork W4240284178 @default.
• W2335103587 hasRelatedWork W4281959460 @default.
• W2335103587 hasRelatedWork W4385792693 @default.
• W2335103587 hasVolume "91" @default.
• W2335103587 isParatext "false" @default.
• W2335103587 isRetracted "false" @default.
• W2335103587 magId "2335103587" @default.
• W2335103587 workType "article" @default.