FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2337652093> ?p ?o ?g. }

• W2337652093 endingPage "813" @default.
• W2337652093 startingPage "808" @default.
• W2337652093 abstract "MYD88 mutations are expressed in Waldenstrom Macroglobulinaemia (WM) (95–97%), immune-privileged lymphomas (50–80%), activated B-cell (ABC) subtype of diffuse large B-cell lymphoma (DLBCL) (15–30%), marginal zone lymphoma (6–10%) and chronic lymphocytic leukaemia (CLL) (3–8%) (Montesinos-Rongeri et al, 2011; Ngo et al, 2011; Pasqualucci et al, 2011; Puente et al, 2011; Treon et al, 2012; Martínez et al, 2014). In WM, nearly all cases express the MYD88L265P mutation (Treon et al, 2012); 50–80% of IgM MGUS patients express MYD88L265P by allele-specific polymerase chain reaction, and its expression is associated with an increased risk of malignant progression (Varettoni et al, 2013; Xu et al, 2013). The importance of mutated MYD88 in supporting tumour cell survival in ABC DLBCL and WM was established by MYD88 gene knock-down and/or over-expression studies (Ngo et al, 2011; Treon et al, 2012; Yang et al, 2013). MYD88 dimerization is necessary for assembly of the Myddosome, a structure composed of MYD88 dimers that recruit and activate interleukin-1 receptor-associated kinase (IRAK) 4, which in turn recruits and activates IRAK1 or 2. The MYD88:IRAK4:IRAK1/2 complex can then trigger canonical nuclear factor-kappa B (NFκB) growth and survival signalling (Ngo et al, 2011; Yang et al, 2013). The Myddosome can also activate Bruton Tyrosine Kinase (BTK), which can promote canonical NFκB signalling in mutated MYD88 WM cells (Yang et al, 2013). The MYD88 protein is composed of an N-terminal death domain (DD) spanning amino acids 40-119, an intermediate linker domain (ID) that spans amino acids 120–173, and a C-terminal Toll/IL1 receptor (TIR) domain that encompasses amino acids 174–309 (NCBI NP_002459.2). Upon ligand binding to TLR/IL1R, the TIR domain facilitates binding to the receptor complex, and promotes MYD88 dimerization. Loiarro et al (2013) used site-directed mutagenesis of conserved residues within the MYD88 TIR domain to analyse their impact on MYD88 protein signalling. Their work revealed that mutation of Glu196, Ser257 and Arg301 [per National Center for Biotechnology Information (NCBI)NP_002459.2 annotation] interfered with TIR-mediated MYD88 dimerization, IRAK recruitment, and reduced NFκB activation. The over-expression of two MyD88 (MYD88164–202 and MYD88181–202) mini-peptides that included Glu196 in wild-type MYD88 (MYD88WT) THP-1 human monocyte cells also blocked TLR/IL1R triggered MYD88 dimerization and NFκB activation. There is evidence that the MYD88 DD domain can also facilitate MYD88 dimerization and MYD88-IRAK4 heterodimerization. Structural modelling has highlighted Ser47 and Arg111 (per NCBI NP_002459.2 annotation) as contributors to Myddosome assembly, IRAK4 recruitment and NFκB signalling, though without an intact TIR domain such interactions appear weak (George et al, 2011). The understanding of how MYD88 and IRAK4 DD domains interact to support Myddosome assembly has been aided by crystal structure modelling of the MYD88:IRAK4:IRAK2 DD complex that shows Val56, Ala57, Glu65, Tyr71, Ile74 and Arg75 (per NCBI NP_002459.2 annotation) of MYD88 as critical determinants of MYD88-IRAK4 binding (Lin et al, 2010). In contrast to native MYD88, mutated MYD88 protein can assemble without external stimuli, and trigger constitutive NFκB activation (Ngo et al, 2011; Treon et al, 2012; Yang et al, 2013). All activating MYD88 mutations observed in B-cell malignancies, including MYD88L265P, reside in the TIR domain. Relative to MYD88WT, mutated MYD88 protein shows enhanced IRAK4 and IRAK1 binding, and NFκB activation. While the precise structural interaction(s) that promote constitutive MYD88 homodimeric and IRAK heterodimeric interactions remain to be clarified in MYD88 mutated cells, the potential to block Myddosome self-assembly may be clinically relevant. We therefore sought to disrupt Myddosome signalling by systematic evaluation of mini-peptides designed to compete with MYD88 TIR and DD domain interactions, and studied their impact on downstream signalling and survival in MYD88 mutated WM cells. Oligonucleotides corresponding to the TIR and DD domain peptide sequences (Fig 1A) were cloned into Lenti-X™ Tet-One™ (Clontech Laboratories, Inc., Mountain View, CA, USA) inducible vector with an N-terminal GFP fusion sequence: MYD88 TIR domain: P181-202 (sense: CTATTGCCCCAGCGACATCCAGTTT, anti-sense: CAGTCGATAGTTTGTCTGTTCCAGTTGC), P256-292 (sense: CTCTCTCCAGGTGCCCATCAGAA, anti-sense: AGGGTTGGTGTAGTCGCAGACAGT), P190-197 (oligonucleotide: GAGATGATCCGGCAACTGGAACAG), P191-198 (oligonucleotide: ATGATCCGGCAACTGGAACAGACA), P195-202 (oligonucleotide: CTGGAACAGACAAACTATCGACTG), P295-302 (oligonucleotide: AAATCTTGGTTCTGGACTCGCCTT), and MYD88 DD domain: P40-85 (sense: CGGCGCCGCCTGTCTCTGTT, anti-sense: GCCAGTGGGGTCCGCTTGT). Molecular modelling depicting the surface areas and ribbon structures of the MYD88 TIR and DD domain regions targeted for interference by mini-peptide constructs based on NCBI MMDB 108985 (TIR) MMDB:82515 (DD) crystal structure models are shown in Fig 1B. Following lentiviral infection and puromycin selection in tetracycline-free media, MYD88L265P mutated BCWM.1 and MWCL-1 or MYD88WT Ramos cells were treated with doxycycline. Cell survival was then assessed on sorted GFP+ cells with AlamarBlue® (Invitrogen, Carlsbad, CA, USA). Annexin V staining (BD Biosciences, San Jose, CA, USA) was used for detecting apoptotic changes on GFP+ cells by flow cytometry. To detect changes in MYD88 downstream signalling, PhosFlow® analysis was performed for pBTKY223, pNFκB-p65S529 (BD Biosciences) and pIRAK1T209 (Abcam, Cambridge, MA, USA) on GFP+ cells (Yang et al, 2013). Given that mini-peptides expressing Glu196 within the TIR domain blocked TLR/IL1R-triggered MYD88 dimerization and NFκB activation in MYD88WT THP-1 human monocytes, we first examined a mini-peptide (MYD88181-202) that targeted this region in MYD88L265P mutated BCWM.1 and MWCL-1 cells, and MYD88WT Ramos cells (Figs 1A,B). Expression of MYD88181-202 blocked growth of BCWM.1 and MWCL-1 cells, but did not impact growth of MYD88WT Ramos cells (Fig 1C). Annexin V staining showed apoptotic changes in MYD88L265P but not MYD88WT cells transduced with MYD88181-202 (Fig 1D). Moreover, pro-survival signalling (pBTKY223, pIRAK1T209, pNFκB-p65S529) was abrogated in MYD88L265P but not MYD88WT cells transduced with MYD88181-202 (Fig 2A). Expression of smaller mini-peptides (8-mers) that overlapped Glu196 (MYD88190-197, MYD88191-198 and MYD88195-202 also showed increased apoptosis at 72 h in MYD88L265P mutated BCWM.1 cells (Fig 2B). In contrast, no sustained growth inhibition of BCWM.1 cells with any of the 8-mer peptides was observed (data not shown). In addition to Glu196, Loiarro et al (2013) also showed that mutation of Ser257 and Arg301 in MYD88 also interfered with TIR-mediated dimerization. To clarify their contribution to MYD88-directed survival signalling, BCWM.1 cells were also transduced with vectors coding for mini-peptides spanning amino acids 256–292 and 295–302. Apoptotic changes relative to control vector were observed in only MYD88295-302 transduced BCWM.1 cells (Fig 2B). Neither MYD88256-292 nor MYD88295-302 impacted pBTKY223, pIRAK1T209 or BCWM.1 cell survival, while moderate reductions in pNFκB-p65S529 were observed with only MYD88256-292 (data not shown). Transduction of a mini-peptide interfering with BB-loop interactions (MYD88207-224) also showed weak or no reduction in pro-survival signalling (pBTKY223, pIRAK1T209, pNFκB-p65S529), nor were any meaningful apoptotic or sustained growth inhibitory effects observed relative to control vector transduced BCWM.1 cells (data not shown). The findings with MYD88256-292 and MYD88207-224 were particularly instructive, given that most of the described activating MYD88 mutations are located in either the BB loop, or at position 265. Further to these experiments, we also sought to clarify the contributions of the DD domain to pro-survival signalling in MYD88L265P mutated WM cells. We therefore transduced BCWM.1 cells with either a control vector or vector coding for a mini-peptide that spanned amino acids 40–85 (MYD8840-85) within the DD domain of MYD88. Expression of the MYD8840-85 mini-peptide in BCWM.1 cells was associated with increased apoptosis, and contributed to sustained growth inhibition (Fig 2C), as well as reduced pIRAK1T209 and pNFκB-p65S529 activation (Fig 2D). The findings therefore suggest that optimal survival signalling of MYD88 mutated WM cells involves TIR domain residues overlapping Glu196, and possibly residues extending from amino acids 40–85 in the DD domain. Reductions in IRAK and/or BTK signalling probably contributed to decreased WM cell survival, though greater reductions in pNFκB-p65S529 were observed in comparison to pIRAK or pBTK following transduction of MYD88181-202 or MYD8840-85. These findings may indicate either a critical scaffold function for the IRAK and/or BTK proteins beyond their well-established pro-survival kinase activity, and/or the presence of other binding partners that support growth signalling in MYD88 mutated WM cells. A scaffold function for TLR/IL1R triggered IRAK1 activity has been previously described in MYD88WT cells (Böl et al, 2005). A potential scaffold function for the IRAK proteins may also explain why knockdown of IRAK1 or IRAK4 produces higher levels of apoptosis than observed with inhibitors targeting these kinases in MYD88 mutated WM cells (Yang et al, 2013, 2015) Lastly, the findings also provide regions of interest that are conducive to the development of small molecules, peptidomimetics or stapled peptides for potential therapeutic application. Larger peptide sequences (>8-mers) may be needed within the TIR MYD88181-202 domain to achieve sustained growth suppression as observed in our studies. The development of stapled peptides may be particularly suitable, as longer (20-mer peptides) have been developed for therapeutic application by this approach (Walensky & Bird, 2014). In addition, the MYD88181-202 domain has an alpha helical configuration that is ideal for manufacturing stapled peptides (Fig 1B). It is also possible that multiple stapled peptides targeting both the TIR and DD domains could be used to more optimally block Myddosome assembly. In summary, we show that interference of Myddosome assembly within select regions of the TIR and DD domains can impact growth and survival signalling of MYD88L265P mutated WM cells. Our findings provide a framework for developing agents that interfere with Myddosome assembly in WM, and possibly for other lymphoproliferative disorders driven by MYD88-activating mutations. The authors gratefully acknowledge the generous support of a Leukemia and Lymphoma Society Translational Research Grant, a grant from the International Waldenstrom's Macroglobulinemia Foundation, and philanthropic support from the Edward and Linda Nelson Fund for WM Research, the Bauman Family Trust, and Peter Bing M.D. in support of these studies. XL, GY, and SPT designed the study. GY and XL designed the primers. XL, JGC performed the lentiviral transduction experiments. JC, NT, and GY performed the signalling studies. CJP and JJC provided samples. ZRH, SB, NG, and ST performed data analysis. The co-authors have no relevant disclosures for this work." @default.
• W2337652093 created "2016-06-24" @default.
• W2337652093 creator A5009613920 @default.
• W2337652093 creator A5010479652 @default.
• W2337652093 creator A5022352605 @default.
• W2337652093 creator A5024726033 @default.
• W2337652093 creator A5026121534 @default.
• W2337652093 creator A5031106919 @default.
• W2337652093 creator A5034266315 @default.
• W2337652093 creator A5052299670 @default.
• W2337652093 creator A5074563113 @default.
• W2337652093 creator A5081299017 @default.
• W2337652093 creator A5082126376 @default.
• W2337652093 creator A5089994476 @default.
• W2337652093 date "2016-04-13" @default.
• W2337652093 modified "2023-10-17" @default.
• W2337652093 title "Targeting Myddosome Assembly in Waldenstrom Macroglobulinaemia" @default.
• W2337652093 cites W1969380065 @default.
• W2337652093 cites W1971659434 @default.
• W2337652093 cites W1981858590 @default.
• W2337652093 cites W1990975597 @default.
• W2337652093 cites W1993211211 @default.
• W2337652093 cites W1993355130 @default.
• W2337652093 cites W2006422013 @default.
• W2337652093 cites W2007851220 @default.
• W2337652093 cites W2020345929 @default.
• W2337652093 cites W2039945582 @default.
• W2337652093 cites W2042061022 @default.
• W2337652093 cites W2072908214 @default.
• W2337652093 cites W2116382435 @default.
• W2337652093 cites W2140380015 @default.
• W2337652093 cites W2588279671 @default.
• W2337652093 doi "https://doi.org/10.1111/bjh.14103" @default.
• W2337652093 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/27073043" @default.
• W2337652093 hasPublicationYear "2016" @default.
• W2337652093 type Work @default.
• W2337652093 sameAs 2337652093 @default.
• W2337652093 citedByCount "13" @default.
• W2337652093 countsByYear W23376520932016 @default.
• W2337652093 countsByYear W23376520932018 @default.
• W2337652093 countsByYear W23376520932019 @default.
• W2337652093 countsByYear W23376520932021 @default.
• W2337652093 countsByYear W23376520932022 @default.
• W2337652093 countsByYear W23376520932023 @default.
• W2337652093 crossrefType "journal-article" @default.
• W2337652093 hasAuthorship W2337652093A5009613920 @default.
• W2337652093 hasAuthorship W2337652093A5010479652 @default.
• W2337652093 hasAuthorship W2337652093A5022352605 @default.
• W2337652093 hasAuthorship W2337652093A5024726033 @default.
• W2337652093 hasAuthorship W2337652093A5026121534 @default.
• W2337652093 hasAuthorship W2337652093A5031106919 @default.
• W2337652093 hasAuthorship W2337652093A5034266315 @default.
• W2337652093 hasAuthorship W2337652093A5052299670 @default.
• W2337652093 hasAuthorship W2337652093A5074563113 @default.
• W2337652093 hasAuthorship W2337652093A5081299017 @default.
• W2337652093 hasAuthorship W2337652093A5082126376 @default.
• W2337652093 hasAuthorship W2337652093A5089994476 @default.
• W2337652093 hasBestOaLocation W23376520931 @default.
• W2337652093 hasConcept C203014093 @default.
• W2337652093 hasConcept C2776364478 @default.
• W2337652093 hasConcept C2776391228 @default.
• W2337652093 hasConcept C2779338263 @default.
• W2337652093 hasConcept C2781038049 @default.
• W2337652093 hasConcept C71924100 @default.
• W2337652093 hasConceptScore W2337652093C203014093 @default.
• W2337652093 hasConceptScore W2337652093C2776364478 @default.
• W2337652093 hasConceptScore W2337652093C2776391228 @default.
• W2337652093 hasConceptScore W2337652093C2779338263 @default.
• W2337652093 hasConceptScore W2337652093C2781038049 @default.
• W2337652093 hasConceptScore W2337652093C71924100 @default.
• W2337652093 hasFunder F4320306738 @default.
• W2337652093 hasIssue "5" @default.
• W2337652093 hasLocation W23376520931 @default.
• W2337652093 hasLocation W23376520932 @default.
• W2337652093 hasOpenAccess W2337652093 @default.
• W2337652093 hasPrimaryLocation W23376520931 @default.
• W2337652093 hasRelatedWork W155378922 @default.
• W2337652093 hasRelatedWork W1972286386 @default.
• W2337652093 hasRelatedWork W1988705540 @default.
• W2337652093 hasRelatedWork W2040015650 @default.
• W2337652093 hasRelatedWork W2058941576 @default.
• W2337652093 hasRelatedWork W2123323375 @default.
• W2337652093 hasRelatedWork W2895466941 @default.
• W2337652093 hasRelatedWork W2981964593 @default.
• W2337652093 hasRelatedWork W3151943896 @default.
• W2337652093 hasRelatedWork W2000967713 @default.
• W2337652093 hasVolume "177" @default.
• W2337652093 isParatext "false" @default.
• W2337652093 isRetracted "false" @default.
• W2337652093 magId "2337652093" @default.
• W2337652093 workType "article" @default.