Matches in SemOpenAlex for { <https://semopenalex.org/work/W2340696711> ?p ?o ?g. }
Showing items 1 to 79 of
79
with 100 items per page.
- W2340696711 endingPage "54" @default.
- W2340696711 startingPage "43" @default.
- W2340696711 abstract "Three 5-bromocytosine base containing oligonucleotides (5'-TCTCTCTTYTYTYTCCAGAGAG (TCY); 5'-TYTYTYTTCTCTCTCCAGAGAG (YTC); 5'-TYTYTYTTYTYTYTCCAGAGAG (YTCY)) as well as TCTCTCTTCTCTCTCCAGAGAG (TC), have been designed and synthesized for the study of intramolecular triplex formation. The stability and formation of the triplexes were monitored by UV, CD and IR spectra employing pH potentials of 4.5, 6.0, and 8.0, respectively, in 20mM sodium cacodylate buffer and 150mM NaCI in a temperature range of 5 to 90 °C. These four oligomers form triplex and duplex at low pH and high pH values, respectively, as monitored by UV melting experiments. However, both triplex and duplex are formed at pH 6.0. The conclusion has been approved by CD spectra, Namely, a triplex characteristic band at 218 nm was observed for all three oligomers at pH 4.5 at low temperature, On the contrary, the CD curve of all three oligomers demonstrated a typical B-form DNA at high pH, Both triplex and duplex CD characters were shown for all three oligomers at pH 6.0. Their stability can be monitored with the CD bands at 218nm and 258 nm, respectively. The conformation of the sugar pucker favors N-type conformation in triplex and the duplex favors the S-type conformation as analyzed by FT-IR spectroscopy. When the triplex dissociated to the duplex, the N-type shifted to the S-type in proportion. Therefore, our study will shed light on the design of triplex formation." @default.
- W2340696711 created "2016-06-24" @default.
- W2340696711 creator A5001794050 @default.
- W2340696711 creator A5007934664 @default.
- W2340696711 creator A5024450667 @default.
- W2340696711 creator A5025459392 @default.
- W2340696711 creator A5027482918 @default.
- W2340696711 creator A5038719850 @default.
- W2340696711 creator A5063756937 @default.
- W2340696711 creator A5071527674 @default.
- W2340696711 date "2000-08-01" @default.
- W2340696711 modified "2023-09-23" @default.
- W2340696711 title "Study of the Intramolecular Triplex Formation with Oligonucleotides Containing 5-Bromocytosine in Aqueous Solution" @default.
- W2340696711 doi "https://doi.org/10.6522/bicas.2000.47.5" @default.
- W2340696711 hasPublicationYear "2000" @default.
- W2340696711 type Work @default.
- W2340696711 sameAs 2340696711 @default.
- W2340696711 citedByCount "0" @default.
- W2340696711 crossrefType "journal-article" @default.
- W2340696711 hasAuthorship W2340696711A5001794050 @default.
- W2340696711 hasAuthorship W2340696711A5007934664 @default.
- W2340696711 hasAuthorship W2340696711A5024450667 @default.
- W2340696711 hasAuthorship W2340696711A5025459392 @default.
- W2340696711 hasAuthorship W2340696711A5027482918 @default.
- W2340696711 hasAuthorship W2340696711A5038719850 @default.
- W2340696711 hasAuthorship W2340696711A5063756937 @default.
- W2340696711 hasAuthorship W2340696711A5071527674 @default.
- W2340696711 hasConcept C129312508 @default.
- W2340696711 hasConcept C144082473 @default.
- W2340696711 hasConcept C147789679 @default.
- W2340696711 hasConcept C184651966 @default.
- W2340696711 hasConcept C185592680 @default.
- W2340696711 hasConcept C552990157 @default.
- W2340696711 hasConcept C55493867 @default.
- W2340696711 hasConcept C71240020 @default.
- W2340696711 hasConcept C75079739 @default.
- W2340696711 hasConcept C8010536 @default.
- W2340696711 hasConcept C99611785 @default.
- W2340696711 hasConceptScore W2340696711C129312508 @default.
- W2340696711 hasConceptScore W2340696711C144082473 @default.
- W2340696711 hasConceptScore W2340696711C147789679 @default.
- W2340696711 hasConceptScore W2340696711C184651966 @default.
- W2340696711 hasConceptScore W2340696711C185592680 @default.
- W2340696711 hasConceptScore W2340696711C552990157 @default.
- W2340696711 hasConceptScore W2340696711C55493867 @default.
- W2340696711 hasConceptScore W2340696711C71240020 @default.
- W2340696711 hasConceptScore W2340696711C75079739 @default.
- W2340696711 hasConceptScore W2340696711C8010536 @default.
- W2340696711 hasConceptScore W2340696711C99611785 @default.
- W2340696711 hasIssue "47" @default.
- W2340696711 hasLocation W23406967111 @default.
- W2340696711 hasOpenAccess W2340696711 @default.
- W2340696711 hasPrimaryLocation W23406967111 @default.
- W2340696711 hasRelatedWork W1973325051 @default.
- W2340696711 hasRelatedWork W1979145365 @default.
- W2340696711 hasRelatedWork W1988045767 @default.
- W2340696711 hasRelatedWork W1998726760 @default.
- W2340696711 hasRelatedWork W2006131708 @default.
- W2340696711 hasRelatedWork W2015926372 @default.
- W2340696711 hasRelatedWork W2019220858 @default.
- W2340696711 hasRelatedWork W2020942180 @default.
- W2340696711 hasRelatedWork W2021357713 @default.
- W2340696711 hasRelatedWork W2040044339 @default.
- W2340696711 hasRelatedWork W2047624512 @default.
- W2340696711 hasRelatedWork W2070892754 @default.
- W2340696711 hasRelatedWork W2076581809 @default.
- W2340696711 hasRelatedWork W2090149759 @default.
- W2340696711 hasRelatedWork W2093804757 @default.
- W2340696711 hasRelatedWork W2094311835 @default.
- W2340696711 hasRelatedWork W2108659984 @default.
- W2340696711 hasRelatedWork W2129576259 @default.
- W2340696711 hasRelatedWork W2190330093 @default.
- W2340696711 hasRelatedWork W2200578881 @default.
- W2340696711 isParatext "false" @default.
- W2340696711 isRetracted "false" @default.
- W2340696711 magId "2340696711" @default.
- W2340696711 workType "article" @default.