FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2340963463> ?p ?o ?g. }

• W2340963463 endingPage "391" @default.
• W2340963463 startingPage "383" @default.
• W2340963463 abstract "The principal conformational features of the mutant trp operator [d(CGTACTGATTAATCAGTACG)2] have been determined by n.m.r. at different temperatures. The sugar puckers were determined from J-resolved spectroscopy and high-resolution homonuclear Hartmann-Hahn spectroscopic (HOHAHA) experiments. Extensive one-dimensional nuclear-Overhauser-enhancement (NOE) data sets were acquired at 25 degrees C using irradiation times of 50, 100, 200, 300 and 500 ms to generate sufficient NOE information to determine the individual nucleotide conformations, and place limits on the local helical parameters, using multi-spin least-squares fitting and searching in conformation space with the program NUCFIT [Lane (1990) Biochim. Biophys. Acta 1049, 189-204]. The conformations of the nucleotides are well determined, and show significant sequence-dependent variation. Pyrimidine residues on average have a wider range of sugar conformations and smaller glycosidic torsion angles than purine residues. The helical parameters are in general less well determined, though clear evidence was obtained for sequence-dependent variation of the helical twist. The overall mean fractional deviation of the calculated from the observed NOEs was 0.108. The conformations of the base-pairs TAAT are temperature-dependent [Lane (1989) Biochem. J. 259, 715-724]. NOESY spectra were recorded at 10, 25 and 40 degrees C, using mixing times inversely proportional to the overall tumbling time to allow changes in the conformation to be described. A more detailed analysis was made using one-dimensional NOEs collected for nucleotides involved in the conformational transitions. There are significant temperature-dependent changes in the conformations of the central base-pairs from T9 to T13 with the largest changes in the glycosidic torsion angle occurring for A11 and A12 (up to 30 degrees). The orientation of the base-pairs T9-A12:T10-A11 also changes, with an increase in the base-pair roll and an unwinding of the helix as the temperature is increased. The conformational changes are qualitatively similar to those observed in a related sequence (Lefèvre, Lane & Jardetzky (1988) Biochemistry 27, 1086-1094]. The conformation is also similar to the wild-type sequence and to that observed in the crystal state in the complex with the trp holorepressor. The similarity suggests that the mutation produces a poorer operator by virtue of removal of essential functional groups within the major groove." @default.
• W2340963463 created "2016-06-24" @default.
• W2340963463 creator A5029157205 @default.
• W2340963463 date "1991-01-15" @default.
• W2340963463 modified "2023-09-25" @default.
• W2340963463 title "The solution conformations of a mutant <i>trp</i> operator determined by n.m.r. spectroscopy" @default.
• W2340963463 cites W1497906014 @default.
• W2340963463 cites W1598637958 @default.
• W2340963463 cites W1970091405 @default.
• W2340963463 cites W1975851628 @default.
• W2340963463 cites W1980116834 @default.
• W2340963463 cites W1985459186 @default.
• W2340963463 cites W1987352448 @default.
• W2340963463 cites W1997011390 @default.
• W2340963463 cites W1998828960 @default.
• W2340963463 cites W1999073962 @default.
• W2340963463 cites W2020689529 @default.
• W2340963463 cites W2023279420 @default.
• W2340963463 cites W2026094497 @default.
• W2340963463 cites W2035620656 @default.
• W2340963463 cites W2036790115 @default.
• W2340963463 cites W2039527382 @default.
• W2340963463 cites W2045059035 @default.
• W2340963463 cites W2047966693 @default.
• W2340963463 cites W2053561906 @default.
• W2340963463 cites W2058918045 @default.
• W2340963463 cites W2078085951 @default.
• W2340963463 cites W2081503177 @default.
• W2340963463 cites W2081911814 @default.
• W2340963463 cites W2083827956 @default.
• W2340963463 cites W2084135121 @default.
• W2340963463 cites W2086276629 @default.
• W2340963463 cites W2088543190 @default.
• W2340963463 cites W2091579953 @default.
• W2340963463 cites W2094418743 @default.
• W2340963463 cites W2139960964 @default.
• W2340963463 cites W2336984566 @default.
• W2340963463 cites W2406599027 @default.
• W2340963463 cites W6418697 @default.
• W2340963463 doi "https://doi.org/10.1042/bj2730383" @default.
• W2340963463 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/1149857" @default.
• W2340963463 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/1998537" @default.
• W2340963463 hasPublicationYear "1991" @default.
• W2340963463 type Work @default.
• W2340963463 sameAs 2340963463 @default.
• W2340963463 citedByCount "13" @default.
• W2340963463 countsByYear W23409634632016 @default.
• W2340963463 countsByYear W23409634632017 @default.
• W2340963463 crossrefType "journal-article" @default.
• W2340963463 hasAuthorship W2340963463A5029157205 @default.
• W2340963463 hasBestOaLocation W23409634632 @default.
• W2340963463 hasConcept C104317684 @default.
• W2340963463 hasConcept C119851462 @default.
• W2340963463 hasConcept C121332964 @default.
• W2340963463 hasConcept C150487720 @default.
• W2340963463 hasConcept C178790620 @default.
• W2340963463 hasConcept C181199279 @default.
• W2340963463 hasConcept C185592680 @default.
• W2340963463 hasConcept C18705241 @default.
• W2340963463 hasConcept C19549132 @default.
• W2340963463 hasConcept C32891209 @default.
• W2340963463 hasConcept C32909587 @default.
• W2340963463 hasConcept C40447573 @default.
• W2340963463 hasConcept C512185932 @default.
• W2340963463 hasConcept C55493867 @default.
• W2340963463 hasConcept C62520636 @default.
• W2340963463 hasConcept C66974803 @default.
• W2340963463 hasConcept C71240020 @default.
• W2340963463 hasConcept C8010536 @default.
• W2340963463 hasConceptScore W2340963463C104317684 @default.
• W2340963463 hasConceptScore W2340963463C119851462 @default.
• W2340963463 hasConceptScore W2340963463C121332964 @default.
• W2340963463 hasConceptScore W2340963463C150487720 @default.
• W2340963463 hasConceptScore W2340963463C178790620 @default.
• W2340963463 hasConceptScore W2340963463C181199279 @default.
• W2340963463 hasConceptScore W2340963463C185592680 @default.
• W2340963463 hasConceptScore W2340963463C18705241 @default.
• W2340963463 hasConceptScore W2340963463C19549132 @default.
• W2340963463 hasConceptScore W2340963463C32891209 @default.
• W2340963463 hasConceptScore W2340963463C32909587 @default.
• W2340963463 hasConceptScore W2340963463C40447573 @default.
• W2340963463 hasConceptScore W2340963463C512185932 @default.
• W2340963463 hasConceptScore W2340963463C55493867 @default.
• W2340963463 hasConceptScore W2340963463C62520636 @default.
• W2340963463 hasConceptScore W2340963463C66974803 @default.
• W2340963463 hasConceptScore W2340963463C71240020 @default.
• W2340963463 hasConceptScore W2340963463C8010536 @default.
• W2340963463 hasIssue "2" @default.
• W2340963463 hasLocation W23409634631 @default.
• W2340963463 hasLocation W23409634632 @default.
• W2340963463 hasLocation W23409634633 @default.
• W2340963463 hasLocation W23409634634 @default.
• W2340963463 hasOpenAccess W2340963463 @default.
• W2340963463 hasPrimaryLocation W23409634631 @default.
• W2340963463 hasRelatedWork W1966466040 @default.
• W2340963463 hasRelatedWork W1972727730 @default.
• W2340963463 hasRelatedWork W2023529537 @default.
• W2340963463 hasRelatedWork W2064050393 @default.

• next