Matches in SemOpenAlex for { <https://semopenalex.org/work/W2392002170> ?p ?o ?g. }
Showing items 1 to 61 of
61
with 100 items per page.
- W2392002170 abstract "It has been established that heterotrimeric G protein plays an important role in signal transduction in animals and simple eukaryotes.Results from biochemical study have suggested the presence of polypeptides similar to the α subunit of the heterotrimeric G protein in plant cells and several full cDNA sequences had been obtained from different plant species,which all encode proteins that are very similar to Arabidopsis thahliana GPA1 product(GPα1),the first identified α subunit of heterotrimeric G protein (G α) in plant cells.However,GPα1 has only 36% identity to mammalian G i and transducins.Obviously,it is an intriguing and significant work to probe plant G protein with high similarity to mammalian heterotrimeric G protein.In the present study,a pair of specific primer(5'ctggggaatctggaaaatc3′,5′ cacagctgttacaccttcaaac3')has been designed according to the conserved region A of G α encoding genes for the purpose of the amplification of similar G α encoding genes from the genome of Luffa cylindrica L.Two PCR DNA fragments (LFG1,LFG2)had been obtained,cloned,and sequenced (assigned in EMBL database,accession numbers:y15270,y15271).Sequence analysis showed that LFG1 and LFG2 were composed of 1 515 bp and 732 bp,respectively.In addition,they all contained the conserved region A of Ga encoding genes and introns.Based on PCR properties and molecular weights,it was deduced that LFG1 could be involved in G α encoding genes and LFG2 might be a nonspecific amplifying fragment or related to other classes of G α encoding genes in Luffa cylindrica ." @default.
- W2392002170 created "2016-06-24" @default.
- W2392002170 creator A5001613003 @default.
- W2392002170 date "1999-01-01" @default.
- W2392002170 modified "2023-09-23" @default.
- W2392002170 title "Primary Study of the Heterotrimeric G Protein in Luffa cylindrica" @default.
- W2392002170 hasPublicationYear "1999" @default.
- W2392002170 type Work @default.
- W2392002170 sameAs 2392002170 @default.
- W2392002170 citedByCount "0" @default.
- W2392002170 crossrefType "journal-article" @default.
- W2392002170 hasAuthorship W2392002170A5001613003 @default.
- W2392002170 hasConcept C104292427 @default.
- W2392002170 hasConcept C104317684 @default.
- W2392002170 hasConcept C139407321 @default.
- W2392002170 hasConcept C143065580 @default.
- W2392002170 hasConcept C153911025 @default.
- W2392002170 hasConcept C187882448 @default.
- W2392002170 hasConcept C2779491563 @default.
- W2392002170 hasConcept C54355233 @default.
- W2392002170 hasConcept C62478195 @default.
- W2392002170 hasConcept C80631254 @default.
- W2392002170 hasConcept C86803240 @default.
- W2392002170 hasConcept C94671646 @default.
- W2392002170 hasConceptScore W2392002170C104292427 @default.
- W2392002170 hasConceptScore W2392002170C104317684 @default.
- W2392002170 hasConceptScore W2392002170C139407321 @default.
- W2392002170 hasConceptScore W2392002170C143065580 @default.
- W2392002170 hasConceptScore W2392002170C153911025 @default.
- W2392002170 hasConceptScore W2392002170C187882448 @default.
- W2392002170 hasConceptScore W2392002170C2779491563 @default.
- W2392002170 hasConceptScore W2392002170C54355233 @default.
- W2392002170 hasConceptScore W2392002170C62478195 @default.
- W2392002170 hasConceptScore W2392002170C80631254 @default.
- W2392002170 hasConceptScore W2392002170C86803240 @default.
- W2392002170 hasConceptScore W2392002170C94671646 @default.
- W2392002170 hasOpenAccess W2392002170 @default.
- W2392002170 hasRelatedWork W1971212137 @default.
- W2392002170 hasRelatedWork W1996312869 @default.
- W2392002170 hasRelatedWork W2012436938 @default.
- W2392002170 hasRelatedWork W2023780636 @default.
- W2392002170 hasRelatedWork W2030827633 @default.
- W2392002170 hasRelatedWork W2035229191 @default.
- W2392002170 hasRelatedWork W2041625711 @default.
- W2392002170 hasRelatedWork W2048115816 @default.
- W2392002170 hasRelatedWork W2062022968 @default.
- W2392002170 hasRelatedWork W2064483656 @default.
- W2392002170 hasRelatedWork W2066030544 @default.
- W2392002170 hasRelatedWork W2079153043 @default.
- W2392002170 hasRelatedWork W2091523744 @default.
- W2392002170 hasRelatedWork W2116854596 @default.
- W2392002170 hasRelatedWork W2117677464 @default.
- W2392002170 hasRelatedWork W2158800126 @default.
- W2392002170 hasRelatedWork W2382805619 @default.
- W2392002170 hasRelatedWork W2786241554 @default.
- W2392002170 hasRelatedWork W2316677101 @default.
- W2392002170 hasRelatedWork W2865361653 @default.
- W2392002170 isParatext "false" @default.
- W2392002170 isRetracted "false" @default.
- W2392002170 magId "2392002170" @default.
- W2392002170 workType "article" @default.