FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2519392912> ?p ?o ?g. }

• W2519392912 endingPage "1196.e6" @default.
• W2519392912 startingPage "1188" @default.
• W2519392912 abstract "•Loss of ASXL1 does not lead to transformation in vitro.•ASXL1 is essential for erythroid development and differentiation.•Functional loss of ASXL1 triggers an apoptotic response and disturbs the cell cycle.•Loss of ASXL1 decreases H3K27me3 levels of p21. ASXL1 is frequently mutated in myelodysplastic syndrome and other hematological malignancies. It has been reported that a loss of ASXL1 leads to a reduction of H3K27me3 via the polycomb repressive complex 2 (PRC2). To determine the role of ASXL1 loss in normal hematopoietic stem and progenitor cells, cord blood CD34+ cells were transduced with independent small hairpin interfering RNA lentiviral vectors against ASXL1 and cultured under myeloid and erythroid permissive conditions. Knockdown of ASXL1 led to a significant reduction in stem-cell frequency and a reduced cell expansion along the myeloid lineage. Cell expansion along the erythroid lineage was also reduced significantly and was accompanied by an increase in apoptosis of erythroid progenitor cells throughout differentiation and by an accumulation of cells in the G0/G1 phase. Bone marrow stromal cells supported the growth of immature erythroid cells, but did not alter the adverse phenotype of ASXL1 knockdown. Chromatin immunoprecipitation revealed no loss of H3K27me3 in myeloid progenitor cells, but demonstrated a loss of H3K27me3 on the HOXA and the p21 locus in erythroid progenitors. We conclude that ASXL1 is essential for erythroid development and differentiation and that the aberrant differentiation is, at least in part, facilitated via PRC2. ASXL1 is frequently mutated in myelodysplastic syndrome and other hematological malignancies. It has been reported that a loss of ASXL1 leads to a reduction of H3K27me3 via the polycomb repressive complex 2 (PRC2). To determine the role of ASXL1 loss in normal hematopoietic stem and progenitor cells, cord blood CD34+ cells were transduced with independent small hairpin interfering RNA lentiviral vectors against ASXL1 and cultured under myeloid and erythroid permissive conditions. Knockdown of ASXL1 led to a significant reduction in stem-cell frequency and a reduced cell expansion along the myeloid lineage. Cell expansion along the erythroid lineage was also reduced significantly and was accompanied by an increase in apoptosis of erythroid progenitor cells throughout differentiation and by an accumulation of cells in the G0/G1 phase. Bone marrow stromal cells supported the growth of immature erythroid cells, but did not alter the adverse phenotype of ASXL1 knockdown. Chromatin immunoprecipitation revealed no loss of H3K27me3 in myeloid progenitor cells, but demonstrated a loss of H3K27me3 on the HOXA and the p21 locus in erythroid progenitors. We conclude that ASXL1 is essential for erythroid development and differentiation and that the aberrant differentiation is, at least in part, facilitated via PRC2. Myelodysplastic syndrome (MDS) is a stem cell disorder characterized by a differentiation defect in one or more hematopoietic lineages in association with ineffective hematopoiesis [1Jaiswal S. Ebert B. MDS is a stem cell disorder after all.Cancer Cell. 2014; 25: 713-714Abstract Full Text Full Text PDF PubMed Scopus (16) Google Scholar]. A paradox seen in MDS is that patients have peripheral cytopenias while commonly also displaying a hypercellular bone marrow [2Kerbauy D.B. Deeg H.J. Apoptosis and anti-apoptotic mechanisms in the progression of MDS.Exp Hematol. 2007; 35: 1739-1746Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar]. In low-risk MDS, this is attributed to an increased susceptibility to programmed cell death [3Folkerts H. Hazenberg C.L. Houwerzijl E.J. et al.Erythroid progenitors from patients with low-risk myelodysplastic syndromes are dependent on the surrounding micro environment for their survival.Exp Hematol. 2015; 43: 215-222.e2Abstract Full Text Full Text PDF Scopus (2) Google Scholar, 4Houwerzijl E.J. Pol H.W. Blom N.R. van der Want J.J. de Wolf J.T. Vellenga E. Erythroid precursors from patients with low-risk myelodysplasia demonstrate ultrastructural features of enhanced autophagy of mitochondria.Leukemia. 2009; 23: 886-891Crossref PubMed Scopus (42) Google Scholar, 5Houwerzijl E.J. van den Heuvel F.A. Blom N.R. van der Want J.J. Mulder A.B. Vellenga E. Sinusoidal endothelial cells are damaged and display enhanced autophagy in myelodysplastic syndromes.Br J Haematol. 2013; 161: 443-446Crossref PubMed Scopus (6) Google Scholar], which appears to be less pronounced in high-risk MDS patients. Recently, several mutations have been identified that contribute to the MDS phenotype. In low-risk patients, mutations are commonly found in TET2 and SF3B [6Kosmider O. Gelsi-Boyer V. Cheok M. et al.Groupe Francophone des Myélodysplasies. TET2 mutation is an independent favorable prognostic factor in myelodysplastic syndromes (MDSs).Blood. 2009; 114: 3285-3291Crossref PubMed Scopus (241) Google Scholar, 7Malcovati L. Karimi M. Papaemmanuil E. et al.SF3B1 mutation identifies a distinct subset of myelodysplastic syndrome with ring sideroblasts.Blood. 2015; 126: 233-241Crossref PubMed Scopus (283) Google Scholar], whereas mutations in DNMT3a, TP53, and IDH1 are often present in high-risk MDS patients [8Patnaik M.M. Hanson C.A. Hodnefield J.M. et al.Differential prognostic effect of IDH1 versus IDH2 mutations in myelodysplastic syndromes: a Mayo Clinic Study of 277 patients.Leukemia. 2012; 26: 101-105Crossref PubMed Scopus (116) Google Scholar, 9Sallman D.A. Komrokji R. Vaupel C. et al.Impact of TP53 mutation variant allele frequency on phenotype and outcomes in myelodysplastic syndromes.Leukemia. 2016; 30: 666-673Crossref PubMed Scopus (126) Google Scholar, 10Thol F. Weissinger E.M. Krauter J. et al.IDH1 mutations in patients with myelodysplastic syndromes are associated with an unfavorable prognosis.Haematologica. 2010; 95: 1668-1674Crossref PubMed Scopus (164) Google Scholar, 11Walter M.J. Ding L. Shen D. et al.Recurrent DNMT3A mutations in patients with myelodysplastic syndromes.Leukemia. 2011; 25: 1153-1158Crossref PubMed Scopus (441) Google Scholar]. Mutations of ASXL1 are found in both low- and high-risk patients and are associated with an unfavorable prognosis [12Bejar R. Stevenson K.E. Caughey B.A. et al.Validation of a prognostic model and the impact of mutations in patients with lower-risk myelodysplastic syndromes.J Clin Oncol. 2012; 30: 3376-3382Crossref PubMed Scopus (372) Google Scholar]. However, mutations in the ASXL1 gene are not restricted to MDS; they have also been demonstrated in acute myeloid leukemia (AML), myelofibrosis, and chronic myelomonocytic leukemia (CMML). Mutations of ASXL1 may lead to truncation of the protein and thereby to loss of its chromatin interacting and modifying domain. In addition, ASXL1 is not the only gene of the ASXL family that can be affected. A study by Micol et al. demonstrated that mutations in the ASXL2 are observed predominantly in AML patients carrying the t(8,21) translocation [13Micol J.B. Duployez N. Boissel N. et al.Frequent ASXL2 mutations in acute myeloid leukemia patients with t (8; 21)/RUNX1-RUNX1T1 chromosomal translocations.Blood. 2014; 124: 1445-1449Crossref Scopus (96) Google Scholar]. One of the main functions attributed to ASXL1 is the stabilization and/or recruitment of the polycomb repressive complex 2 (PRC2) to certain loci of histone H3-lysine 27, leading to trimethylation and repression of these loci [14Abdel-Wahab O. Adli M. LaFave L.M. et al.ASXL1 mutations promote myeloid transformation through loss of PRC2-mediated gene repression.Cancer Cell. 2012; 22: 180-193Abstract Full Text Full Text PDF PubMed Scopus (437) Google Scholar]. Functional studies in mice have shown that loss of ASXL1 function results in embryonic lethality, whereas heterozygous mice develop an MDS-like phenotype after a long latency [15Abdel-Wahab O. Gao J. Adli M. et al.Deletion of Asxl1 results in myelodysplasia and severe developmental defects in vivo.J Exp Med. 2013; 210: 2641-2659Crossref PubMed Scopus (239) Google Scholar, 16Inoue D. Kitaura J. Togami K. et al.Myelodysplastic syndromes are induced by histone methylation-altering ASXL1 mutations.J Clin Invest. 2013; 123: 4627-4640Crossref PubMed Scopus (121) Google Scholar, 17Wang J. Li Z. He Y. et al.Loss of Asxl1 leads to myelodysplastic syndrome-like disease in mice.Blood. 2014; 123: 541-553Crossref PubMed Scopus (128) Google Scholar]. Abdel-Wahab et al. discovered that the posterior HOXA cluster could be affected by down-modulation of ASXL1 and HOXA genes have been linked to malignant transformation in mice [14Abdel-Wahab O. Adli M. LaFave L.M. et al.ASXL1 mutations promote myeloid transformation through loss of PRC2-mediated gene repression.Cancer Cell. 2012; 22: 180-193Abstract Full Text Full Text PDF PubMed Scopus (437) Google Scholar, 18Kroon E. Thorsteinsdottir U. Mayotte N. Nakamura T. Sauvageau G. NUP98–HOXA9 expression in hemopoietic stem cells induces chronic and acute myeloid leukemias in mice.EMBO J. 2001; 20: 350-361Crossref PubMed Scopus (181) Google Scholar, 19Ayton P.M. Cleary M.L. Transformation of myeloid progenitors by MLL oncoproteins is dependent on Hoxa7 and Hoxa9.Genes Dev. 2003; 17: 2298-2307Crossref PubMed Scopus (370) Google Scholar]. However, it is unclear how the loss of ASXL1 affects the PRC2 pathway in human hematopoietic stem and progenitor cells (HSPCs). In addition, the consequences of loss-of-function of ASXL1 in these cells are not well defined. Therefore, we used an interfering RNA (RNAi) approach to study the consequences in HSPCs with several independent short hairpin RNAs (shRNAs) in vitro. The results demonstrate that loss of ASXL1 leads to reduced erythroid differentiation and progenitor development due to increased apoptosis and an increased accumulation of cells in the G0/G1 phase. Knockdown of ASXL1 coincides with a loss of H3K27 trimethylation and increased gene expression of targeted genes in the erythroid lineage, but not in the myeloid lineage. Stem-cell frequencies and myeloid progenitors were also reduced on loss of ASXL1. CD34+ cord blood (CB) cells were isolated after informed consent in accordance with the Declaration of Helsinki from the obstetrics departments at the Martini Hospital and University Medical Center Groningen, Groningen, The Netherlands. CB CD34+ cells were purified using the AutoMacs (Miltenyi Biotec, Amsterdam, The Netherlands). CB CD34+ cells were grown under myeloid liquid conditions (Iscove modified Dulbecco medium) supplemented with 20% fetal calf serum (FCS, Sigma-Aldrich, Zwijndrecht, The Netherlands), interleukin 3 (IL-3; Gist-Brocades, Delft, The Netherlands), and stem cell factor (SCF, Amgen, Thousand Oaks, CA, USA). Cells were cultured under erythroid permissive conditions in Dulbecco modified Eagle medium (Westburg, Leusden, The Netherlands) supplemented with 12% FCS, 10 mg/mL bovine serum albumin, 1% penicillin/streptomycin (pen/strep), 1.9 mmol/L sodium bicarbonate, 1 μmol/L dexamethasone, 1 μmol/L β-estradiol, 0.1 mmol/L 2-mercaptoethanol, 0.3 mg/mL rHu Holo-Transferrin (Sigma-Aldrich), 5 U/mL recombinant human (rHu) erythropoietin (EPO), 20 ng/mL SCF, and 40 ng/mL rHu insulin-like growth factor-1 (Sigma-Aldrich). Long-term cultures were performed as described previously [20Schepers H. van Gosliga D. Wierenga A.T. Eggen B.J. Schuringa J.J. Vellenga E. STAT5 is required for long-term maintenance of normal and leukemic human stem/progenitor cells.Blood. 2007; 110: 2880-2888Crossref PubMed Scopus (83) Google Scholar]. CB CD34+ cells were expanded on MS5 stromal cells in long-term culture (LTC) medium (Gartner's) containing αMEM supplemented with 12.5% heat-inactivated FCS, 12.5% heat-inactivated horse serum, pen/strep, 57.2 μmol/L β-mercaptoethanol (Sigma-Aldrich), and 1 μmol/L hydrocortisone (Sigma-Aldrich) with or without the cytokines SCF (20 ng/mL) and EPO (2 U/mL). Cultures were grown at 37°C and 5% CO2. LTC-IC and CFC assays were performed as described previously [20Schepers H. van Gosliga D. Wierenga A.T. Eggen B.J. Schuringa J.J. Vellenga E. STAT5 is required for long-term maintenance of normal and leukemic human stem/progenitor cells.Blood. 2007; 110: 2880-2888Crossref PubMed Scopus (83) Google Scholar]. LTC-IC assays were performed by plating CB CD34+ cells in limiting dilutions in the range of six to 1458 cells per well on MS5 stromal cells in 96-well plates in Gartner's medium. A demi of the medium of the cultures was conducted on a weekly basis. After 5 weeks, the medium was removed and replaced with methylcellulose (H4230, Stem Cell Technologies) supplemented with 20 ng/mL IL-3, IL-6, SCF, rHu granulocyte-colony stimulating factor (G-CSF), Flt-3L, 10 ng/mL granulocyte macrophage (GM)-CSF, and 1 U/mL EPO. After an additional 2 weeks, wells were scored negative or positive for CFCs. For CFC assays, green fluorescent protein positive (GFP+) CD34+ cells were plated in duplicate in 1 mL of methylcellulose. Colonies were scored within 10–14 days after plating. The lentiviral shRNA vectors of human ASXL1 and EZH2 were generous gifts from Prof. Dr. Giovanni Morrone (University of Catanzaro Magna Græcia, Catanzaro, Italy). ASXL1 hairpins target the following sequences: GCTATGTCACAGGACAGTAAT and CCAGGAGAATCAGTGCGTATA. EZH2 targets the following sequence: TATGATGGTTAACGGTGATCA. The sequence for the third hairpin (#96) was available online from the TRC RNAi Consortium with the following sequence: CCGGATTCAACTTTCACGTAT. The ASXL1 and EZH2 hairpins were cloned from a puro-vector into the pLKO.1 lentiviral vector containing either GFP or mCherry by cutting the restrictions sites with MUNI and SACII. A pLKO.1 GFP or mCherry vector containing a scrambled (SCR) shRNA was used as a control. Lentiviral particles were produced using the Fugene transfection system (Promega, Madison, WI, USA) together with glycoprotein envelope plasmid VSV-G, the packaging construct PAX2, and the construct of interest. 293T cells were then transfected transiently. Stable transduction of cell lines or CB CD34+ cells was performed and transduction efficiencies were measured by fluorescence-activated cell sorting (FACS) analysis. Knockdown was verified by real-time polymerase chain reaction (PCR) and Western blot. The following antibodies were used: allophycocyanin (APC)-conjugated anti-CD34 (581, BD Biosciences, Alphen a/d Rijn, The Netherlands), phycoerythrin (PE), anti-CD14 (HCD14, Biolegend, Alphen a/d Rijn, The Netherlands), Pacific blue-conjugated anti-CD15 (W6D3, Biolegend), brilliant violet anti-CD71 (M-A712, BD Biosciences), and R-PE anti-glycophorin-A (JC159, Dako, Heverlee, Belgium). All cells were blocked with anti-human FcR block (Stem Cell Technologies). Cells were then incubated with antibodies for 30 minutes at 4°C. All FACS analyses were performed on an FACS LSR-II, cells were sorted on a MoFlo-XDP or MoFlo-Astrios (DakoCytomation, Carpinteria, CA, USA) and data were analyzed using FlowJo version X.0.7 software. Total RNA was isolated using the RNeasy kit from QIAGEN (Venlo, The Netherlands) in accordance with the manufacturer's recommendations. RNA was reverse transcribed with iScript reverse transcriptase (Bio-Rad). Using the iQ SYBR Green Supermix (Bio-Rad), cDNA was real-time amplified with the CFX connect Real-Time System (Bio-Rad) thermocycler. For primers and primer sequences, see Supplementary Table E1 (online only, available at www.exphem.org). The following primary antibodies were used for Western blotting: ASXL1 (H-105X, Santa Cruz Biotechnology, Santa Cruz, CA, USA), Akt (9272S, Cell Signaling Technology, Danvers, MA, USA), Caspase 3 (9662, Cell Signaling Technology), H3K27me3 (07-449, Millipore), p21 (ab16767, Abcam, Cambridge, UK), PIM1 (ab117518, Abcam), and BNIP3L (ab8399, Abcam). Sorted cells were boiled in Laemmli sample buffer for up to 10 min and separated on 7.5–12% SDS-polyacrylamide gels. Proteins were transferred to PVDF membrane (Millipore, Etten Leur, The Netherlands) by semidry electroblotting. Membranes were blocked in Odyssey blocking buffer (Westburg, Leusden, The Netherlands) and incubated with primary antibodies. Secondary antibodies were labeled with Alexa Fluor 680 or IRDye800 (Invitrogen, Breda, The Netherlands) and used to detect binding of primary antibodies. Subsequently, membranes were scanned using an Odyssey infrared scanner (Li-Cor Biosciences, Lincoln, NE, USA). Cells were washed with calcium buffer (10 mmol/L HEPES, 140 mmol/L NaCL, 2.5 mmol/L CaCl2) and Annexin-V–APC antibody (IQ products IQ-120F/A) was added for 20 minutes at 4°C. Cells were washed with calcium buffer and analyzed by FACS with the LSR-II. ChIP experiments for H3K27me3 were performed as described previously [21Frank S.R. Schroeder M. Fernandez P. et al.Binding of c-Myc to chromatin mediates mitogen-induced acetylation of histone H4 and gene activation.Genes Dev. 2001; 15: 2069-2082Crossref PubMed Scopus (420) Google Scholar]. Briefly, cells were transduced with shASXL1 or shEZH2, sorted for GFP+, cross-linked in 1% formaldehyde, and then either snap-frozen or ChIP was performed directly. Antibodies used for ChIP include anti-H3K27me3 (Millipore, 07-449). For ChIP, PCR was conducted using the iQ SYBR Green Supermix. For primers and primer sequences, see Supplementary Table E1 (online only, available at www.exphem.org). Student t test using GraphPad Prism software was used to analyze data. The frequency of stem cells was calculated using L-Calc software (Stem Cell Technologies). Data are expressed as means ± SD. *p < 0.05, **p < 0.01, and ***p < 0.001 were considered significant. CB CD34+ cells were transduced with control vectors (shSCR) or two independent shRNA vectors to knock down ASXL1 (shASXL1 #1 and shASXL1 #2). Transduction efficiencies for both hairpins were above 30%, resulting in a reduction in ASXL1 expression at the mRNA as well as at the protein level (Fig. 1A). To evaluate the consequences of ASXL1 knockdown on erythroid and myeloid progenitors, shSCR and shASXL1 #1- and shASXL1 #2-transduced CB CD34+ cells were sorted and plated in methylcellulose assays, which revealed significant reductions in erythrocyte burst-forming units (BFU-Es) and granulocyte-macrophage colony-forming units (CFU-GMs) (Fig. 1B). If not stated otherwise, further experiments were conducted using hairpin #1. shASXL1-transduced CB CD34+ cells were then grown under myeloid-permissive conditions and followed for 15 days. At day 12, cells with shASXL1 revealed a twofold growth disadvantage (Fig. 1C). Throughout growth, shASXL1 cells displayed a trend towards a lower percentage and number of CD14+ cells, whereas the CD15 population remained largely unchanged (Fig. 1D and Supplementary Figure E1A, online only, available at www.exphem.org). In addition, a significant reduction in CFC frequencies throughout the culture period was observed (Fig. 1E). These findings demonstrate that shASXL1 affects myeloid development. Because MDS cells of low-risk patients are strongly dependent on the microenvironment, we evaluated the consequences of shASXL1 in CB CD34+ cells in co-cultures on MS5 bone marrow stromal cells in three independent experiments (Fig. 1F). Down-modulation of ASXL1 impaired long-term expansion during a 5-week co-culture period compared with shSCR CD34+ cells. CFC-GM frequencies declined significantly over time (day 14, p < 0.01), indicating that the MS5 stromal cells did not prevent reduction of progenitor frequencies on knockdown of ASXL1 (Fig. 1G). To determine whether LTC-IC frequencies were also affected, limiting-dilution LTC-IC assays were performed with CD34+ GFP+-sorted cells in two independent experiments. Data in Figure 1H reveal a significant reduction in stem cell frequency of shASXL1 CD34+ cells versus shSCR CD34+ cells (1 in 1165 vs 1 in 221, respectively; p < 0.0001; Supplementary Figure E1B, online only, available at www.exphem.org). These data demonstrate that reduction of ASXL1 impairs the maintenance of stem and progenitor cells. To investigate the effects of ASXL1 downregulation on the erythroid differentiation program in more detail, shSCR or shASXL1-transduced CB CD34+ cells were grown in suspension in the presence of EPO and SCF. Erythroid expansion was markedly affected by ASXL1 downregulation (Fig. 2A), with similar findings for the second hairpin (Supplementary Figure E2A, online only, available at www.exphem.org). To determine whether an increase in apoptosis would underlie the reduced output, Annexin V staining was performed. Indeed, the reduction in cell expansion was, at least in part, due to an increase in apoptosis. At day 7, a significant overall increase in Annexin V staining (p < 0.02) was observed (Fig. 2B, Supplementary Figure E2B, online only, available at www.exphem.org), accompanied by reduced erythroid differentiation and erythroid progenitor development in ASXL1 downmodulated cells compared with controls (Fig. 2C, Supplementary Figure E2C, online only, available at www.exphem.org). Control shSCR CD34+ cells followed a normal pattern of in vitro erythroid differentiation over time, in which cells gained CD71mid and then CD71bright marker expression, followed by CD71bright/Glycophorin A (GPA+) double expression. ASXL1-depleted cells, however, revealed a significantly increased percentage of the CD71mid compartment (p < 0.01), whereas the CD71bright compartment was reduced significantly (p < 0.006). In addition, fewer cells became CD71bright/GPA+ over time on ASXL1 knockdown compared with controls (Supplementary Figure E2D, online only, available at www.exphem.org). Moreover, a significant increase of Annexin V positivity among progenitor-like cells (CD71bright and CD71bright/GPA+, p < 0.02 and p < 0.003, respectively) was observed. The apoptotic phenotype in the ASXL1 knocked-down cells was limited to CD71bright and CD71bright/GPA+ cells. Subsequently, the whole CD71+ population was studied for changes in gene expression (Fig. 2D). Consistent with previously published data, HOXA9 expression was significantly increased after ASXL1 knockdown compared with control cells. In addition, several apoptotic genes, cell-cycle genes, and genes involved in erythroid differentiation were investigated due to their observed phenotype. CDKN1A (referred to as p21), a cell-cycle regulator, was significantly upregulated, whereas BNIP3L, a gene involved in erythroid development and differentiation, and PIM1, an anti-apoptotic gene and proposed regulator of hematopoietic stem cells (HSCs), showed significantly reduced expression levels. A reduction and an increase in protein levels for BNIP3L and p21 could be observed, respectively (Supplementary Figures E2E and E2F, online only, available at www.exphem.org), and similar results were obtained for the second hairpin. Several other well-known pro-apoptotic and anti-apoptotic genes were not affected by ASXL1 knockdown (Supplementary Figure E2G, online only, available at www.exphem.org). Cell-cycle analysis demonstrated accumulation of cells in G0/G1 (87.7 ± 4.9%) on ASXL1 knockdown compared with shSCR (81.6 ± 3.6%), with a reduced percentage of cells in the S and G2 phases (11.9 ± 0.8% vs. 6.4 ± 4.4%, respectively) compared with control cells (8.9 ± 1.7% vs. 3.4 ± 3.2%, respectively) (Fig. 2E). These changes were associated with reduced BFU-E output over time (p < 0.01) (Fig. 2F). Taken together, these data indicate that, on knockdown of ASXL1, apoptosis is a key contributor to the observed phenotypes in the erythroid lineage, which affects progenitor cells specifically. To define whether the phenotype observed in Figure 2 could be reversed in the presence of bone marrow stromal cells, co-cultures on MS5 were performed in the presence of EPO and SCF (Fig. 3A). As observed with suspension cells, ASXL1 depletion led to a profound decrease in cell expansion (day 13, p < 0.001). On day 13, reduced cell growth was accompanied by a significant increase of Annexin V+ cells (Fig. 3B, p < 0.01), but no changes at the other time points (Supplementary Figure E3A, online only, available at www.exphem.org). Opposite of what we observed in erythroid suspension cultures, the CD71mid compartment revealed an increase in total cell numbers over time in ASXL1-down-modulated cells (Fig. 3C), suggesting that the stromal layer can support these more immature erythroid cells. However, the survival of differentiating cells with ASXL1 knockdown was still impaired, similar to erythroid cells cultured in suspension (Fig. 3D). ASXL1 downmodulation led to a greater percentage of Annexin V+ cells among erythroid progenitors than in controls (CD71bright/GPA+, p < 0.01). These data indicate that, on knockdown of ASXL1, apoptosis is a key contributor to the observed phenotypes in EPO-stimulated co-cultures, which affects erythroid progenitor-like cells specifically. To investigate whether the observed phenotypes could be attributed to changes in PRC2-mediated epigenetic marks, we transduced CB CD34+ cells and cultured them for 7 days either in myeloid or erythroid liquid suspension cultures in two independent experiments. GFP+ cells were then sorted and immediately cross-linked. Targeted ChIP PCR was conducted on the HOXA9 promotor region and HOXA11 gene body because HOXA genes have been shown previously to be affected by ASXL1 depletion [14Abdel-Wahab O. Adli M. LaFave L.M. et al.ASXL1 mutations promote myeloid transformation through loss of PRC2-mediated gene repression.Cancer Cell. 2012; 22: 180-193Abstract Full Text Full Text PDF PubMed Scopus (437) Google Scholar, 17Wang J. Li Z. He Y. et al.Loss of Asxl1 leads to myelodysplastic syndrome-like disease in mice.Blood. 2014; 123: 541-553Crossref PubMed Scopus (128) Google Scholar]. In addition, ChIP for the p21 promotor region was performed based on its upregulation on gene expression (Fig. 2D) and protein level (Supplementary Figure E2D, online only, available at www.exphem.org). In the ChIP of the myeloid liquid cultures, no reduction of H3K27me3 could be observed (Fig. 4A) and the percentage of input for the HOXA9 cluster was generally low. Moreover, gene expression for HOXA9 was not altered (Supplementary Figure E4A, online only, available at www.exphem.org). Down-modulation of ASXL1 in erythroid cells, however, revealed a significant reduction of H3K27me3 on the HOXA9 locus of more than 80% for hairpin #1 and more than 65% for hairpin #2 (p < 0.05 both) (Fig. 4B). On the HOXA11 locus, the loss of H3K27me3 was more than 55% and 41% (p < 0.02) for hairpin 1 and 2, respectively. The observed increased p21 gene expression was accompanied by a reduction in H3K27me3 of more than 65% for hairpin #1 and more than 40% for hairpin #2 (p < 0.05). However, the global trimethylation levels of H3K27me3 did not appear to be reduced on ASXL1 knockdown (Supplementary Figure E2D, online only, available at www.exphem.org), suggesting that a loss in H3K27me3 is locus specific. To determine whether additional components of the PRC2 complex affected the erythroid lineage in a comparable manner, CB CD34+ cells were transduced by shEZH2 vectors, which resulted in a 71% reduced expression, whereas EZH1 expression remained largely unaffected (Fig. 4C; Supplementary Figure E4B, online only, available at www.exphem.org). Similar to the loss of ASXL1, EZH2 knockdown led to impaired BFU-E and CFU-GM formation compared with control cells (Fig. 4C). In addition, cell expansion was reduced significantly and accompanied by increased apoptosis on multiple time points (Fig. 4D and 4E). As seen with knockdown of ASXL1, EZH2 loss led to a greater CD71bright percentage than in control cells (Fig. 4F). As noted before, throughout erythroid maturation, an increase in Annexin V+ could be observed. In addition, total cell numbers decreased or remained low over time in the EZH2 knocked-down cells compared with controls (Fig. 4G). Recently, ASXL1 has been identified as an important gene involved in malignant transformation. Mutations in ASXL1 have been found in MDS, but also in AML, CMML, and myelofibrosis and are in general associated with an unfavorable prognosis [22Thol F. Friesen I. Damm F. et al.Prognostic significance of ASXL1 mutations in patients with myelodysplastic syndromes.J Clin Oncol. 2011; 29: 2499-2506Crossref PubMed Scopus (239) Google Scholar, 23Schnittger S. Eder C. Jeromin S. et al.ASXL1 exon 12 mutations are frequent in AML with intermediate risk karyotype and are independently associated with an adverse outcome.Leukemia. 2013; 27: 82-91Crossref PubMed Scopus (160) Google Scholar, 24Cui Y. Tong H. Du X. et al.Impact of TET2, SRSF2, ASXL1 and SETBP1 mutations on survival of patients with chronic myelomonocytic leukemia.Exp Hematol Oncol. 2015; 4: 14Crossref PubMed Scopus (26) Google Scholar, 25Vannucchi A.M. Lasho T.L. Guglielmelli P. et al.Mutations and prognosis in primary myelofibrosis.Leukemia. 2013; 27: 1861-1869Crossref PubMed Scopus (538) Google Scholar]. ASXL1 is a proposed partner of the PRC2 complex and, as such, is involved in epigenetic gene regulation [14Abdel-Wahab O. Adli M. LaFave L.M. et al.ASXL1 mutations promote myeloid transformation through loss of PRC2-mediated gene repression.Cancer Cell. 2012; 22: 180-193Abstract Full Text Full Text PDF PubMed Scopus (437) Google Scholar]. In the present study, we analyzed the consequences of loss of ASXL1 in normal HSPCs and observed that stem cells—and specifically progenitor cells—are strongly affected in their expansion, whereas the differentiation program is affected only modestly. Surprisingly, our data show that loss of ASXL1 does not contribute immediately to transformation, but rather leads to loss of cells due to apoptosis. It is likely that a subset of cells that adapt to ASXL1 knockdown may participate in the process of transformation. Our in vitro assays are apparently not sufficiently long term to allow hematopoietic clones to outgrow with the unfavorable ASXL1 mutation. In fact, mice with an ASXL1 mutation reveal an MDS phenotype only after serial transplantation [15Abdel-Wahab O. Gao J. Adli M. et al.Deletion of Asxl1 results in myelodysplasia and severe developmental defects in vivo.J Exp Med. 2013; 210: 2641-2659Crossref PubMed Scopus (239) Google Scholar]. This suggests that additional epigenetic or nonepigenetic alterations might be necessary for malignant transformation. Recently, population-based studies also revealed age-related mutations including ASXL1 in healthy individuals that are associated with clonal hematopoiesis [26Jaiswal S. Fontanillas P. Flannick J. et al.Age-related clonal hematopoiesis associated with adverse outcomes.N Engl J Med. 2014; 371: 2488-2498Crossref PubMed Scopus (2433) Google Scholar, 27Xie M. Lu C. Wang J. et al.Age-related mutations associated with clonal hematopoietic expansion and malignancies.Nat Med. 2014; 20: 1472-1478Crossref PubMed Scopus (1162) Google Scholar]. Only individuals with several mutations are at greater risk of developing myeloid malignancies. Data from patient studies also indicate that additional mutations such as U2AF1, EZH2, or NRAS/KRAS co-occur with ASXL1 mutations, suggesting that ASXL1 might need cooperating hits for malignant transformation. In addition, the microenvironment of the patient might have been adapted for and be permissive for ongoing transformation. It appeared that, on knockdown of ASXL1, the erythroid lineage was particularly affected. The strong response in the erythroid lineage might be related to the relatively high expression of ASXL1 in these cells [28Novershtern N. Subramanian A. Lawton L.N. et al.Densely interconnected transcriptional circuits control cell states in human hematopoiesis.Cell. 2011; 144: 296-309Abstract Full Text Full Text PDF PubMed Scopus (642) Google Scholar]. It was shown in purified hematopoietic cell populations that ASXL1 is more highly expressed in erythroid progenitors compared with more immature hematopoietic cells or myeloid progenitors. Loss of ASXL1 function triggered an apoptotic response and culturing these cells on stromal layer did not give them a selective advantage, in contrast to MDS erythroid progenitors, which have a strong benefit form their own microenvironment [3Folkerts H. Hazenberg C.L. Houwerzijl E.J. et al.Erythroid progenitors from patients with low-risk myelodysplastic syndromes are dependent on the surrounding micro environment for their survival.Exp Hematol. 2015; 43: 215-222.e2Abstract Full Text Full Text PDF Scopus (2) Google Scholar]. Gene expression studies of shASXL1 cells in erythroid liquid cultures demonstrated that the increased apoptosis could be linked to p21 in conjunction with reduced expression of BNIP3L and PIM1, which act together in the altered differentiation program and increased apoptosis. The set of affected genes were in general not consistent with the results of the study by Wahab et al. [14Abdel-Wahab O. Adli M. LaFave L.M. et al.ASXL1 mutations promote myeloid transformation through loss of PRC2-mediated gene repression.Cancer Cell. 2012; 22: 180-193Abstract Full Text Full Text PDF PubMed Scopus (437) Google Scholar]. Their dataset revealed changes in several apoptosis-related genes, which were, for the most part, unchanged in our study. This inconsistency might be related to differences in the experimental setup in the two studies. It has been proposed that ASXL1 affects the epigenetic machinery, which modifies chromatin in concert with the PRC2 complex [14Abdel-Wahab O. Adli M. LaFave L.M. et al.ASXL1 mutations promote myeloid transformation through loss of PRC2-mediated gene repression.Cancer Cell. 2012; 22: 180-193Abstract Full Text Full Text PDF PubMed Scopus (437) Google Scholar]. PRC2-ASXL1 activity may lead to an increase of H3K27 trimethylation and, therefore, a loss of ASXL1 presumably leads to a reduction of this silencing mark. Integration of gene expression and ChIP data after ASXL1 down-modulation in erythroid progenitor cells identified HOXA9 and p21 as targets with reduced H3K27me3. Previous studies have suggested that HOXA9 upregulation coincides with malignant transformation, but in the present experimental setup with normal CB CD34+ cells, transformation was not observed, possibly due to the activation of cell death pathways [18Kroon E. Thorsteinsdottir U. Mayotte N. Nakamura T. Sauvageau G. NUP98–HOXA9 expression in hemopoietic stem cells induces chronic and acute myeloid leukemias in mice.EMBO J. 2001; 20: 350-361Crossref PubMed Scopus (181) Google Scholar, 19Ayton P.M. Cleary M.L. Transformation of myeloid progenitors by MLL oncoproteins is dependent on Hoxa7 and Hoxa9.Genes Dev. 2003; 17: 2298-2307Crossref PubMed Scopus (370) Google Scholar]. In addition, the changes in trimethylation were observed in the erythroid lineage in particular. Trimethylation levels within the myeloid liquid cultures were not affected, possibly due to the already low trimethylation levels of the HOXA9 locus. A loss of ASXL1 may not lead to early noticeable changes in cell proliferation and differentiation among the myeloid lineage and changes on epigenetic level may take place at later time points. Knockdown of EZH2, an alternative member of the PRC2 complex, revealed similar phenotypes in the erythroid lineage, supporting the concept that ASXL1 conveys its function via the PRC2 complex in erythroid development. Although ASXL1 mutations are considered as a loss of function that can be mimicked using an RNAi approach, a recent study demonstrated that the ASXL1-truncated protein may act as a gain of function in the context of the ASXL1–BAP1 complex [29Balasubramani A. Larjo A. Bassein J.A. et al.Cancer-associated ASXL1 mutations may act as gain-of-function mutations of the ASXL1–BAP1 complex.Nat Commun. 2015; 6: 7307Crossref PubMed Scopus (128) Google Scholar]. Future studies need to be conducted to clarify whether the truncated ASXL1 protein is indeed functional. Based on our results, we conclude that ASXL1 is necessary for proper function of the erythroid differentiation and, to a lesser extent, of the myeloid compartment. In addition, loss of ASXL1 affects the frequency of stem cells negatively in long-term cultures. Elucidating the role of ASXL1 in HSCs further may contribute to improved treatment outcome of patients harboring ASXL1 mutations. The authors thank Dr. Albertus Titus Johannes Wierenga for his helpful suggestions throughout the experimental and research setup. This work was supported by the European Union (EU-FP7 Grant [282510]: “A Blueprint of Haematopoietic Epigenomes”). The authors declare no competing financial interests. Supplementary Figure E2Erythroid progenitors are compromised upon ASXL1 down-modulation. (A) Cumulative cell count of CB cells cultured under erythroid permissive conditions for hairpin #2 (n = 3). (B) Total percentage of Annexin V+ cells for both hairpins in erythroid liquid cultures (n = 3). (C) Percentage of cells in stages of erythroid differentiation and their percentage of Annexin V+ at day 10 and 13 (n = 3). (D) Total numbers of cells in stages of erythroid differentiation (n = 3). (E) Cells sorted at day 7 for Western blot analysis of Asxl1, Bnip3L, p21, and H3K27me3. Akt-t functions as a loading control. (F, G) Hairpin #1 and #2. Cells were sorted at day 7 for gene expression analysis, respectively (n = 2). Shown is the relative expression of target genes normalized against NACA and RPS11. Error bars represent SD; *p < 0.05; **p < 0.01; ***p < 0.0001.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Figure E3Erythroid progenitors are compromised when cultured on stroma. (A) Total percentage of Annexin V+ suspension cells at days 7 and 10 (n = 3). (B) Percentage of cells in different stages of erythroid differentiation and their percentage of Annexin V+ (n = 3). Error bars represent SD; *p < 0.05.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Figure E4Slight changes in EZH1 expression. (A) Gene expression normalized to NACA and RPS11 at day 7 of myeloid liquid cultures (n = 2). (B) Relative EZH1 expression upon EZH2 knock-down normalized against NACA and RPS11 (n = 2). Error bars represent SD; *p < 0.05.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Table E1List of quantitative PCR primer sequences in this studyGeneForward primers (5′ to 3′)Reverse primers (5′ to 3′)ASXL1GGTCAAATGAAGCGCAACAGAGACGGAGGTTGGTGTTGACAAGBAXCCAGCAAACTGGTGCTCAAGGGAGGCTTGAGGAGTCTCACBCL2AACATCGCCCTGTGGATGACGGCCGTACAGTTCCACAAAGBNIP3AGCTCACAGTCTGAGGAAGATGGCGCTTCGGGTGTTTAAAGAGGBNIP3LACACGTACCATCCTCATCGATCTGCCCATCTTCTTGCDKN1ACGACTGTGATGCGCTAATGGCGTTTTCGACCCTGAGAGDAPK1GGTCTTGAGGCAGATATGGTAGTTGACAGCGGATACEZH2CAGTTCGTGCCCTTGTGTGATAGGAAAGCGGTTTTGACACTCTGGATA1ACACTGTGGCGGAGAAATGCAGATGCCTTGCGGTTTCGAGGATA2AGCAAGGCTCGTTCCTGTTCGTCGGTTCTGCCCATTCATCHOXA9TGCAGTTTCATAATTTCCGTCGACGTAGTAGTTGCCCAGGGCCNACAGCCCTGCTTCAGATACTTACGAGACAGCTTCACCTTGAACP53GAGATGTTCCGAGAGCTGAATGAGGCTCTTGAACATGAGTTTTTTATGGCGGGAGGPIM1TCAAACACGTGGAGAAGGTAATGACGCCGGAGAAACPUMAGACCTCAACGCACAGTACGGGCAGGAGTCCCATGATGAGRPS11AAGATGGCGGACATTCAGACAGCTTCTCCTTGCCAGTTTC Open table in a new tab Supplementary Table E2List of ChIP primer sequences used in this studyGeneForward primers (5′ to 3′)Reverse primers (5′ to 3′)HOXA9AGTCAGTCAGGGACAAAGTGCCGGCCTTATGGCATTAAACHOXA11AGAGCCCATAGCTGAGGAGATGCAGTCGGAGCGTTAAAGP21GGAAAGCGGAGTGGAGTAAGGTGGACACAGTGGCGTAAAG Open table in a new tab" @default.
• W2519392912 created "2016-09-23" @default.
• W2519392912 creator A5011506752 @default.
• W2519392912 creator A5019699669 @default.
• W2519392912 creator A5050532707 @default.
• W2519392912 creator A5067822535 @default.
• W2519392912 date "2016-12-01" @default.
• W2519392912 modified "2023-09-28" @default.
• W2519392912 title "Loss of ASXL1 triggers an apoptotic response in human hematopoietic stem and progenitor cells" @default.
• W2519392912 cites W1889574318 @default.
• W2519392912 cites W1891790327 @default.
• W2519392912 cites W1976913227 @default.
• W2519392912 cites W1992320498 @default.
• W2519392912 cites W1992826811 @default.
• W2519392912 cites W1993185007 @default.
• W2519392912 cites W1998598673 @default.
• W2519392912 cites W1998890065 @default.
• W2519392912 cites W2005412609 @default.
• W2519392912 cites W2008261599 @default.
• W2519392912 cites W2009960767 @default.
• W2519392912 cites W2010318973 @default.
• W2519392912 cites W2026183275 @default.
• W2519392912 cites W2036038124 @default.
• W2519392912 cites W2047760441 @default.
• W2519392912 cites W2052451894 @default.
• W2519392912 cites W2073358532 @default.
• W2519392912 cites W2076096857 @default.
• W2519392912 cites W2083112109 @default.
• W2519392912 cites W2115551519 @default.
• W2519392912 cites W2123355582 @default.
• W2519392912 cites W2144691110 @default.
• W2519392912 cites W2144878135 @default.
• W2519392912 cites W2149858388 @default.
• W2519392912 cites W2150892663 @default.
• W2519392912 cites W2156794452 @default.
• W2519392912 cites W2158773950 @default.
• W2519392912 cites W2191233876 @default.
• W2519392912 cites W2258553021 @default.
• W2519392912 doi "https://doi.org/10.1016/j.exphem.2016.08.011" @default.
• W2519392912 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/27616637" @default.
• W2519392912 hasPublicationYear "2016" @default.
• W2519392912 type Work @default.
• W2519392912 sameAs 2519392912 @default.
• W2519392912 citedByCount "11" @default.
• W2519392912 countsByYear W25193929122017 @default.
• W2519392912 countsByYear W25193929122018 @default.
• W2519392912 countsByYear W25193929122019 @default.
• W2519392912 countsByYear W25193929122020 @default.
• W2519392912 crossrefType "journal-article" @default.
• W2519392912 hasAuthorship W2519392912A5011506752 @default.
• W2519392912 hasAuthorship W2519392912A5019699669 @default.
• W2519392912 hasAuthorship W2519392912A5050532707 @default.
• W2519392912 hasAuthorship W2519392912A5067822535 @default.
• W2519392912 hasBestOaLocation W25193929121 @default.
• W2519392912 hasConcept C109159458 @default.
• W2519392912 hasConcept C190283241 @default.
• W2519392912 hasConcept C201750760 @default.
• W2519392912 hasConcept C28328180 @default.
• W2519392912 hasConcept C502942594 @default.
• W2519392912 hasConcept C54355233 @default.
• W2519392912 hasConcept C86803240 @default.
• W2519392912 hasConcept C95444343 @default.
• W2519392912 hasConceptScore W2519392912C109159458 @default.
• W2519392912 hasConceptScore W2519392912C190283241 @default.
• W2519392912 hasConceptScore W2519392912C201750760 @default.
• W2519392912 hasConceptScore W2519392912C28328180 @default.
• W2519392912 hasConceptScore W2519392912C502942594 @default.
• W2519392912 hasConceptScore W2519392912C54355233 @default.
• W2519392912 hasConceptScore W2519392912C86803240 @default.
• W2519392912 hasConceptScore W2519392912C95444343 @default.
• W2519392912 hasFunder F4320320300 @default.
• W2519392912 hasIssue "12" @default.
• W2519392912 hasLocation W25193929121 @default.
• W2519392912 hasLocation W25193929122 @default.
• W2519392912 hasOpenAccess W2519392912 @default.
• W2519392912 hasPrimaryLocation W25193929121 @default.
• W2519392912 hasRelatedWork W1993503820 @default.
• W2519392912 hasRelatedWork W2120223845 @default.
• W2519392912 hasRelatedWork W2416660988 @default.
• W2519392912 hasRelatedWork W2578179644 @default.
• W2519392912 hasRelatedWork W2588548568 @default.
• W2519392912 hasRelatedWork W2784395700 @default.
• W2519392912 hasRelatedWork W2977919159 @default.
• W2519392912 hasRelatedWork W3132976081 @default.
• W2519392912 hasRelatedWork W4311268005 @default.
• W2519392912 hasRelatedWork W4312527920 @default.
• W2519392912 hasVolume "44" @default.
• W2519392912 isParatext "false" @default.
• W2519392912 isRetracted "false" @default.
• W2519392912 magId "2519392912" @default.
• W2519392912 workType "article" @default.