Matches in SemOpenAlex for { <https://semopenalex.org/work/W2560120216> ?p ?o ?g. }
Showing items 1 to 62 of
62
with 100 items per page.
- W2560120216 endingPage "20" @default.
- W2560120216 startingPage "14" @default.
- W2560120216 abstract "Highly sensitive and specific method for identification of pathogenic prion protein was developed. It was found that the water-soluble fractions of beef proteins and plasma proteins of farm animals are normal prion proteins in cattle. Aligning gene sequences of pathogenic and normal prion protein of sheep (Ovis aries) revealed that the nucleotide sequences of PrPc and PrPsc are identical. Murine monoclonal antibody 15B3 was selected. Synthetic sequence of 194 bps was randomly produced (DNA-tail). The produced sequence and the database sequences have no homologues. Two primer of 20 bps were selected for synthesized DNA-tail. The experimental data indicate that by using AGTCAGTCCTTGGCCTCCTT (left) and CAGTTTCGATCCTCCTCCAG (right) primers the amplification should be performed as follows: pre-denaturation, 95 °C, 60 seconds, 1 cycle; denaturation, 95 °C, 30 seconds, 30 cycles; annealing, 56 °C, 60 seconds, 30 cycles; elongation, 72 °C, 30 seconds, 30 cycles, additional elongation, 1 cycle, 600 seconds. The optimum concentration of reaction mixture components for PCR was established. High specificity of the developed test system and oligonucleotide primers was confirmed by electrophoretic separation of ground beef samples containing pathogenic prion protein, as well as by comparative analysis of the results of pathogenic prion protein determination. These results were obtained using PCR test system and TeSeE™ ELISA system." @default.
- W2560120216 created "2016-12-16" @default.
- W2560120216 creator A5028597080 @default.
- W2560120216 creator A5044122687 @default.
- W2560120216 date "2016-10-24" @default.
- W2560120216 modified "2023-10-16" @default.
- W2560120216 title "RESEARCH AND DEVELOPMENT CONTROL METHOD PATHOGENIC PRION INFECTIONS SECONDARY RAW MEAT INDUSTRY" @default.
- W2560120216 doi "https://doi.org/10.21323/2414-438x-2016-1-3-14-20" @default.
- W2560120216 hasPublicationYear "2016" @default.
- W2560120216 type Work @default.
- W2560120216 sameAs 2560120216 @default.
- W2560120216 citedByCount "0" @default.
- W2560120216 crossrefType "journal-article" @default.
- W2560120216 hasAuthorship W2560120216A5028597080 @default.
- W2560120216 hasAuthorship W2560120216A5044122687 @default.
- W2560120216 hasBestOaLocation W25601202161 @default.
- W2560120216 hasConcept C104317684 @default.
- W2560120216 hasConcept C129312508 @default.
- W2560120216 hasConcept C13965031 @default.
- W2560120216 hasConcept C153911025 @default.
- W2560120216 hasConcept C178790620 @default.
- W2560120216 hasConcept C185592680 @default.
- W2560120216 hasConcept C2776923230 @default.
- W2560120216 hasConcept C2777563447 @default.
- W2560120216 hasConcept C49105822 @default.
- W2560120216 hasConcept C552990157 @default.
- W2560120216 hasConcept C55493867 @default.
- W2560120216 hasConcept C86803240 @default.
- W2560120216 hasConceptScore W2560120216C104317684 @default.
- W2560120216 hasConceptScore W2560120216C129312508 @default.
- W2560120216 hasConceptScore W2560120216C13965031 @default.
- W2560120216 hasConceptScore W2560120216C153911025 @default.
- W2560120216 hasConceptScore W2560120216C178790620 @default.
- W2560120216 hasConceptScore W2560120216C185592680 @default.
- W2560120216 hasConceptScore W2560120216C2776923230 @default.
- W2560120216 hasConceptScore W2560120216C2777563447 @default.
- W2560120216 hasConceptScore W2560120216C49105822 @default.
- W2560120216 hasConceptScore W2560120216C552990157 @default.
- W2560120216 hasConceptScore W2560120216C55493867 @default.
- W2560120216 hasConceptScore W2560120216C86803240 @default.
- W2560120216 hasIssue "3" @default.
- W2560120216 hasLocation W25601202161 @default.
- W2560120216 hasLocation W25601202162 @default.
- W2560120216 hasOpenAccess W2560120216 @default.
- W2560120216 hasPrimaryLocation W25601202161 @default.
- W2560120216 hasRelatedWork W1967467411 @default.
- W2560120216 hasRelatedWork W1991525069 @default.
- W2560120216 hasRelatedWork W1991579867 @default.
- W2560120216 hasRelatedWork W2015656314 @default.
- W2560120216 hasRelatedWork W2037912916 @default.
- W2560120216 hasRelatedWork W2101116249 @default.
- W2560120216 hasRelatedWork W2333865586 @default.
- W2560120216 hasRelatedWork W2364143628 @default.
- W2560120216 hasRelatedWork W2376731378 @default.
- W2560120216 hasRelatedWork W2513714519 @default.
- W2560120216 hasVolume "1" @default.
- W2560120216 isParatext "false" @default.
- W2560120216 isRetracted "false" @default.
- W2560120216 magId "2560120216" @default.
- W2560120216 workType "article" @default.