FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2585807002> ?p ?o ?g. }

• W2585807002 endingPage "67.e5" @default.
• W2585807002 startingPage "56" @default.
• W2585807002 abstract "•Tet2 knockdown mice exhibit mild anemia and iron overload.•TET2 affects expression of genes related to iron/heme metabolism in erythroblasts.•TET2 regulates the DNA methylation of the Fech, Abcb7, and Sf3b1 promoters.•Reduced TET2 expression is not sufficient to induce RSs. Sideroblastic anemia is characterized by the presence of ring sideroblasts (RSs), which are caused by iron accumulation in the mitochondria of erythroblasts and are present in both the acquired and congenital forms of the disease. However, the mechanism leading to RS formation remains elusive. Acquired sideroblastic anemia is usually observed in myelodysplastic syndrome (MDS). Because a subset of MDS harbors a somatic mutation of TET2, it may be involved in iron metabolism and/or heme biosynthesis in erythroblasts. Tet2 knockdown (Tet2trap) induced exhibited mild normocytic anemia and elevated serum ferritin levels in 4-month-old mice. Although typical RSs were not observed, increased mitochondrial ferritin (FTMT) amounts were observed in the erythroblasts of Tet2-knockdown mice. Quantitative real-time polymerase chain reaction demonstrated significant dysregulation of genes involved in iron and heme metabolism, including Hmox1, Fech, Abcb7, and Sf3b1 downregulation. After the identification of a cytosine–guanine island in the promoters of Fech, Abcb7, and Sf3b1, we evaluated DNA methylation status and found significantly higher methylation levels at the CpG sites in the erythroblasts of Tet2-knockdown mice. Furthermore, Tet2 knockdown in erythroblasts resulted in decreased heme concentration and accumulation of FTMT. Therefore, TET2 plays a role in the iron and heme metabolism in erythroblasts. Sideroblastic anemia is characterized by the presence of ring sideroblasts (RSs), which are caused by iron accumulation in the mitochondria of erythroblasts and are present in both the acquired and congenital forms of the disease. However, the mechanism leading to RS formation remains elusive. Acquired sideroblastic anemia is usually observed in myelodysplastic syndrome (MDS). Because a subset of MDS harbors a somatic mutation of TET2, it may be involved in iron metabolism and/or heme biosynthesis in erythroblasts. Tet2 knockdown (Tet2trap) induced exhibited mild normocytic anemia and elevated serum ferritin levels in 4-month-old mice. Although typical RSs were not observed, increased mitochondrial ferritin (FTMT) amounts were observed in the erythroblasts of Tet2-knockdown mice. Quantitative real-time polymerase chain reaction demonstrated significant dysregulation of genes involved in iron and heme metabolism, including Hmox1, Fech, Abcb7, and Sf3b1 downregulation. After the identification of a cytosine–guanine island in the promoters of Fech, Abcb7, and Sf3b1, we evaluated DNA methylation status and found significantly higher methylation levels at the CpG sites in the erythroblasts of Tet2-knockdown mice. Furthermore, Tet2 knockdown in erythroblasts resulted in decreased heme concentration and accumulation of FTMT. Therefore, TET2 plays a role in the iron and heme metabolism in erythroblasts. Sideroblastic anemia is characterized by the presence of ring sideroblasts (RSs) in the bone marrow (BM). These RSs are formed due to the accumulation of iron in the mitochondria of erythroblasts and are observed in both acquired and congenital sideroblastic anemia [1Harigae H. Furuyama K. Hereditary sideroblastic anemia: pathophysiology and gene mutations.Int J Hematol. 2010; 92: 425-431Crossref PubMed Scopus (53) Google Scholar, 2Malcovati L. Cazzola M. Refractory anemia with ring sideroblasts.Best Pract Res Clin Haematol. 2013; 26: 377-385Abstract Full Text Full Text PDF PubMed Scopus (31) Google Scholar]. The excess of mitochondrial iron present in RSs exists in the form of mitochondrial ferritin (FTMT), a recently characterized ferritin encoded by an intronless gene located on chromosome 5q23 [3Levi S. Corsi B. Bosisio M. et al.A human mitochondrial ferritin encoded by an intronless gene.J Biol Chem. 2001; 276: 24437-24440Crossref PubMed Scopus (326) Google Scholar]. FTMT exhibits ferroxidase activity and is therefore likely to sequester potentially harmful free iron [3Levi S. Corsi B. Bosisio M. et al.A human mitochondrial ferritin encoded by an intronless gene.J Biol Chem. 2001; 276: 24437-24440Crossref PubMed Scopus (326) Google Scholar]. At the molecular level, the most common form of sideroblastic anemia is X-linked sideroblastic anemia (XLSA); this defect involves δ-aminolevulinate synthase (5-aminolevulinate synthase 2, ALAS2), which is encoded by a gene located at Xp11.21. ALAS2 encodes the first, rate-limiting enzyme of the heme biosynthetic pathway in erythroid cells, a process involving the condensation of glycine with succinyl-coenzyme A to yield 5-aminolevulic acid (ALA) [4Cotter P.D. Baumann M. Bishop D.F. Enzymatic defect in “X-linked” sideroblastic anemia: molecular evidence for erythroid delta-aminolevulinate synthase deficiency.Proc Natl Acad Sci U S A. 1992; 89: 4028-4032Crossref PubMed Scopus (132) Google Scholar]. XLSA is caused by a loss-of-function missense mutation or mutations in a GATA transcription factor binding site located within the transcriptional enhancer element within an intron of ALAS2 [1Harigae H. Furuyama K. Hereditary sideroblastic anemia: pathophysiology and gene mutations.Int J Hematol. 2010; 92: 425-431Crossref PubMed Scopus (53) Google Scholar, 5Harigae H. Suwabe N. Weinstock P.H. et al.Deficient heme and globin synthesis in embryonic stem cells lacking the erythroid-specific delta-aminolevulinate synthase gene.Blood. 1998; 91: 798-805PubMed Google Scholar, 6Kaneko K. Furuyama K. Fujiwara T. et al.Identification of a novel erythroid-specific enhancer for the ALAS2 gene and its loss-of-function mutation which is associated with congenital sideroblastic anemia.Haematologica. 2014; 99: 252-261Crossref PubMed Scopus (59) Google Scholar]. Therefore, defective ALAS2 enzymatic activity leads to insufficient protoporphyrin IX synthesis, mitochondrial iron overload, and intramedullary death of red blood cell precursors. Other genes responsible for congenital sideroblastic anemia include SLC25A38 and ABCB7, which are involved in glycine transport into the mitochondria and iron–sulfur cluster biogenesis, respectively [7Allikmets R. Raskind W.H. Hutchinson A. Schueck N.D. Dean M. Koeller D.M. Mutation of a putative mitochondrial iron transporter gene (ABC7) in X-linked sideroblastic anemia and ataxia (XLSA/A).Hum Mol Genet. 1999; 8: 743-749Crossref PubMed Scopus (351) Google Scholar, 8Guernsey D.L. Jiang H. Campagna D.R. et al.Mutations in mitochondrial carrier family gene SLC25A38 cause nonsyndromic autosomal recessive congenital sideroblastic anemia.Nat Genet. 2009; 41: 651-653Crossref PubMed Scopus (189) Google Scholar]. Although mitochondrial iron/heme metabolism dysregulation has been implicated in the underlying pathogenesis, the molecular basis of its role in myelodysplastic syndrome (MDS) with RS remains elusive. Recently, whole-exome sequencing analysis of a sample from a patient with MDS revealed a high frequency of mutations among RNA-splicing machinery genes, including U2AF35, ZRSR2, SRSF2, and SF3B1 [9Yoshida K. Sanada M. Shiraishi Y. et al.Frequent pathway mutations of splicing machinery in myelodysplasia.Nature. 2011; 478: 64-69Crossref PubMed Scopus (1487) Google Scholar]. According to the World Health Organization (WHO), cases that meet the appropriate morphological and cytogenetic criteria for MDS and harbor ≥15% RSs in BM are best classified as having refractory anemia with RSs (RARS); however, varying quantities of RSs (<15%) may be present in refractory anemia with multilineage dysplasia or other myeloid malignancies [10Vardiman J.W. Harris N.L. Brunning R.D. The World Health Organization (WHO) classification of the myeloid neoplasms.Blood. 2002; 100: 2292-2302Crossref PubMed Scopus (1800) Google Scholar]. Both MDS subsets and myeloid malignancies harbor a somatic mutation in the gene encoding TET2 (Ten-Eleven-Translocation 2) [11Delhommeau F. Dupont S. Valle V.D. et al.Mutation in TET2 in myeloid cancers.N Engl J Med. 2009; 360: 2289-2301Crossref PubMed Scopus (1405) Google Scholar, 12Malcovati L. Papaemmanuil E. Ambaglio I. et al.Driver somatic mutations identify distinct disease entities within myeloid neoplasms with myelodysplasia.Blood. 2014; 124: 1513-1521Crossref PubMed Scopus (205) Google Scholar]. TET2 regulates DNA demethylation by hydroxylating 5-methylcytosine to 5-hydroxymethylcytosine, leading to the activation of genes containing cytosine–guanine (CpG)-rich promoter sequences [13Pronier E. Almire C. Mokrani H. et al.Inhibition of TET2-mediated conversion of 5-methylcytosine to 5-hydroxymethylcytosine disturbs erythroid and granulomonocytic differentiation of human hematopoietic progenitors.Blood. 2011; 118: 2551-2555Crossref PubMed Scopus (144) Google Scholar, 14Visconte V. Rogers H.J. Singh J. et al.SF3B1 haploinsufficiency leads to formation of ring sideroblasts in myelodysplastic syndromes.Blood. 2012; 120: 3173-3186Crossref PubMed Scopus (161) Google Scholar, 15Wang C. Sashida G. Saraya A. et al.Depletion of Sf3b1 impairs proliferative capacity of hematopoietic stem cells but is not sufficient to induce myelodysplasia.Blood. 2014; 123: 3336-3343Crossref PubMed Scopus (34) Google Scholar]. A previous study demonstrated that TET2 knockdown inhibits erythroid colony formation from CD34-positive cells in vitro [13Pronier E. Almire C. Mokrani H. et al.Inhibition of TET2-mediated conversion of 5-methylcytosine to 5-hydroxymethylcytosine disturbs erythroid and granulomonocytic differentiation of human hematopoietic progenitors.Blood. 2011; 118: 2551-2555Crossref PubMed Scopus (144) Google Scholar]. Therefore, we speculate that TET2 has an important role during erythroid differentiation, presumably through affecting the expression of genes involved in iron metabolism and/or heme biosynthesis in erythroblasts; accordingly, a TET2 mutation might contribute to the formation of RSs. To explore this possibility, we conducted biological and molecular analyses on Tet2-knockdown mice. Tet2-knockdown mice (Ayu17-449, Tet2trap) were generated by gene trap mutagenesis, as described previously [16Tang H. Araki K. Li Z. Yamamura K. Characterization of Ayu17-449 gene expression and resultant kidney pathology in a knockout mouse model.Transgenic Res. 2008; 17: 599-608Crossref PubMed Scopus (14) Google Scholar, 17Shide K. Kameda T. Shimoda H. et al.TET2 is essential for survival and hematopoietic stem cell homeostasis.Leukemia. 2012; 26: 2216-2223Crossref PubMed Scopus (62) Google Scholar]. Four-month-old mice (both heterozygous Tet2trap/+ and homozygous Tet2trap/trap) were used in the present study. Before each analysis, the mice were sacrificed via isoflurane inhalation followed by cervical dislocation. The study protocol was approved by the ethics committee of Tohoku University (Sendai, Japan) and animal experiments were conducted at the Institute for Animal Experimentation, Tohoku University Graduate School of Medicine. A magnetic-activated cell sorter system (Miltenyi Biotec, Inc., Auburn, CA, USA) was used to separate the Ter119-positive cell populations. To obtain fractionated erythroid populations (Stages I–IV), fluorescence-activated cell sorting was conducted using a FACSAria II Cell Sorter (BD Biosciences, San Jose, CA, USA). BM cells collected from the bilateral femur and tibia were suspended in staining buffer (phosphate-buffered saline with 3% fetal bovine serum) and stained with phycoerythrin-labeled anti-Ter119 and fluorescein isothiocyanate-labeled anti-CD71 antibodies (BD Biosciences). Cells were sorted with FACS Aria I or II instruments (BD Biosciences). Data were analyzed using FlowJo software (TreeStar, Ashland, OR, USA). Total RNA was purified using the NucleoSpin RNA XS Purification Kit (Takara Bio, Inc., Shiga, Japan) and converted to cDNA using Moloney murine leukemia virus reverse transcriptase and random primers (ReverTra Ace kit; Toyobo, Tokyo, Japan). The QuantiTect SYBR Green PCR Kit (QIAGEN, Valencia, CA, USA) and the Chromo4 Real-Time System (Bio-Rad, Hercules, CA, USA) were used to perform qRT-PCR. Reaction mixtures (20 μL) for qRT-PCR consisted of 2 μL of cDNA, 10 μL of SYBR Green Master Mix (Qiagen GmbH, Hilden, Germany), and the appropriate primers. Primer sequences are shown in Table 1. Product synthesis was monitored by measuring SYBR Green fluorescence levels, which were subsequently normalized to the fluorescence levels associated with 18S ribosomal RNA. For all qRT-PCR analyses, we used absolute quantification by using standard plasmids. To obtain plasmids for use as standards for qRT-PCR, an amplified cDNA fragment of the gene of interest was cloned into the pGEM™-T Easy Vector System (Promega Corp., Madison, WI, USA).Table 1Oligonucleotide primersDesignationForward and reverse sequence (5′–3′)Primers used for qRT-PCR Tet2ForwardTCTCAGGAGTCACTGCATGTTTReverseTTAGCTCCGACTTCTCGATTG Hmox1ForwardAAGAGGCTAAGACCGCTTCReverseGCATAAATTCCCACTGCCAC βmajorForwardTTTAACGATGGCCTGAATCACTTReverseCAGCACAATCACGATCATATTGC Alas2ForwardCCATCTTAAGGCAACCAAGGCReverseACAGCATGAAAGGACAATGGC Gata1ForwardGGCCCAAGAAGCGAATGATTReverseGGTTCACCTGATGGAGCTTGA FechForwardTGGAGCACAATCGACAGGTGReverseAACAGACATCGGCAGGGAGT Mfrn1ForwardCATGACAGCGGGAGCGATReverseGGCTTTGGGATCTGGATTCA Abcb7ForwardTTACAAGATGTGAGCCTGGAAAReverseTTTGCGACTGCATATACTTCCTC Sf3b1ForwardCAACACAGAATGGCTTTGGATAReverseTCCTGTACTGCTCAGCTTCATC Slc25a38ForwardGTGGTTCGCACAGAAAGTCTCReverseGAAGAATACAGGGTGCCAAAGT Tfr1ForwardGAGGGTTATGTGGCATTCAGTAReverseATTTCCCCTGCTCTAACAATCA Dmt1ForwardGAATCTGATTTGCAGTCTGGAGReverseACGGTGACATACTTCAGCAAGA Steap3ForwardGCCAGTCTAACGCTGAGTACCTReverseGCTTCTGGCTGATCACTGC Abcb10ForwardGAGATGACGGAAGTGGAGAAGTReverseTTTGTACAGGACAGACAGCACA 18SForwardCGCCGCTAGAGGTGAAATTCTReverseCGAACCTCCGACTTTCGTTCT ActbForwardCGTTGACATCCGTAAAGACCTCReverseAGCCACCGATCCACACAGAPrimers used for DNA methylation analysis Fech promoterForwardAGAAGGTGGAAGCTGCAACTReverseGTTCCAGTTTCGACCAGGTTG Abcb7 promoterForwardTTCTCTCTTAGCGTTGCCAGATReverseTCGAATGGCAGACAAGATAGGG Sf3b1 promoterForwardATTTTGTCCACTCGAACACACAReverseTAGGTGGCAGTTGAAGTACGTG Actb promoterForwardCCCAACACACCTAGCAAATTAGAACCACReverseCCTGGATTGAATGGACAGAGAGTCACT Mfrn1 promoterForwardCAGCGACGTCACACAGAGAReverseCCAATAGCTGGAGAAGAAGAGG Abcb10 promoterForwardTCTCGGGGTCACTTCTACTCTCReverseTACGACCTGAGTCTCTTGCTTGPrimers used for bisulfite sequencing Fech promoterForwardTTTGGGTATTGGTTTTGGTAAReverseACCAATTACAACTTCCACCTTC Abcb7 promoterForwardTAATGGTAGTTTGATGGTTTGGReverseTAAAATCACAAAAACAACCCTTT Open table in a new tab Genomic DNA samples were extracted from the Ter119-positive cells of wild-type (WT) and Tet2trap/trap mice using the Nucleospin Tissue Genomic DNA Purification Kit (Takara Bio, Inc.). Extracted DNA was fragmented with a Bioruptor (Diagenode, Philadelphia, PA, USA) for 12 min (30 sec pulses, 1 min pauses) to reduce the average DNA length to 100–1000 base pairs. Subsequently, DNA methylation status was assessed using the EpiXploreTM Methylated DNA Enrichment Kit (Clontech, Mountain View, CA, USA) according to the manufacturer's recommendations. For the elution of enriched methylated DNA from the methyl-CpG binding domain protein 2 (MBD2) protein/magnetic bead complex, we used a single fraction method. Quantification was performed with the SYBR Premix Ex Taq GC reagent (Takara Bio, Inc.) and the Chromo4 Real-Time System. Primer sequences are shown in Table 1. The DNA methylation level of each gene was normalized to that of the Actb promoter [18Takai J. Moriguchi T. Suzuki M. Yu L. Ohneda K. Yamamoto M. The Gata1 5’ region harbors distinct cis-regulatory modules that direct gene activation in erythroid cells and gene inactivation in HSCs.Blood. 2013; 122: 3450-3460Crossref PubMed Scopus (29) Google Scholar]. The UCSC Genome Browser (http://genome.ucsc.edu) was used to identify CpG islands. Bisulfite treatment and sample recovery were performed with the MethylEasy Xceed Rapid DNA Bisulfite Modification kit (Takara Bio, Inc., Japan). Amplified DNA fragment was cloned into the pGEM™-T Easy Vector System (Promega Corp.) and sequencing was subsequently conducted with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) and the 3730×/DNA Analyzer (Applied Biosystems). Statistical analysis was conducted with QUMA (Quantification tool for Methylation Analysis; http://quma.cdb.riken.jp/top/quma_main_j.html). Primer pairs used for PCR amplification of the bisulfite-treated DNA are shown in Table 1. To obtain a complete blood count, peripheral blood was collected from the retro-orbital vein and analyzed using a hemocytometer (LC-152; Horiba, Ltd., Kyoto, Japan). Serum biochemical analyses were conducted by Oriental Yeast, Co., Ltd. (Tokyo, Japan). Serum ferritin levels were analyzed using the Ferritin Mouse ELISA Kit (Abcam, Cambridge, UK). Whole-cell extracts were prepared by boiling cells at 100°C for 10 min at a concentration of 1 × 107 cells/mL in sodium dodecyl sulfate (SDS) sample buffer (25 mM Tris, pH 6.8, 2% β-mercaptoethanol, 3% SDS, 0.1% bromophenol blue, and 5% glycerol). Extracts from 1–2 × 105 cells were resolved by SDS-polyacrylamide gel electrophoresis and transferred to a Hybond-P polyvinylidene fluoride blotting membrane (GE Healthcare, Cleveland, OH, USA). The proteins were semiquantitatively measured using the ECL-Plus Kit (GE Healthcare) and images were captured using CL-X PosureTM film (Thermo Fisher Scientific, Waltham, MA, USA). Recombinant ferritin (heavy polypeptide 22.6 kDa: RPD021Mu01) and ferritin (mitochondrial 21.9 kDa: RPD251Mu01) were from USCN Life Science (Wuhan, China). Antibody against FTMT (M-60), goat anti-rabbit horseradish peroxidase (HRP)-conjugated IgG (sc-2004), and goat anti-mouse HRP-conjugated IgG (sc-2005) were from Santa Cruz Biotechnology (Dallas, TX, USA). Antibodies against ferritin (ab75973) and α-Tubulin (CP06) were from Abcam and Calbiochem (Darmstadt, Germany), respectively. Antibody against ferrochelatase (Fech) (bs-9521R) was from Bioss Antibodies (Woburn, MA, USA). Heme content was determined fluorometrically as described previously [19Fujiwara T. Alqadi Y.W. Okitsu Y. et al.Role of transcriptional corepressor ETO2 in erythroid cells.Exp Hematol. 2013; 41: 303-315Abstract Full Text Full Text PDF PubMed Scopus (19) Google Scholar]. Ter119-positive cell pellets were suspended in 2 mol/L oxalic acid and boiled at 100°C for 30 min to dissociate protoporphyrin IX and iron from heme. Subsequently, the fluorescence of protoporphyrin IX was measured at 400 nm (excitation) and 662 nm (emission). To exclude endogenous protoporphyrin IX levels, the fluorescence levels of the unboiled samples were subtracted from the results. For preparing standard solution, hemin (Sigma-Aldrich Corp., St. Louis, MO, USA) was dissolved into 40% dimethyl sulfoxide (Sigma-Aldrich Corp.). Freshly-isolated Ter119-positive cells were centrifuged at 500 rpm for 3 min using the Shandon Cytospin 4 cytocentrifuge (Thermo Fisher Scientific). The cells were subsequently stained with May–Grünwald Giemsa stain (Merck KGaA, Darmstadt, Germany) and Prussian blue stain (Sigma-Aldrich Corp.). The frequency of sideroblasts in 500 erythroblasts in BM was quantified by light microscopy. Sera from all mice were frozen and stored at −80°C until analysis. Serum hepcidin-25 levels were determined using a liquid chromatography–tandem mass spectrometry-based assay system as described previously [20Hattori A. Tomosugi N. Tatsumi Y. et al.Identification of a novel mutation in the HAMP gene that causes non-detectable hepcidin molecules in a Japanese male patient with juvenile hemochromatosis.Blood Cells Mol Dis. 2012; 48: 17-182Crossref PubMed Scopus (18) Google Scholar]. Statistical significance was assessed using the two-sided Student t test. In all analyses, a p value < 0.05 was considered to indicate statistical significance. For bisulfite sequencing, statistical significance was assessed using Fisher's exact test and Mann–Whitney U test. We first assessed Tet2 expression during murine erythroid differentiation. We separated erythroid populations from the BM of WT mice on the basis of CD71 (Transferrin Receptor) and Ter119 (a molecule associated with glycophorine A) expression into stage I (CD71highTer119–), stage II (CD71highTer119+), stage III (CD71lowTer119+), and stage IV (CD71–Ter119+) erythroblasts as described previously (Fig. 1A) [21Socolovsky M. Nam H. Fleming M.D. Haase V.H. Brugnara C. Lodish H.F. Ineffective erythropoiesis in Stat5a−/− 5b−/− mice due to decreased survival of early erythroblasts.Blood. 2001; 98: 3261-3273Crossref PubMed Scopus (578) Google Scholar]. qRT-PCR analysis confirmed increased expression levels of β-globin (βmajor) and heme oxygenase 1 (Hmox1) during erythroid differentiation, with the peak levels detected in stage III cells (Fig. 1B) [22Garcia-Santos D. Schranzhofer M. Horvathova M. et al.Heme oxygenase 1 is expressed in murine erythroid cells where it controls the level of regulatory heme.Blood. 2014; 123: 2269-2277Crossref PubMed Scopus (26) Google Scholar]. Under conditions of erythroid differentiation, Tet2 expression remained high at stage I and moderately but significantly decreased during stages II–IV (Fig. 1B). Hematological analyses revealed that both Tet2trap/+ and Tet2trap/trap mice exhibited mild normocytic anemia (Table 1) at 4 months of age, but failed to exhibit significant decreases in hemoglobin levels at younger ages (8 weeks; data not shown). In addition, the Tet2-knockdown mice exhibited leukocytosis, as reported previously [17Shide K. Kameda T. Shimoda H. et al.TET2 is essential for survival and hematopoietic stem cell homeostasis.Leukemia. 2012; 26: 2216-2223Crossref PubMed Scopus (62) Google Scholar]. Biochemical analyses revealed that Tet2 knockdown led to increases in serum iron and ferritin levels (Fig. 2 and Table 2), suggesting that TET2 is involved in iron homeostasis. Because systemic iron balance is mainly regulated by hepcidin, which is produced by the liver and limits the entry of iron into the plasma [23Ganz T. Nemeth E. Hepcidin and iron homeostasis.Biochim Biophys Acta. 2012; 1823: 1434-1443Crossref PubMed Scopus (856) Google Scholar], we further evaluated serum hepcidin levels. Unexpectedly, serum hepcidin levels did not differ among WT, Tet2trap/+, and Tet2trap/trap mice (Supplementary Figure E1, online only, available at www.exphem.org).Table 2Hematologic and biochemical parameters of Tet2-knockdown miceWTTet2trap/+Tet2trap/trapWBC, μLap < 0.05, WT versus Tet2trap/trap.,bp < 0.05, Tet2 trap/+ versus Tet2trap/trap.,cp < 0.05, WT versus Tet2trap/+.8800.0 ± 269613450.0 ± 273214325.0 ± 2964RBC, ×104/μLbp < 0.05, Tet2 trap/+ versus Tet2trap/trap.834.1 ± 74.9774.3 ± 39.5745.4 ± 50.8HGB, g/dLap < 0.05, WT versus Tet2trap/trap.,bp < 0.05, Tet2 trap/+ versus Tet2trap/trap.,cp < 0.05, WT versus Tet2trap/+.14.5 ± 1.113.2 ± 0.612.2 ± 0.8HCT, %ap < 0.05, WT versus Tet2trap/trap.,bp < 0.05, Tet2 trap/+ versus Tet2trap/trap.38.3 ± 3.435.7 ± 1.834.5 ± 2.4MCV, fL46.0 ± 1.145.1 ± 1.046.3 ± 1.7MCH, pgbp < 0.05, Tet2 trap/+ versus Tet2trap/trap.,cp < 0.05, WT versus Tet2trap/+.17.4 ± 0.717.1 ± 0.516.4 ± 0.7MCHC, g/dLbp < 0.05, Tet2 trap/+ versus Tet2trap/trap.,cp < 0.05, WT versus Tet2trap/+.37.8 ± 137.9 ± 135.6 ± 1PLT, ×104/μL80.1 ± 18.774.7 ± 19.177.0 ± 19.3Fe, μg/dLap < 0.05, WT versus Tet2trap/trap.,bp < 0.05, Tet2 trap/+ versus Tet2trap/trap.131.3 ± 15.9148.1 ± 13.6160.1 ± 20.3UIBC, μg/dLbp < 0.05, Tet2 trap/+ versus Tet2trap/trap.270.0 ± 20.4251.6 ± 24.9207.9 ± 53.0TIBC, μg/dL401.3 ± 28.5399.8 ± 28.9368.0 ± 46.9Ferritin, ng/mLap < 0.05, WT versus Tet2trap/trap.,bp < 0.05, Tet2 trap/+ versus Tet2trap/trap.,cp < 0.05, WT versus Tet2trap/+.104.7 ± 42.4171.6 ± 89.5329.6 ± 199.2HCT = hematocrit; HGB = hemoglobin; MCH = mean corpuscular hemoglobin; MCHC = mean corpuscular hemoglobin concentration; MCV = mean corpuscular volume; PLT = platelets; RBC = red blood cells; TIBC = total iron binding capacity; UIBC = unsaturated iron binding capacity; WBC = white blood cells.Data are expressed as mean ± SD (n = 8).a p < 0.05, WT versus Tet2trap/trap.b p < 0.05, Tet2 trap/+ versus Tet2trap/trap.c p < 0.05, WT versus Tet2trap/+. Open table in a new tab HCT = hematocrit; HGB = hemoglobin; MCH = mean corpuscular hemoglobin; MCHC = mean corpuscular hemoglobin concentration; MCV = mean corpuscular volume; PLT = platelets; RBC = red blood cells; TIBC = total iron binding capacity; UIBC = unsaturated iron binding capacity; WBC = white blood cells. Data are expressed as mean ± SD (n = 8). Next, we conducted flow cytometry to determine the role of TET2 in erythropoiesis. This analysis revealed a significant decrease in the total number of erythroblasts (stages I–IV; Fig. 3A and 3B), suggesting an important role of TET2 in erythropoiesis. To explore the molecular mechanism by which TET2 deficiency might cause anemia and iron overload, we subjected Ter119-positive erythroblasts to qRT-PCR analysis of genes involved in erythroid differentiation (Gata1), RNA splicing (splicing factor 3b [Sf3b1]), heme biosynthesis (Alas2, Fech, and Hmox1), and iron metabolism (adenosine triphosphate binding cassette B7 [Abcb7], mitoferrine [Slc25a37, Mfrn1], adenosine triphosphate binding cassette B10 [Abcb10], STEAP family member 3 [Steap3], and divalent metal transporter 1 [Dmt1, Slc11a2]), which could potentially lead to RS formation. The results demonstrated a significant downregulation of the expressions of Tet2, Alas2, Hmox1, Fech, Abcb7, and Sf3b1 and a significant upregulation of the expressions of Mfrn1, Abcb10, Steap3, and Dmt1 in the Tet2trap/+ and Tet2trap/trap mice (Fig. 4). However, Gata1 expression was unaffected by Tet2 knockdown (Fig. 4). We further examined the expression levels of genes potentially involved in RS formation (Fech, Abcb7, and Sf3b1) [7Allikmets R. Raskind W.H. Hutchinson A. Schueck N.D. Dean M. Koeller D.M. Mutation of a putative mitochondrial iron transporter gene (ABC7) in X-linked sideroblastic anemia and ataxia (XLSA/A).Hum Mol Genet. 1999; 8: 743-749Crossref PubMed Scopus (351) Google Scholar, 9Yoshida K. Sanada M. Shiraishi Y. et al.Frequent pathway mutations of splicing machinery in myelodysplasia.Nature. 2011; 478: 64-69Crossref PubMed Scopus (1487) Google Scholar, 15Wang C. Sashida G. Saraya A. et al.Depletion of Sf3b1 impairs proliferative capacity of hematopoietic stem cells but is not sufficient to induce myelodysplasia.Blood. 2014; 123: 3336-3343Crossref PubMed Scopus (34) Google Scholar, 24Yamamoto M. Arimura H. Fukushige T. et al.Abcb10 role in heme biosynthesis in vivo: Abcb10 knockout in mice causes anemia with protoporphyrin IX and iron accumulation.Mol Cell Biol. 2014; 34: 1077-1084Crossref PubMed Scopus (47) Google Scholar] by separating cells according to erythroid fractions (stages I–IV). We observed the same trend in whole Ter119-positive cells (Fig. 4), although the results did not reach statistically significance in most of the analyses (Supplementary Figures E2A and E2B, online only, available at www.exphem.org). Conversely, we confirmed that Tet2 was significantly downregulated in stage I erythroblasts, in which Tet2 was abundantly expressed (Fig. 1 and Supplementary Figure E3, online only, available at www.exphem.org). TET2 regulates DNA demethylation by hydroxylating of 5-methylcytosine to 5-hydroxymethylcytosine, leading to the activation of genes with promoters containing CpG-rich sequences [25Tahiliani M. Koh K.P. Shen Y. et al.Conversion of 5-methylcytosine to 5-hydroxymethylcytosine in mammalian DNA by MLL partner TET1.Science. 2009; 324: 930-935Crossref PubMed Scopus (4229) Google Scholar, 26Ko M. Huang Y. Jankowska A.M. et al.Impaired hydroxylation of 5-methylcytosine in myeloid cancers with mutant TET2.Nature. 2010; 468: 839-843Crossref PubMed Scopus (1023) Google Scholar, 27Koh K.P. Yabuuchi A. Rao S. et al.Tet1 and Tet2 regulate 5-hydroxymethylcytosine production and cell lineage specification in mouse embryonic stem cells.Cell Stem Cell. 2011; 8: 200-213Abstract Full Text Full Text PDF PubMed Scopus (608) Google Scholar]. Through a database search (https://genome.ucsc.edu), we identified CpG motifs in the promoters of Fech, Abcb7, Sf3b1, Mfrn1, Abcb10, and Dmt1. Accordingly, we evaluated the DNA methylation status of genes with downregulated expression in erythroblasts of Tet2-knockdown mice that horbored CpG islands within their promoter regions, such as Fech, Abcb7, and Sf3b1 (Fig. 4). A quantitative DNA methylation analysis was conducted as described previously [28Lizardi P.M. Yan Q. Wajapeyee N. Analysis of DNA methylation in mammalian cells.Cold Spring Harb Protoc. 2016; (http://dx.doi.org/10.1101/pdb.top094821 [Epub ahead of print])Google Scholar] and we also confirmed that the expression of Actb in Ter119-positive erythroblasts was not affected by Tet2 knockdown (Supplementary Figure E4, online only, available at www.exphem.org). As shown in Figure 5A, we demonstrated significantly high levels of methylation at the CpG sites of Fech, Abcb7, and Sf3b1 in the Ter119-positive cells of Tet2trap/trap mice compared with cells from WT mice. Bisulfite sequencing confirmed significantly increased methylated CpG frequencys of Ter119-positive cells fromTet2trap/trap mice at Abcb7 promoter (Fig. 5B). We also demonstrated increased methylated CpG frequency of Ter119-positive cells fromTet2trap/trap mice at the Fech promoter, although we observed global hypomethylation at this region (Supplementary Figure E5, online only, available at www.exphem.org). As a control, we also evaluated the DNA methylation statuses at CpG islands in Mfrn1 and Abcb10 to demonstrate that Tet2 knockdown did not af" @default.
• W2585807002 created "2017-02-10" @default.
• W2585807002 creator A5012027495 @default.
• W2585807002 creator A5013517572 @default.
• W2585807002 creator A5032563318 @default.
• W2585807002 creator A5046529772 @default.
• W2585807002 creator A5051606627 @default.
• W2585807002 creator A5055192416 @default.
• W2585807002 creator A5056287200 @default.
• W2585807002 creator A5075539771 @default.
• W2585807002 creator A5077166961 @default.
• W2585807002 creator A5079272025 @default.
• W2585807002 creator A5081301408 @default.
• W2585807002 date "2017-05-01" @default.
• W2585807002 modified "2023-10-17" @default.
• W2585807002 title "Impact of TET2 deficiency on iron metabolism in erythroblasts" @default.
• W2585807002 cites W1171241794 @default.
• W2585807002 cites W1553923096 @default.
• W2585807002 cites W1562582642 @default.
• W2585807002 cites W1568628619 @default.
• W2585807002 cites W1968347019 @default.
• W2585807002 cites W1972429414 @default.
• W2585807002 cites W1972437605 @default.
• W2585807002 cites W1972998779 @default.
• W2585807002 cites W1974371672 @default.
• W2585807002 cites W1976397332 @default.
• W2585807002 cites W1976573435 @default.
• W2585807002 cites W1977142594 @default.
• W2585807002 cites W1981921100 @default.
• W2585807002 cites W1997998180 @default.
• W2585807002 cites W2005458309 @default.
• W2585807002 cites W2006383772 @default.
• W2585807002 cites W2014179433 @default.
• W2585807002 cites W2014658249 @default.
• W2585807002 cites W2018212295 @default.
• W2585807002 cites W2022751993 @default.
• W2585807002 cites W2026134786 @default.
• W2585807002 cites W2028034405 @default.
• W2585807002 cites W2028078153 @default.
• W2585807002 cites W2029528461 @default.
• W2585807002 cites W2035166160 @default.
• W2585807002 cites W2035777896 @default.
• W2585807002 cites W2040257851 @default.
• W2585807002 cites W2054465450 @default.
• W2585807002 cites W2058311446 @default.
• W2585807002 cites W2067257787 @default.
• W2585807002 cites W2069774708 @default.
• W2585807002 cites W2073889874 @default.
• W2585807002 cites W2076153728 @default.
• W2585807002 cites W2078277354 @default.
• W2585807002 cites W2080762011 @default.
• W2585807002 cites W2082089700 @default.
• W2585807002 cites W2087390915 @default.
• W2585807002 cites W2096638244 @default.
• W2585807002 cites W2097743943 @default.
• W2585807002 cites W2108141473 @default.
• W2585807002 cites W2108664872 @default.
• W2585807002 cites W2109650275 @default.
• W2585807002 cites W2112851030 @default.
• W2585807002 cites W2116205277 @default.
• W2585807002 cites W2119835442 @default.
• W2585807002 cites W2125026005 @default.
• W2585807002 cites W2138472595 @default.
• W2585807002 cites W2143881989 @default.
• W2585807002 cites W2146155744 @default.
• W2585807002 cites W2150246687 @default.
• W2585807002 cites W2150887357 @default.
• W2585807002 cites W2158207797 @default.
• W2585807002 cites W2159249303 @default.
• W2585807002 cites W4210291672 @default.
• W2585807002 doi "https://doi.org/10.1016/j.exphem.2017.01.002" @default.
• W2585807002 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/28167288" @default.
• W2585807002 hasPublicationYear "2017" @default.
• W2585807002 type Work @default.
• W2585807002 sameAs 2585807002 @default.
• W2585807002 citedByCount "10" @default.
• W2585807002 countsByYear W25858070022017 @default.
• W2585807002 countsByYear W25858070022018 @default.
• W2585807002 countsByYear W25858070022019 @default.
• W2585807002 countsByYear W25858070022020 @default.
• W2585807002 countsByYear W25858070022021 @default.
• W2585807002 countsByYear W25858070022023 @default.
• W2585807002 crossrefType "journal-article" @default.
• W2585807002 hasAuthorship W2585807002A5012027495 @default.
• W2585807002 hasAuthorship W2585807002A5013517572 @default.
• W2585807002 hasAuthorship W2585807002A5032563318 @default.
• W2585807002 hasAuthorship W2585807002A5046529772 @default.
• W2585807002 hasAuthorship W2585807002A5051606627 @default.
• W2585807002 hasAuthorship W2585807002A5055192416 @default.
• W2585807002 hasAuthorship W2585807002A5056287200 @default.
• W2585807002 hasAuthorship W2585807002A5075539771 @default.
• W2585807002 hasAuthorship W2585807002A5077166961 @default.
• W2585807002 hasAuthorship W2585807002A5079272025 @default.
• W2585807002 hasAuthorship W2585807002A5081301408 @default.
• W2585807002 hasBestOaLocation W25858070021 @default.
• W2585807002 hasConcept C134018914 @default.
• W2585807002 hasConcept C42407357 @default.
• W2585807002 hasConcept C62231903 @default.

• next