FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2780496211> ?p ?o ?g. }

• W2780496211 endingPage "1181" @default.
• W2780496211 startingPage "1181" @default.
• W2780496211 abstract "HomePlant DiseaseVol. 102, No. 6First Report of a Cilevirus Associated with Green Ringspot on Senescent Hibiscus Leaves in Tampa, Florida Previous DISEASE NOTES OPENOpen Access licenseFirst Report of a Cilevirus Associated with Green Ringspot on Senescent Hibiscus Leaves in Tampa, FloridaA. Roy, A. L. Stone, M. J. Melzer, J. S. Hartung, V. A. Mavrodieva, M. K. Nakhla, W. L. Schneider, and R. H. BrlanskyA. Roy†Corresponding author: A. Roy; E-mail: E-mail Address: [email protected]Search for more papers by this author, A. L. StoneSearch for more papers by this author, M. J. MelzerSearch for more papers by this author, J. S. HartungSearch for more papers by this author, V. A. MavrodievaSearch for more papers by this author, M. K. NakhlaSearch for more papers by this author, W. L. SchneiderSearch for more papers by this author, and R. H. BrlanskySearch for more papers by this authorAffiliationsAuthors and Affiliations A. Roy † , USDA-APHIS-PPQ-S&T, Beltsville, MD 20705 A. L. Stone , USDA-ARS, FDWSRU, Fort Detrick, MD 21702 M. J. Melzer , Plant and Environmental Protection Sciences, University of Hawaii, Honolulu 96822 J. S. Hartung , USDA-ARS, MPPL, Beltsville, MD 20705 V. A. Mavrodieva M. K. Nakhla , USDA-APHIS-PPQ-S&T, Beltsville, MD 20705 W. L. Schneider , USDA-ARS, FDWSRU, Fort Detrick, MD 21702 R. H. Brlansky , University of Florida, CREC, Lake Alfred, 33850. Published Online:2 Apr 2018https://doi.org/10.1094/PDIS-11-17-1699-PDNAboutSectionsSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat A nonsystemic cilevirus producing green ringspot symptoms in ornamental hibiscus (Hibiscus rosa-sinensis) was first reported from Hawaii in 2013 and was named Hibiscus-infecting cilevirus (HiCV) (Melzer et al. 2013). The false spider mite Brevipalpus yothersi is associated with symptomatic hibiscus, but its role as a vector of HiCV has not yet been demonstrated. Positive-sense bipartite HiCV genome shared 86.2 and 80.0% nucleotide identity with the RNA1 and RNA2 of cytoplasmic Citrus leprosis virus -2 (CiLV-C2), respectively (Roy et al. 2013a). Both CiLV-C and -C2 cileviruses were reported from Colombia, but the most prevalent one is CiLV-C2 (Roy et al. 2013a). The 92% amino acid identity between the full genome of these two viruses suggests that HiCV could be a strain of CiLV-C2, but it is not clear if HiCV is capable of infecting and causing symptoms in citrus (Melzer et al. 2013). Recently, we reported natural infection of hibiscus by CiLV-C2 in Colombia that produced green ring lesions with internal chlorotic spots in a senescing H. rosa-sinensis leaf (Roy et al. 2015). In August 2016, green ringspot symptoms in senescing H. rosa-sinensis leaves were observed in Tampa, FL (27.9420° N; 82.4556° W). Symptomatic and asymptomatic leaves were collected from five H. rosa-sinensis plants. Total RNA was isolated using the RNeasy Plant Mini Kit (Qiagen, Valencia, CA) and tested by reverse-transcription (RT) PCR using CiLV-C, -C2 (Roy et al. 2013a), and Hibiscus green spot virus (HGSV)-2 (Melzer et al. 2012) primers. In addition, a generic cilevirus forward primer (R1CiLV-C2-GF5: 5′TTGAAGTTYAAGTTGCAGGTTCAACG3′) and HiCV-specific reverse primer (R1CiLV-C2H-R5: 5′GGATGTTTACTCTCCCTGCTCTTC TG3′) were designed and utilized by the RT-PCR assay. Primers specific for CiLV-C, CiLV-C2, and HGSV-2 failed to produce any amplicons from symptomatic hibiscus samples. The HiCV genome-specific RT-PCR assays yielded a 1,447 nt amplicon of partial RNA dependent RNA polymerase and complete coat protein genes. For further verification, the amplicon was cloned and sequenced. BLAST analysis of the amplicon sequence showed nucleotide identity of 95% and a close phylogenetic relationship with the HiCV isolate from Hawaii (accession KC626783), confirming the identity of the virus as HiCV. The amplicon sequence of the new cilevirus from Tampa has been deposited in GenBank (accession MG021325). A small RNA library was constructed for Illumina next generation sequencing assay using RNA from the RT-PCR-positive tissue. Potential virus reads (21 to 24 nt) were identified following a subtractive approach (Roy et al. 2013b) to confirm the presence of HiCV genome sequences in the symptomatic hibiscus leaves. The sRNA library sequences provided the coverage of 55% RNA1 and 65% RNA2 of the HiCV bipartite genome. The BLASTn results of several contigs showed 92 to 98% nucleotide identity with the HiCV Hawaiian isolate. No other virus sequences were detected. To our knowledge, this is the first report of HiCV in Florida and the mainland United States. There is no evidence of HiCV infection on citrus and the CiLV-C2 infection in hibiscus in Hawaii. B. yothersi, the known vector of the cilevirus CiLV-C and CiLV-C2, is also present in Florida. This suggests HiCV has the potential to spread throughout the state. Further studies are necessary to determine the incidence and distribution of HiCV in Florida and other citrus-growing regions as well as its potential effects on citrus.References:Melzer, M. J., et al. 2012. Phytopathology 102:122. https://doi.org/10.1094/PHYTO-01-11-0013 Link, ISI, Google ScholarMelzer, M. J., et al. 2013. Arch. Virol. 158:2421. https://doi.org/10.1007/s00705-013-1745-0 Crossref, ISI, Google ScholarRoy, A., et al. 2013a. Phytopathology 103:488. https://doi.org/10.1094/PHYTO-07-12-0177-R Link, ISI, Google ScholarRoy, A., et al. 2013b. J. Data Mining Genomics Proteomics 4:2. https://doi.org/10.4172/2153-0602.1000129 Google ScholarRoy, A., et al. 2015. Phytopathology 105:1013. https://doi.org/10.1094/PHYTO-12-14-0375-FI Link, ISI, Google ScholarDetailsFiguresLiterature CitedRelated Vol. 102, No. 6 June 2018SubscribeISSN:0191-2917e-ISSN:1943-7692 Metrics Article History Issue Date: 25 May 2018Published: 2 Apr 2018First Look: 20 Dec 2017Accepted: 15 Dec 2017 Page: 1181 Information© 2018 The American Phytopathological SocietyFundingCitrus Research BoardGrant/Award Number: 5300-172Cited byHigh-throughput sequencing application in the detection and discovery of viruses associated with the regulated citrus leprosis disease complex24 January 2023 | Frontiers in Plant Science, Vol. 13Citrus leprosis virus C (leprosis of citrus)CABI Compendium, Vol. CABI CompendiumIs There a “Biological Desert” With the Discovery of New Plant Viruses? A Retrospective Analysis for New Fruit Tree Viruses19 November 2020 | Frontiers in Microbiology, Vol. 11Reassortment of Genome Segments Creates Stable Lineages Among Strains of Orchid Fleck Virus Infecting Citrus in MexicoAvijit Roy, Andrew L. Stone, Gabriel Otero-Colina, Gang Wei, Ronald H. Brlansky, Ronald Ochoa, Gary Bauchan, William L. Schneider, Mark K. Nakhla, and John S. Hartung29 November 2019 | Phytopathology®, Vol. 110, No. 1First Report of Hibiscus-infecting cilevirus in Citrus sinensis in Meta and Casanare, ColombiaAvijit Roy, A. L. Stone, G. León Martínez, J. S. Hartung, G. Wei, V. A. Mavrodieva, M. K. Nakhla, W. L. Schneider, and R. H. Brlansky15 June 2018 | Plant Disease, Vol. 102, No. 8" @default.
• W2780496211 created "2018-01-05" @default.
• W2780496211 creator A5013575537 @default.
• W2780496211 creator A5024215618 @default.
• W2780496211 creator A5039646672 @default.
• W2780496211 creator A5047592109 @default.
• W2780496211 creator A5061333076 @default.
• W2780496211 creator A5066896606 @default.
• W2780496211 creator A5072397925 @default.
• W2780496211 creator A5090732702 @default.
• W2780496211 date "2018-06-01" @default.
• W2780496211 modified "2023-10-18" @default.
• W2780496211 title "First Report of a Cilevirus Associated with Green Ringspot on Senescent Hibiscus Leaves in Tampa, Florida" @default.
• W2780496211 cites W2004841248 @default.
• W2780496211 cites W2042360511 @default.
• W2780496211 cites W2155214109 @default.
• W2780496211 cites W2159817007 @default.
• W2780496211 doi "https://doi.org/10.1094/pdis-11-17-1699-pdn" @default.
• W2780496211 hasPublicationYear "2018" @default.
• W2780496211 type Work @default.
• W2780496211 sameAs 2780496211 @default.
• W2780496211 citedByCount "6" @default.
• W2780496211 countsByYear W27804962112018 @default.
• W2780496211 countsByYear W27804962112020 @default.
• W2780496211 countsByYear W27804962112022 @default.
• W2780496211 countsByYear W27804962112023 @default.
• W2780496211 crossrefType "journal-article" @default.
• W2780496211 hasAuthorship W2780496211A5013575537 @default.
• W2780496211 hasAuthorship W2780496211A5024215618 @default.
• W2780496211 hasAuthorship W2780496211A5039646672 @default.
• W2780496211 hasAuthorship W2780496211A5047592109 @default.
• W2780496211 hasAuthorship W2780496211A5061333076 @default.
• W2780496211 hasAuthorship W2780496211A5066896606 @default.
• W2780496211 hasAuthorship W2780496211A5072397925 @default.
• W2780496211 hasAuthorship W2780496211A5090732702 @default.
• W2780496211 hasBestOaLocation W27804962111 @default.
• W2780496211 hasConcept C2778179962 @default.
• W2780496211 hasConcept C2780659118 @default.
• W2780496211 hasConcept C59822182 @default.
• W2780496211 hasConcept C86803240 @default.
• W2780496211 hasConceptScore W2780496211C2778179962 @default.
• W2780496211 hasConceptScore W2780496211C2780659118 @default.
• W2780496211 hasConceptScore W2780496211C59822182 @default.
• W2780496211 hasConceptScore W2780496211C86803240 @default.
• W2780496211 hasFunder F4320310621 @default.
• W2780496211 hasIssue "6" @default.
• W2780496211 hasLocation W27804962111 @default.
• W2780496211 hasOpenAccess W2780496211 @default.
• W2780496211 hasPrimaryLocation W27804962111 @default.
• W2780496211 hasRelatedWork W1990641667 @default.
• W2780496211 hasRelatedWork W1994771190 @default.
• W2780496211 hasRelatedWork W2059092732 @default.
• W2780496211 hasRelatedWork W2071264200 @default.
• W2780496211 hasRelatedWork W2078297052 @default.
• W2780496211 hasRelatedWork W2224677679 @default.
• W2780496211 hasRelatedWork W2271324704 @default.
• W2780496211 hasRelatedWork W3110545604 @default.
• W2780496211 hasRelatedWork W4328002198 @default.
• W2780496211 hasRelatedWork W166384771 @default.
• W2780496211 hasVolume "102" @default.
• W2780496211 isParatext "false" @default.
• W2780496211 isRetracted "false" @default.
• W2780496211 magId "2780496211" @default.
• W2780496211 workType "article" @default.