FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2784299079> ?p ?o ?g. }

• W2784299079 endingPage "22883" @default.
• W2784299079 startingPage "22875" @default.
• W2784299079 abstract "Methionine adenosyltransferase is a ubiquitous enzyme that catalyzes the only known route of biosynthesis of S-adenosylmethionine, the major methyl group donor in cell metabolism. In mammals, two different methionine adenosyltransferases exist: one is confined to the liver, and the other one is distributed in extrahepatic tissues. In the present study, we report the cloning of the 5′-flanking region of liver-specific methionine adenosyltransferase gene from rat. Two closely spaced sites for transcriptional initiation were identified by primer extension analysis. The major transcription start site was determined to be 29 nucleotides downstream from the putative TATA box. Transient transfection assays of constructs containing sequentially deleted 5′-flanking sequences fused to the luciferase gene showed that rat hepatic methionine adenosyltransferase promoter was able to efficiently drive reporter expression not only in liver-type cells (rat hepatoma H35 cells and human hepatoblastoma HepG2 cells) but also in Chinese hamster ovary cells. Two regions spanning nucleotides −1251 to −958 and −197 to +65 were found to be crucial for the promoter efficiency. The distal upstream region contains elements that positively regulate promoter activity in H35 and HepG2 cells but are ineffective in Chinese hamster ovary cells. Eight protein binding sites were characterized in both regions by DNase I footprinting analysis. Two of these elements, sites A and B, located in the distal region, were found to be essential for the regulation of promoter activity. Electrophoretic mobility shift assays and competition experiments showed that site A is recognized by an NF1 protein. Site B was able to interact with a member of HNF-3 family when nuclear extracts from rat liver and H35 cells were used in the in vitro assay, but an additional binding activity to an NHF1-like protein was obtained with the hepatoma cell extracts. It is suggested that this differential binding can contribute to the cell specificity of promoter function. Methionine adenosyltransferase is a ubiquitous enzyme that catalyzes the only known route of biosynthesis of S-adenosylmethionine, the major methyl group donor in cell metabolism. In mammals, two different methionine adenosyltransferases exist: one is confined to the liver, and the other one is distributed in extrahepatic tissues. In the present study, we report the cloning of the 5′-flanking region of liver-specific methionine adenosyltransferase gene from rat. Two closely spaced sites for transcriptional initiation were identified by primer extension analysis. The major transcription start site was determined to be 29 nucleotides downstream from the putative TATA box. Transient transfection assays of constructs containing sequentially deleted 5′-flanking sequences fused to the luciferase gene showed that rat hepatic methionine adenosyltransferase promoter was able to efficiently drive reporter expression not only in liver-type cells (rat hepatoma H35 cells and human hepatoblastoma HepG2 cells) but also in Chinese hamster ovary cells. Two regions spanning nucleotides −1251 to −958 and −197 to +65 were found to be crucial for the promoter efficiency. The distal upstream region contains elements that positively regulate promoter activity in H35 and HepG2 cells but are ineffective in Chinese hamster ovary cells. Eight protein binding sites were characterized in both regions by DNase I footprinting analysis. Two of these elements, sites A and B, located in the distal region, were found to be essential for the regulation of promoter activity. Electrophoretic mobility shift assays and competition experiments showed that site A is recognized by an NF1 protein. Site B was able to interact with a member of HNF-3 family when nuclear extracts from rat liver and H35 cells were used in the in vitro assay, but an additional binding activity to an NHF1-like protein was obtained with the hepatoma cell extracts. It is suggested that this differential binding can contribute to the cell specificity of promoter function. S-Adenosylmethionine plays a central role in cellular metabolism, being the major methyl group donor in transmethylation reactions and the source of propylamine moieties for polyamine biosynthesis (1Cantoni G.L. Annu. Rev. Biochem. 1975; 44: 435-451Crossref PubMed Scopus (414) Google Scholar, 2Tabor C.W. Tabor H. Adv. Enzymol. 1984; 56: 251-282PubMed Google Scholar). S-Adenosylmethionine is synthesized by transfer of the adenosyl moiety from ATP to the sulfur atom of methionine, in a reaction catalyzed by the enzyme methionine adenosyltransferase (MAT 1The abbreviations used are: MAT, ATP:l-methionine S-adenosyltransferase; bp, base pair(s); PCR, polymerase chain reaction; RSV, Rous sarcoma virus; HNF, hepatocyte nuclear factor; CHO, Chinese hamster ovary; kb, kilobase pairs.; ATP:l-methionine S-adenosyltransferase, EC2.5.1.6) (3Cantoni G.L. J. Biol. Chem. 1953; 204: 403-416Abstract Full Text PDF PubMed Google Scholar). The occurrence of MAT has been extensively studied in a variety of organisms, where different isoenzyme forms have been characterized (2Tabor C.W. Tabor H. Adv. Enzymol. 1984; 56: 251-282PubMed Google Scholar). In mammals, biochemical and molecular cloning studies have revealed the existence of at least two MAT (for a consensus nomenclature for mammalian methionine adenosyltransferase genes and gene products, see Ref. 4Kotb M. Mudd H. Mato J.M. Geller A.M. Kredich N.M. Chou J.Y. Cantoni G.L. Trends Genet. 1997; 13: 51-52Abstract Full Text PDF PubMed Scopus (186) Google Scholar). One is selectively expressed in the liver and the other one is distributed in non-hepatic tissues (reviewed in Ref. 5Mato J.M. Alvarez L. Corrales F. Pajares M.A. Arias I.M. Boyer J.L. Fausto N. Jakoby W.B. Schachter D.A. Shafritz D.A. The Liver: Biology and Pathobiology. 3rd Ed. Raven Press, Ltd., New York1994: 461-470Google Scholar). The presence of a liver-specific isoenzyme is related to the main role of this organ in methionine metabolism. Thus, most of the methionine taken up from the diet is metabolized in the liver, and up to 85% of all transmethylation reactions occur in the liver (5Mato J.M. Alvarez L. Corrales F. Pajares M.A. Arias I.M. Boyer J.L. Fausto N. Jakoby W.B. Schachter D.A. Shafritz D.A. The Liver: Biology and Pathobiology. 3rd Ed. Raven Press, Ltd., New York1994: 461-470Google Scholar). Hepatic MAT is a cytosolic homo-oligomeric protein, found as a mixture of tetramers and dimers (6Cabrero C. Puerta J. Alemany S. Eur. J. Biochem. 1987; 170: 299-304Crossref PubMed Scopus (109) Google Scholar, 7Alvarez L. Mingorance J. Pajares M.A. Mato J.M. Biochem. J. 1994; 301: 557-561Crossref PubMed Scopus (37) Google Scholar). Its expression correlates well with liver growth and differentiation, having been proposed to be a marker of the differentiated state of the hepatocyte (8Gil B. Casado M. Pajares M.A. Boscá L. Mato J.M. Martı́n-Sanz P. Alvarez L. Hepatology. 1996; 24: 876-881PubMed Google Scholar). There is growing evidence suggesting that this enzyme can be regulated at different levels by a variety of factors and under several pathological conditions. For instance, a serious decrease in the enzyme activity, without a concomitant reduction in the expression of the gene, has been found in several human hepatic disorders (9Cabrero C. Martı́n-Duce A. Ortiz P. Alemany S. Mato J.M. Hepatology. 1988; 8: 1530-1534Crossref PubMed Scopus (156) Google Scholar, 10Alvarez L. Corrales F. Martı́n-Duce A. Mato J.M. Biochem. J. 1993; 293: 481-486Crossref PubMed Scopus (70) Google Scholar), as well as in different experimental models of liver injury (11Corrales F. Giménez A. Alvarez L. Caballerı́a J. Pajares M.A. Andreu H. Parés A. Mato J.M. Rodés J. Hepatology. 1992; 16: 1022-1027Crossref PubMed Scopus (159) Google Scholar, 12Avila M.A. Mingorance J. Martı́nez-Chantar M.L. Casado M. Martı́n-Sanz P. Boscá L. Mato J.M. Hepatology. 1997; 25: 391-396PubMed Google Scholar). In contrast, a marked reduction of MAT gene expression has been reported in human hepatocarcinoma (13Cai J.X. Sun W.M. Hwuang J.J. Stain S.C. Lu S.C. Hepatology. 1996; 24: 1090-1097Crossref PubMed Google Scholar) and in a rat model of hypoxia-induced liver injury (14Chawla R.K. Jones D.P. Biochim. Biophys. Acta. 1994; 1199: 45-51Crossref PubMed Scopus (27) Google Scholar). On the other hand, glucocorticoids (15Gil B. Pajares M.A. Mato J.M. Alvarez L. Endocrinology. 1997; 138: 1251-1258Crossref PubMed Scopus (49) Google Scholar) and cAMP (8Gil B. Casado M. Pajares M.A. Boscá L. Mato J.M. Martı́n-Sanz P. Alvarez L. Hepatology. 1996; 24: 876-881PubMed Google Scholar) increase the expression of the gene in rats, whereas insulin blocks the inducing effect of glucocorticoids (8Gil B. Casado M. Pajares M.A. Boscá L. Mato J.M. Martı́n-Sanz P. Alvarez L. Hepatology. 1996; 24: 876-881PubMed Google Scholar). Altogether, these results suggest that hepatic MAT gene expression is regulated differently under various normal and pathophysiological conditions. The necessity of a strict regulation of the expression of this enzyme has been recently emphasized by the fact that a sustained enhancement in its synthesis is accompanied by a depletion of cellular ATP and NAD, and a greater sensitivity to oxidative cell injury (16Sánchez-Góngora E. Pastorino J. Alvarez L. Pajares M.A. Garcı́a C. Viña J.R. Mato J.M. Farber J. Biochem. J. 1996; 319: 767-773Crossref PubMed Scopus (32) Google Scholar). To study molecular mechanisms underlying the regulation of hepatic MAT expression, we have isolated and characterized the 5′-flanking region of the rat MAT gene. The regulatory elements necessary for basal expression have been identified using transient transfections into various cell lines with hepatic MAT promoter-luciferase chimeric genes as well as by in vitro DNase I footprinting analysis. Thesecis-acting elements are clustered in a promoter proximal region and in a distal region. We finally show that transcriptional activity of hepatic MAT promoter is predominantly dependent on the binding of an NF1-like protein and liver-enriched transcription factors to the promoter distal region. Standard procedures were used for screening the recombinant genomic library, restriction enzyme mapping, subcloning, DNA labeling, isolation of genomic DNA, Southern transfer, and hybridization to DNA on filters (17Sambrook J. Fritsch E.F. Maniatis T. Nolan C. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar, 18). Oligonucleotide primers were synthesized on an Applied Biosystems 391 DNA synthesizer using the phosphoramidite method. A rat genomic DNA library in EMBL-3 SP6/T7 (CLONTECH) was screened using as a probe a 32P-labeled 580-bpEcoRI/XbaI fragment of the pSSRL cDNA clone (19Alvarez L. Asunción M. Corrales F. Pajares M.A. Mato J.M. FEBS Lett. 1991; 290: 142-146Crossref PubMed Scopus (45) Google Scholar), which contains 211 bp of the 5′-untranslated sequence and the first 369 bp of the rat liver MAT coding region. Five overlapping clones ranging in size between 13 and 18 kb kilobase pairs were isolated from ∼1 × 106 recombinants. Clones were plaque-purified and subjected to Southern analysis. Fragments of interest were subcloned into the plasmid pUC18. DNA was sequenced on both strands by the dideoxy termination method (20Sanger F. Nicklen S. Coulson A.R. Proc. Natl. Acad. Sci. U. S. A. 1977; 74: 5463-5467Crossref PubMed Scopus (52770) Google Scholar), using Sequenase (U. S. Biochemical Corp.) and either pUC/M13 forward and reverse primers or sequence-specific oligonucleotide primers. Poly(A)+ RNA used for primer extension studies was prepared from rat liver by oligo(dT)-cellulose chromatography (21Aviv H. Leder P. Proc. Natl. Acad. Sci. U. S. A. 1972; 69: 1408-1412Crossref PubMed Scopus (5183) Google Scholar). A 24-base oligonucleotide primer complementary to nucleotides −186/−163 of the rat liver MAT cDNA (19Alvarez L. Asunción M. Corrales F. Pajares M.A. Mato J.M. FEBS Lett. 1991; 290: 142-146Crossref PubMed Scopus (45) Google Scholar) was end-labeled with [γ-32P]ATP using T4 polynucleotide kinase. Three μg of rat liver poly(A)+ RNA (or yeast tRNA as negative control) were annealed to 106 cpm of the primer and extended with 200 units of Moloney murine leukemia virus reverse transcriptase (Superscript II, Life Technologies, Inc.) as described previously (19Alvarez L. Asunción M. Corrales F. Pajares M.A. Mato J.M. FEBS Lett. 1991; 290: 142-146Crossref PubMed Scopus (45) Google Scholar). The primer-extended products were analyzed on 7 m urea, 6% polyacrylamide gels, in parallel with sequencing reactions carried out on the genomic subclone using the same primer. Eleven deletion constructs of different length were generated by PCR, using a MAT genomic clone as template. Initially, a DNA fragment spanning 1470 bp of the 5′-flanking region was amplified using 3′ and 5′ primers corresponding to nucleotides +49 to +65 and −1405 to −1389, respectively. The purified PCR product was inserted into theSmaI site of pUC18 plasmid. Ten deletions were then constructed by inverse PCR (22Ochman H. Medhora M.M. Garza D. Hartl D.L. Innis M.A. Gelfand D.H. Sninsky J.J. White T.J. PCR Protocols. Academic Press, San Diego1990: 219-227Google Scholar), using a vector-specific 5′ primer and 3′ primers complementary to nucleotides −1251 to −1235, −1154 to −1133, −1134 to −1118, −1080 to −1064, −958 to −942, −727 to −711, −527 to −511, −375 to −359, −193 to −177, and −87 to −71 of the cloned sequence. PCR reactions were performed as described previously (7Alvarez L. Mingorance J. Pajares M.A. Mato J.M. Biochem. J. 1994; 301: 557-561Crossref PubMed Scopus (37) Google Scholar) but using the thermostable DNA polymerase Dynazyme (Finnzymes Oy, Finland). The inserts of these 11 constructs were digested with KpnI and SalI and subcloned into the corresponding sites of the luciferase promoterless vector pXP1 (23Nordeen S.K. BioTechniques. 1988; 6: 454-458PubMed Google Scholar). The identity of the constructs was confirmed by sequencing. The relative transcriptional activities of MAT promoter fragments were determined by transient transfection analysis in cultured H35, HepG2, and CHO cells. Typically, cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum and plated at approximately 3 × 105 cells/60-mm culture dish 24 h before transfections. The cells were transfected by the calcium phosphate precipitation method (18) with 6 μg (CHO) or 15 μg (H35, HepG2) of each DNA construct. Five μg of the β-galactosidase expression vector pCH110 (Pharmacia Biotech) were included as an internal standard of transfection efficiency. After 18 h, the DNA precipitates were rinsed twice with phosphate-buffered saline, and cells were further grown for 24 h in culture medium. The cells were harvested in reporter lysis buffer (Promega), following the manufacturer's instructions, and the lysate was spun in a microcentrifuge for 15 s. Luciferase and β-galactosidase activities were determined as described (17Sambrook J. Fritsch E.F. Maniatis T. Nolan C. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar, 18). All transfections were conducted in triplicate using at least two different batches of each construct. Activities reported are averaged from three independent experiments. Nuclear extracts from rat tissues or rat hepatoma H35 cells were prepared as described by Gorskiet al. (24Gorski K. Carneiro M. Schliber U. Cell. 1986; 47: 767-776Abstract Full Text PDF PubMed Scopus (973) Google Scholar) and Andrews and Faller (25Andrews N.C. Faller D.V. Nucleic Acids Res. 1991; 19: 2499Crossref PubMed Scopus (2214) Google Scholar), respectively. The final nuclear suspension buffer contained 20 mm HEPES, pH 7.9, 0.4 m KCl, 0.2 mm EDTA, 1.5 mmMgCl2, 1 mm dithiothreitol, 0.2 mmphenylmethylsulfonyl fluoride, 0.5 μg/ml leupeptin, 10 μg/ml soybean trypsin inhibitor, and 25% glycerol. Nuclear extracts were aliquoted and frozen at −70 °C. Protein concentrations were determined by the Bradford protein assay kit (Bio-Rad). Two32P-end-labeled fragments of the 5′-flanking region of rat liver MAT gene were generated by PCR amplification of the template GSR4. The primers for these two fragments were +49 to +65, −193 to −177, −1012 to −996, and −1251 to −1235. One primer from each pair was 5′-end-labeled with [γ-32P]ATP using T4polynucleotide kinase. PCR reactions were performed as described (7Alvarez L. Mingorance J. Pajares M.A. Mato J.M. Biochem. J. 1994; 301: 557-561Crossref PubMed Scopus (37) Google Scholar). Amplified fragments were purified using Sephacryl S-300 columns (Pharmacia). Approximately 5 × 104 cpm of end-labeled DNA fragments were incubated with 10–50 μg of nuclear proteins from rat liver. After 30 min incubation at room temperature, CaCl2 and MgCl2 were added to give a final concentration of 0.5 and 1 mm, respectively. DNase I digestions were performed at room temperature for 1 min, using different amounts of enzyme. The reactions were stopped by the addition of 140 μl of stop solution containing 2 μg of yeast tRNA, 20 mm EDTA, 150 mm sodium acetate, and 1.5 μg of proteinase K. Upon phenol extraction and ethanol precipitation, pellets were resuspended in sample dye buffer, and DNA fragments were resolved by electrophoresis in a denaturing 8% acrylamide/urea sequencing gel. The positions of specific DNase I-protected regions were determined by sequencing the fragments according to Maxam-Gilbert (26Maxam A.M. Gilbert W. Proc. Natl. Acad. Sci. U. S. A. 1977; 74: 560-564Crossref PubMed Scopus (5478) Google Scholar). Electrophoretic mobility shift assays were performed in a 20-μl binding reaction containing 5 μg of crude nuclear extract, 40 mm HEPES, pH 7.5, 40 mm KCl, 0.2 mm EDTA, 5 mmMgCl2, 1.25% Ficoll, 1 μg poly(dI-dC)·poly(dI-dC), 1 μg of sonicated herring sperm DNA, and, when indicated, a 50-fold molar excess of competitor oligonucleotide. The reaction mixtures were incubated on ice for 10 min, and then 6 × 104 cpm of annealed oligonucleotides were added, and incubation was continued for an additional 30 min. The DNA-protein complexes were resolved in a 6% acrylamide gel in 0.5 × TBE (1 × TBE: 89 mmTris, pH 8.0, 89 mm boric acid, 2 mm EDTA). Double-stranded oligonucleotides used as probes or competitors were composed of the following sequences (top strand shown): MAT promoter FPA site, CACTAGAATTTGTGCCAGAAAAAAAAAAAGTA; FPB site, TGAACGTATTGATTAACTCACC; a mutant sequence (lowercase) of FPB site, oligonucleotide MtFPB, TGAACGcgTaGccTAACTCA; the HNF-1 binding site from the rat albumin promoter, TGTGGTTAATGATCTACAGT (27Cereghini S. Blumenfeld M. Yaniv M. Genes Dev. 1988; 2: 957-974Crossref PubMed Scopus (226) Google Scholar); the HNF-3 binding site from the transthyretin (TTR) promoter, GTTGACTAAGTCAATAATCAGAATCAG (28Costa R.H. Grayson D.R. Darnell Jr., J.E. Mol. Cell. Biol. 1989; 9: 1415-1425Crossref PubMed Scopus (428) Google Scholar); a C/EBP binding site, GGTATGATTTTGTAATGGGGTA (29Friedman A.D. Landschulz W.H. McKnight S.L. Genes Dev. 1989; 3: 1314-1322Crossref PubMed Scopus (363) Google Scholar); a consensus NF-1 binding sequence, GCTTTGGCATGCTGCCAATATG (30Jones K.A. Kadonaga J.T. Rosenfeld P.J. Kelly T.J. Tjian R. Cell. 1987; 48: 79-89Abstract Full Text PDF PubMed Scopus (574) Google Scholar); a consensus AP1 recognition site, ATTCTAGACTGAGTCATGGTACCGA (31Angel P. Baumann I. Stein B. Delius H. Rahmsdorf H.J. Herrlich P. Mol. Cell. Biol. 1987; 7: 2256-2266Crossref PubMed Scopus (585) Google Scholar). A rat genomic DNA library in EMBL-3 sp6/T7 was screened with a 580-bp EcoRI/XbaI fragment of the rat liver MAT cDNA clone pSSRL, which comprises 211 bp of the 5′-untranslated sequence and the first 369 bp of the coding region (19Alvarez L. Asunción M. Corrales F. Pajares M.A. Mato J.M. FEBS Lett. 1991; 290: 142-146Crossref PubMed Scopus (45) Google Scholar). Five overlapping clones containing inserts ranging in size between 13 and 18 kb were isolated from approximately 1 × 106recombinants. Restriction mapping and Southern analysis showed that all of them contained different lengths of the 5′-flanking region. A genomic clone of about 16 kb, designated GRS4, containing approximately 6 kb of the 5′-flanking region of the MAT gene was chosen for detailed analysis. To verify that no gross rearrangements had occurred during the cloning process, Southern blots prepared with rat genomic DNA digested with selected restriction endonucleases were hybridized with the same probe used for screening the genomic library. The sizes of the hybridizable fragments were identical to those obtained when Southern analysis of the genomic clone GRS4 was performed under the same conditions (Fig. 1). These results indicate that the cloned DNA segment retains the same sequence organization as in the genomic DNA and suggest that hepatic MAT gene is present as a single copy in the rat genome. To determine the start site of transcription, a primer extension assay was performed using poly(A)+ RNA from rat liver, as described under “Experimental Procedures.” As shown in Fig.2, a major product corresponding to a 89-base extended fragment was detected as well as a minor product two nucleotides longer. These products were not detected when the assay was carried out using tRNA. Sequencing reactions performed on the genomic clone GRS4 using the same primer localized the major start site 251 nucleotides from the ATG translation initiation codon and 41 nucleotides upstream of the 5′-end of the partial cDNA sequence previously published (19Alvarez L. Asunción M. Corrales F. Pajares M.A. Mato J.M. FEBS Lett. 1991; 290: 142-146Crossref PubMed Scopus (45) Google Scholar). This base was designated as +1 for numbering the nucleotides in the gene. The nucleotide sequence of rat hepatic MAT promoter region extending to 1557 bp upstream of the transcription initiation site is shown in Fig.3. The exon sequence corresponding to the first 41 nucleotides of the MAT mRNA, not present in the reported cDNA sequence (19Alvarez L. Asunción M. Corrales F. Pajares M.A. Mato J.M. FEBS Lett. 1991; 290: 142-146Crossref PubMed Scopus (45) Google Scholar), is also included. The 5′-flanking region shares 88% sequence identity with the 1113-bp promoter region reported for the mouse MAT gene (32Sakata S.F. Shelly L.L. Ruppert S. Schutz G. Chou J.Y. J. Biol. Chem. 1993; 268: 13978-13986Abstract Full Text PDF PubMed Google Scholar). Sequence analysis revealed a putative TATA box located at positions −29 to −23, which is in agreement with the preferred position occupied by this element in a typical eukaryotic promoter (33Bucher P. J. Mol. Biol. 1990; 212: 563-578Crossref PubMed Scopus (980) Google Scholar). The canonical CAAT box, usually present around −80 bp, was not found in this area, but two perfect CAAT motifs were located far away (positions −379 and −1514). A number of DNA consensus sequences reported to bind specific trans-acting factors were also present. Thus, two AP-1 binding sites (34Angel P. Imagawa M. Chiu R. Stein B. Imbra R.J. Rahmsdorf H.J. Jonat C. Herrlich P. Karin M. Cell. 1987; 49: 729-739Abstract Full Text PDF PubMed Scopus (2156) Google Scholar, 35Lee W. Mitchell P. Tjian R. Cell. 1987; 49: 741-752Abstract Full Text PDF PubMed Scopus (1365) Google Scholar) were found at positions −1057 to −1051 and −294 to −288. Two copies of the PEA3 motif (5′-AGGAAG-3′) (36Martin M.E. Piette J. Yaniv M. Tang W.J. Folk W.R. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 5839-5843Crossref PubMed Scopus (151) Google Scholar), an oncogene-, growth factor-, and phorbol ester-responsive element, were located at −772 to −767 and −217 to −212. The consensus recognition motif for the glucocorticoid response element (TGT(C/T)CT) (37Beato M. Cell. 1989; 56: 335-344Abstract Full Text PDF PubMed Scopus (2852) Google Scholar) was represented 4 times at positions −701 to −696, −636 to −631, −442 to −437, and −66 to −61. Two interleukin-6 response elements (38Hattori M. Abraham L.J. Northemann W. Fey G.H. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 2364-2368Crossref PubMed Scopus (143) Google Scholar), which act as positive elements in several acute phase protein genes, were identified at −1301 to −1296, in reverse complement form, and at −317 to −312. Two NF-1 binding motifs (5′-TGGN7CCA-3′) (39de Vries E. van Driel W. van den Heuvel S.J.L. van der Vliet P.C. EMBO J. 1987; 6: 161-168Crossref PubMed Scopus (106) Google Scholar) were found at −1218 to −1206 and −630 to −618, the latter overlapping with a glucocorticoid response element. Finally, the analysis also revealed several DNA elements that matched the consensus binding sequences for liver-enriched transcription factors, such as HNF-1 (27Cereghini S. Blumenfeld M. Yaniv M. Genes Dev. 1988; 2: 957-974Crossref PubMed Scopus (226) Google Scholar) (at −1144 to −1138), HNF-3 (40Lai E. Prezioso V.R. Smith E. Litvin O. Costa R.H. Darnell Jr., J.E. Genes Dev. 1990; 4: 1427-1436Crossref PubMed Scopus (407) Google Scholar) (at −1128 to 1122 and −581 to −575), and HNF-4 (41Sladek F.M. Zhong W. Lai E. Darnell Jr., J.E. Genes Dev. 1990; 4: 2353-2365Crossref PubMed Scopus (861) Google Scholar) (at −159 to −154 and −79 to −73). To delineate the sequences that drive MAT expression, a series of deletion mutants extending from −1405 to +65 bp was generated by PCR and cloned into the promoterless luciferase expression vector pXP1 (Fig. 4 A). A similar plasmid containing the RSV promoter was used as a positive control for transfection. These chimeric constructs were transiently transfected into two cell types of liver origin, the rat hepatoma H35 cell line and the human hepatoblastoma HepG2 cell line, as well as into CHO cells. In all transfection experiments, a vector expressing β-galactosidase was included as internal control. Transient expression of luciferase activity showed that the MAT-luciferase vectors were expressed in the three cell types. The pattern of transcriptional activity of the chimeric constructs was very similar in H35 and HepG2 cells (Fig. 4 B). Only background expression was observed following transfection with the pXP1 luciferase vector without any promoter fragment. The highest luciferase activity, almost 14 and 20% of RSV-luciferase activity in H35 and HepG2, respectively, was observed with the −1405/+65 construct. Removal of the fragment −1405 to −1251 had little effect on the promoter efficiency. However, successive 5′ deletions from −1251 to −87 bp resulted in a marked decrease in luciferase activity, indicating the presence of a positive-acting region between −1251 and −958, that increases transcriptional activity about 3-fold. Deletions of sequences from −958 to −727, −727 to −527, −527 to −375, and −375 to −193 did not significantly affect luciferase activity, suggesting that no relevant additional elements involved in basal transcription are contained in this area. Further deletion from −193 to −87 promoted a 2-fold decrease, suggesting the presence of positive regulatory element(s) in this area. The resulting construct (−87/+65), which contains the minimal promoter elements including the TATA box, produced 10 and 18% maximal activity in H35 and HepG2 cells, respectively. The profile of luciferase expression in CHO cells was quite different from that obtained in the liver-type cells (Fig. 4 C). The constructs −1405/+65, −1251/+65, and −958/+65 yielded a similar luciferase activity. Therefore, as judged by the results obtained in the hepatic cells, the region comprised between −1251 and −958 might contain tissue-specific regulatory elements that do not account for the promoter activity in CHO cells. On the other hand, and in contrast with the pattern observed in H35 and HepG2 cells, sequences from −958 to −727 and −375 to −195 seem to contain elements that positively regulate transcription in CHO cells. From the results of deletion analysis, it can be concluded that the essential elements governing MAT expression in hepatic cells lie between nucleotides −1251 to −958 and −193 to +65. To identify these potential cis-acting elements, DNase I footprinting analysis was performed using both DNA fragments and nuclear proteins isolated from rat liver. As shown in Fig.5 A, five DNase I-protected areas, designated I to V, were generated on both strands within the promoter proximal region (−193 to +65) at increasing amounts of protein. The nucleotide sequences of these footprints are depicted in Fig. 6. Footprint I is a large protected area that covers putative TATA box elements. The second protected region extends from −46 to −70 and includes a significant homology to an AP1 recognition site. Footprint III shows no sequence similarity to any of the known protein-binding sites, as revealed by a search in transcription factor site data bases (42Ghosh D. Nucleic Acids Res. 1993; 21: 3117-3118Crossref PubMed Scopus (119) Google Scholar, 43Quandt K. Frech C. Karas H. Wingender E. Werner T. Nucleic Acids Res. 1995; 23: 4878-4884Crossref PubMed Scopus (2427) Google Scholar). The region between −150 and −96 (footprints IV and V) adjoins sequences bearing some resemblance to several putative transcription factor binding sites, including cAMP response element, AP1, and AP4. Interestingly, this region also contains two tandem copies of the 5′-GTCGAA-3′ motif, which does not match any consensus recognition site for known transcription factors.Figure 6Nucleotide sequences protected from DNase I digestion. Sequences protected against DNase I digestion by hepatic nuclear proteins are indicated by bars above (coding strand) and below (non-coding strand). A andB represent MAT promoter proximal and distal regions, respectively.View Large I" @default.
• W2784299079 created "2018-01-26" @default.
• W2784299079 creator A5008532501 @default.
• W2784299079 creator A5013151315 @default.
• W2784299079 creator A5014481304 @default.
• W2784299079 creator A5029080692 @default.
• W2784299079 creator A5080765829 @default.
• W2784299079 date "1997-09-01" @default.
• W2784299079 modified "2023-10-17" @default.
• W2784299079 title "Characterization of Rat Liver-specific Methionine Adenosyltransferase Gene Promoter" @default.
• W2784299079 cites W1490329277 @default.
• W2784299079 cites W1493781700 @default.
• W2784299079 cites W1567096247 @default.
• W2784299079 cites W1578409044 @default.
• W2784299079 cites W1604386810 @default.
• W2784299079 cites W1749054014 @default.
• W2784299079 cites W1791101682 @default.
• W2784299079 cites W1937305668 @default.
• W2784299079 cites W1959346655 @default.
• W2784299079 cites W1965258786 @default.
• W2784299079 cites W1965825184 @default.
• W2784299079 cites W1967004332 @default.
• W2784299079 cites W1967503480 @default.
• W2784299079 cites W1969373767 @default.
• W2784299079 cites W1973272888 @default.
• W2784299079 cites W1980854129 @default.
• W2784299079 cites W1992595091 @default.
• W2784299079 cites W1993441033 @default.
• W2784299079 cites W1999966058 @default.
• W2784299079 cites W2003893812 @default.
• W2784299079 cites W2005270847 @default.
• W2784299079 cites W2009347752 @default.
• W2784299079 cites W2037540469 @default.
• W2784299079 cites W2039307052 @default.
• W2784299079 cites W2047203795 @default.
• W2784299079 cites W2050808243 @default.
• W2784299079 cites W2054534199 @default.
• W2784299079 cites W2060903877 @default.
• W2784299079 cites W2064879068 @default.
• W2784299079 cites W2066160869 @default.
• W2784299079 cites W2081135713 @default.
• W2784299079 cites W2089588876 @default.
• W2784299079 cites W2089597112 @default.
• W2784299079 cites W2090467716 @default.
• W2784299079 cites W2094646101 @default.
• W2784299079 cites W2109170983 @default.
• W2784299079 cites W2117969708 @default.
• W2784299079 cites W2128215408 @default.
• W2784299079 cites W2130535740 @default.
• W2784299079 cites W2135374851 @default.
• W2784299079 cites W2138270253 @default.
• W2784299079 cites W2145947403 @default.
• W2784299079 cites W2149623959 @default.
• W2784299079 cites W2167611648 @default.
• W2784299079 cites W2240323633 @default.
• W2784299079 cites W2265338784 @default.
• W2784299079 cites W2320272830 @default.
• W2784299079 cites W295339133 @default.
• W2784299079 doi "https://doi.org/10.1074/jbc.272.36.22875" @default.
• W2784299079 hasPublicationYear "1997" @default.
• W2784299079 type Work @default.
• W2784299079 sameAs 2784299079 @default.
• W2784299079 citedByCount "25" @default.
• W2784299079 countsByYear W27842990792015 @default.
• W2784299079 countsByYear W27842990792017 @default.
• W2784299079 countsByYear W27842990792018 @default.
• W2784299079 crossrefType "journal-article" @default.
• W2784299079 hasAuthorship W2784299079A5008532501 @default.
• W2784299079 hasAuthorship W2784299079A5013151315 @default.
• W2784299079 hasAuthorship W2784299079A5014481304 @default.
• W2784299079 hasAuthorship W2784299079A5029080692 @default.
• W2784299079 hasAuthorship W2784299079A5080765829 @default.
• W2784299079 hasBestOaLocation W27842990791 @default.
• W2784299079 hasConcept C104317684 @default.
• W2784299079 hasConcept C153911025 @default.
• W2784299079 hasConcept C185592680 @default.
• W2784299079 hasConcept C2780912031 @default.
• W2784299079 hasConcept C2909420578 @default.
• W2784299079 hasConcept C515207424 @default.
• W2784299079 hasConcept C55493867 @default.
• W2784299079 hasConcept C86803240 @default.
• W2784299079 hasConceptScore W2784299079C104317684 @default.
• W2784299079 hasConceptScore W2784299079C153911025 @default.
• W2784299079 hasConceptScore W2784299079C185592680 @default.
• W2784299079 hasConceptScore W2784299079C2780912031 @default.
• W2784299079 hasConceptScore W2784299079C2909420578 @default.
• W2784299079 hasConceptScore W2784299079C515207424 @default.
• W2784299079 hasConceptScore W2784299079C55493867 @default.
• W2784299079 hasConceptScore W2784299079C86803240 @default.
• W2784299079 hasIssue "36" @default.
• W2784299079 hasLocation W27842990791 @default.
• W2784299079 hasLocation W27842990792 @default.
• W2784299079 hasOpenAccess W2784299079 @default.
• W2784299079 hasPrimaryLocation W27842990791 @default.
• W2784299079 hasRelatedWork W1972164388 @default.
• W2784299079 hasRelatedWork W2004414266 @default.
• W2784299079 hasRelatedWork W2023084765 @default.
• W2784299079 hasRelatedWork W2132216778 @default.

• next