FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2799506802> ?p ?o ?g. }

• W2799506802 endingPage "2557.e5" @default.
• W2799506802 startingPage "2554" @default.
• W2799506802 abstract "Flaky tail mice (FTM) with mutations in the Flg and Tmem79 genes are known to spontaneously develop atopic dermatitis (AD)-like dermatitis with age. We have already reported that the spontaneous development of dermatitis exhibits site specificity; for example, the face, ears, and neck of old FTM develop severe dermatitis spontaneously, whereas the dorsal flank skin remains normal (Sakai et al., 2015Sakai T. Hatano Y. Matsuda-Hirose H. Nishiyori R. Fujiwara S. Atopic dermatitis-like dermatitis emerges unevenly on different sites in flaky tail mice.J Dermatol Sci. 2015; 78: 151-153Abstract Full Text Full Text PDF PubMed Scopus (3) Google Scholar). Although some studies have revealed the importance of IL-1, thymic stromal lymphopoietin, and IL-17 for the development of dermatitis in FTM (Ewald et al., 2017Ewald D.A. Noda S. Oliva M. Litman T. Nakajima S. Li X. et al.Major differences between human atopic dermatitis and murine models, as determined by using global transcriptomic profiling.J Allergy Clin Immunol. 2017; 139: 562-571Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar, Kezic et al., 2012Kezic S. O'Regan G.M. Lutter R. Jakasa I. Koster E.S. Saunders S. et al.Filaggrin loss-of-function mutations are associated with enhanced expression of IL-1 cytokines in the stratum corneum of patients with atopic dermatitis and in a murine model of filaggrin deficiency.J Allergy Clin Immunol. 2012; 129: 1031-1039.e1Abstract Full Text Full Text PDF PubMed Scopus (179) Google Scholar, Moniaga et al., 2013Moniaga C.S. Jeong S.K. Egawa G. Nakajima S. Hara-Chikuma M. Jeon J.E. et al.Protease activity enhances production of thymic stromal lymphopoietin and basophil accumulation in flaky tail mice.Am J Pathol. 2013; 182: 841-851Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar), the site specificity seen in FTM was not a focus of the studies, and the detailed mechanisms of site-specific emergence of dermatitis remain unclear. Here, we analyzed nonlesional and lesional skin in FTM using a microarray to investigate the pathogenesis of site-specific dermatitis. Among the four sites—flanks of young FTM, necks of young FTM, flanks of old FTM, and necks of old FTM—visible dermatitis developed only on the necks of old FTM, as evaluated clinically and histologically. Increases in transepidermal water loss and stratum corneum pH and decreases in stratum corneum hydration were observed in the necks of old FTM compared with the flanks of old FTM, whereas transepidermal water loss in the necks of young FTM did not increase (Supplementary Figure S1). Whole skin from the flanks and necks of old FTM were microarrayed, and we carried out clustering analysis to visualize the differences in gene expression. In the heatmap of all genes, the difference between nonlesional and lesional skin was not clear, because the expression pattern of each mouse varied (Figure 1). Next, we created heatmaps in which the predominant genes related to AD were shown along with P-values and expression ratios (neck/flank) (Figure 2). The upregulation of TARC coincided with the emergence of dermatitis. It has been shown previously that the expression of T helper type 2 cytokines such as IL-4, -5, and -13 is very low in FTM, and that IL-17A is upregulated in lesional skin (Ewald et al., 2017Ewald D.A. Noda S. Oliva M. Litman T. Nakajima S. Li X. et al.Major differences between human atopic dermatitis and murine models, as determined by using global transcriptomic profiling.J Allergy Clin Immunol. 2017; 139: 562-571Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar). Interestingly, the expression of FLG was significantly upregulated, whereas the expression of FLG-2 was downregulated in the necks of old FTM (Figure 2). These results were also confirmed through reverse transcriptase–PCR (Supplementary Figure S2). Flg2 is located next to Flg on the chromosome, and the FLG-2 protein is known as an S100 fused-type protein in the epidermal differentiation complex. A recent study showed that FLG-2 is responsible for part of skin barrier function in addition to FLG (Pendaries et al., 2015Pendaries V. Le Lamer M. Cau L. Hansmann B. Malaisse J. Kezic S. et al.In a three-dimensional reconstructed human epidermis filaggrin-2 is essential for proper cornification.Cell Death Dis. 2015; 6: e1656Crossref PubMed Scopus (50) Google Scholar), and that mutations in FLG2 are involved in the development of human AD (Margolis et al., 2014Margolis D.J. Gupta J. Apter A.J. Ganguly T. Hoffstad O. Papadopoulos M. et al.Filaggrin-2 variation is associated with more persistent atopic dermatitis in African American subjects.J Allergy Clin Immunol. 2014; 133: 784-789Abstract Full Text Full Text PDF PubMed Scopus (118) Google Scholar). The expression of both genes is known to be downregulated ordinarily by cutaneous inflammation, such as eczematous lesions, or by the effects of some cytokines, including T helper type 2 and T helper type 17, independent of mutation status (Broccardo et al., 2011Broccardo C.J. Mahaffey S. Schwarz J. Wruck L. David G. Schlievert P.M. et al.Comparative proteomic profiling of patients with atopic dermatitis based on history of eczema herpeticum infection and Staphylococcus aureus colonization.J Allergy Clin Immunol. 2011; 127: 186-193.e11Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar, Gutowska-Owsiak et al., 2012Gutowska-Owsiak D. Schaupp A.L. Salimi M. Selvakumar T.A. McPherson T. Taylor S. et al.IL-17 downregulates filaggrin and affects keratinocyte expression of genes associated with cellular adhesion.Exp Dermatol. 2012; 21: 104-110Crossref PubMed Scopus (153) Google Scholar, Howell et al., 2008Howell M.D. Fairchild H.R. Kim B.E. Bin L. Boguniewicz M. Redzic J.S. et al.Th2 cytokines act on S100/A11 to downregulate keratinocyte differentiation.J Invest Dermatol. 2008; 128: 2248-2258Abstract Full Text Full Text PDF PubMed Scopus (164) Google Scholar), in contrast with the results of FLG in this study. On the other hand, a similar expression pattern of FLG and FLG-2 to that observed in our results was found in the dermatitis related to abnormal lipid metabolism induced by an essential fatty acid–deficient diet (Hansmann et al., 2012Hansmann B. Ahrens K. Wu Z. Proksch E. Meyer-Hoffert U. Schröder J.M. Murine filaggrin-2 is involved in epithelial barrier function and down-regulated in metabolically induced skin barrier dysfunction.Exp Dermatol. 2012; 21: 271-276Crossref PubMed Scopus (23) Google Scholar). Therefore, although the detailed mechanisms remain obscure, we speculate that abnormal lipid metabolism might be deeply involved in the site-specific emergence or maintenance of dermatitis on the necks of old FTM. This is supported by Kyoto Encyclopedia of Genes and Genomes pathway analysis using DAVID to investigate the pathogenic differences between the flank and neck, which found that some pathways involved in lipid metabolism had the highest statistical difference in old FTM (Supplementary Figure S3a), suggesting that the abnormality of lipid metabolism might be involved in the emergence or maintenance of the site-specific dermatitis on the necks of old FTM. In addition, alterations in lipid organization were also reported to lead to the upregulation of involucrin (Ekanayake-Mudiyanselage et al., 1998Ekanayake-Mudiyanselage S. Jensen J. Proksch E. Aschauer H. Schmook F.P. Meingassner J.G. Expression of epidermal keratins and the cornified envelope protein involucrin is influenced by permeability barrier disruption.J Invest Dermatol. 1998; 111: 517-523Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar), which was therefore also upregulated in the necks of old FTM (Figure 2).Figure 2Heatmap of the predominant genes related to AD in the flank and neck of old FTM. The heatmap of the predominant genes related to AD was generated, and expression ratios (neck/flank) and P-values were calculated as shown in Supplementary Materials and Methods. The results were ordered by neck/flank ratio. TARC upregulation coincided with the emergence of dermatitis. The expression of Th2 cytokines was very low in FTM, and the expression of IL-17A was upregulated in the neck. The expression of FLG was significantly upregulated, whereas the expression of FLG-2 was downregulated in the necks of old FTM. AD, atopic dermatitis; FTM, flaky tail mice; Th2, T helper type 2.View Large Image Figure ViewerDownload Hi-res image Download (PPT) These findings could be useful for exploring therapeutic targets. In particular, it is notable that the peroxisome proliferator-activated receptor (PPAR) signaling pathway, which is also related to lipid metabolism, was detected as a second pathway in the Kyoto Encyclopedia of Genes and Genomes pathway analysis of old FTM (Supplementary Figure S3a). In that pathway, the expression of several genes, including PPAR-α was downregulated (Supplementary Figure S3, Supplementary Figure S4, and S5). Accordingly, a decrease in PPAR-α expression has been detected in AD, and PPAR-α–deficient mice exhibited more severe hapten-induced AD-like dermatitis than wild-type mice (Staumont-Sallé et al., 2008Staumont-Sallé D. Abboud G. Brénuchon C. Kanda A. Roumier T. Lavogiez C. et al.Peroxisome proliferator-activated receptor alpha regulates skin inflammation and humoral response in atopic dermatitis.J Allergy Clin Immunol. 2008; 121: 962-968.e6Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar). In addition, some studies have shown that agonists of PPAR-α can normalize skin lipid ratio and improve cutaneous inflammation (Hatano et al., 2010Hatano Y. Man M.Q. Uchida Y. Crumrine D. Mauro T.M. Feingold K.R. et al.Murine atopic dermatitis responds to peroxisome proliferator-activated receptors alpha and beta/delta (but not gamma) and liver X receptor activators.J Allergy Clin Immunol. 2010; 125: 160-169.e1-5Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar, Wallmeyer et al., 2015Wallmeyer L. Lehnen D. Eger N. Sochorová M. Opálka L. Kováčik A. et al.Stimulation of PPARalpha normalizes the skin lipid ratio and improves the skin barrier of normal and filaggrin deficient reconstructed skin.J Dermatol Sci. 2015; 80: 102-110Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar), suggesting that a decrease in PPAR-α might be a promising therapeutic target in the treatment of AD. Meanwhile, the expression pattern of PPARs, that is, downregulation of PPAR-α and PPAR-γ, but not of PPAR-β/δ, in the necks of old FTM seems to be consistent with what would be induced by permeability barrier abrogation in mice (Adachi et al., 2013Adachi Y. Hatano Y. Sakai T. Fujiwara S. Expressions of peroxisome proliferator-activated receptors (PPARs) are directly influenced by permeability barrier abrogation and inflammatory cytokines and depressed PPARα modulates expressions of chemokines and epidermal differentiation-related molecules.Exp Dermatol. 2013; 22: 606-608Crossref PubMed Scopus (17) Google Scholar); this suggests that permeability barrier abnormalities, possibly related to abnormal lipid metabolism, might be a key mechanism in the emergence or maintenance of site-specific dermatitis in the necks of old FTM. This study is only an analysis of gene expressions, so further studies are required for proving detailed mechanisms, although site-specific evaluation using microarrays in individuals with the same genetic background could provide new insight into the pathogenesis and therapeutic targets of several skin diseases showing site specificity. Other limitations of the present study are that we used FTM with mutations in Flg and Tmem79 and analyzed the skin of only old FTM after dermatitis fully completed. The gene mutations in FTM may affect the results of the microarray. The process of dermatitis formation could not be focused in this study. In practice, it would be difficult to focus on the precise state of pre-onset dermatitis in vivo. In addition, dermatitis on the necks of old FTM never improves in lifetime spontaneously, and the dorsal flank never developed dermatitis in our laboratory observations. Female FTM (Jackson Laboratory, Bar Harbor, ME) were used at 4 weeks old and 33–37 weeks old. Whole skin including dermis and fat of flank and neck in each mouse were sampled. All experiments with mice were approved by the Ethics of Animal Experimentation Committee of Oita University. Datasets related to this article can be found at https://doi.org/10.17632/v5th44n68j.1, hosted at Mendeley Data (Sakai, 2019). The microarray data are accessible through the Gene Expression Omnibus Series, Accession Number GSE124434 (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?&acc=GSE). Takashi Sakai: https://orcid.org/0000-0001-7128-3237 Chinatsu Aoki: https://orcid.org/0000-0002-5988-2517 Yasuko Mori: https://orcid.org/0000-0002-8761-9185 Tomoko Yamate: https://orcid.org/0000-0002-8586-7783 Haruna Matsuda-Hirose: https://orcid.org/0000-0003-4821-4406 Yutaka Hatano: https://orcid.org/0000-0002-1349-755X The authors state no conflict of interest. This study was supported by JSPS KAKENHI Grant Number JP17K16347. The authors are grateful to Ms. Kaori Yasuda (Cell Innovator Co, Ltd, Japan) for her assistance on the analysis of microarrays. Conceptualization: TS; Data Curation: TS; Formal Analysis: TS; Investigation: TS, CA, YM, TY, HMH; Project Administration: TS; Supervision: YH; Validation: TS; Visualization: TS; Writing - Original Draft Preparation: TS; Writing - Review and Editing: YH Transepidermal water loss, stratum corneum hydration, and stratum corneum surface pH were measured with the Tewameter TM300 (Courage & Khazaka, Cologne, Germany), the Corneometer CM825 (Courage & Khazaka), and a skin pH meter (PH 905; Courage & Khazaka), respectively, as described previously (Sakai et al., 2014Sakai T. Hatano Y. Zhang W. Fujiwara S. Defective maintenance of pH of stratum corneum is correlated with preferential emergence and exacerbation of atopic-dermatitis-like dermatitis in flaky-tail mice.J Dermatol Sci. 2014; 74: 222-228Abstract Full Text Full Text PDF PubMed Scopus (17) Google Scholar). Skin samples from flank or neck were fixed in 10% buffered formalin and embedded in paraffin. Multiple 4-μm sections were stained with hematoxylin and eosin. The thickness of the epidermis was measured with the scaled ocular lens of a light microscope. The total RNA was isolated from whole skin of each individual animal using TRIzol Reagent (Invitrogen, Carlsbad, CA) and purified using SV Total RNA Isolation System (Promega, Madison, WI) according to the manufacturer's instructions. RNA samples were quantified by an ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE), and the quality was confirmed with a Experion System (Bio-Rad Laboratories, Hercules, CA). The cRNA was amplified, labeled using a Low Input Quick Amp Labeling Kit, and hybridized to a SurePrint G3 Mouse Gene Expression Microarray 8×60K v2 according to the manufacturer's instructions (Agilent, Santa Clara, CA). All hybridized microarray slides were scanned by an Agilent scanner. Relative hybridization intensities and background hybridization values were calculated using Agilent Feature Extraction Software, version 9.5.1.1. We generated a heat map using MeV software (Saeed et al., 2003Saeed A.I. Sharov V. White J. Li J. Liang W. Bhagabati N. et al.TM4: a free, open-source system for microarray data management and analysis.BioTechniques. 2003; 34: 374-378Crossref PubMed Scopus (3996) Google Scholar) and a hierarchical clustering method to sort the genes. The intensities of all genes in this study are accessible through the Gene Expression Omnibus Series, Accession Number GSE124434 (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?&acc=GSE). The raw signal intensities of samples from old FTM and Flags for each probe were calculated from hybridization intensities (gProcessedSignal), and spot information (gIsSaturated, etc.), according to the procedures recommended by Agilent. Additionally, the raw signal intensities of all samples were normalized by quantile algorithm with ‘preprocessCore’ library package [P] on Bioconductor software [B]. Probes that call ‘P’ flag in at least one sample were selected, excluding lincRNA probes. We then applied Linear Models for Microarray Analysis (limma) package (Smyth, 2005Smyth G.K. Limma: linear models for microarray data.in: Gentleman R. Carey V. Dudoit S. Irizarry R. Huber W. Bioinformatics and Computational Biology solutions using R and bioconductor. Springer, New York2005: 397-420Crossref Google Scholar) of Bioconductor software, and obtained 3065 genes. The criteria were that limma p-value < 0.05 and absolute log-fold-change (|logFC|) > 1 between dermatitis (+) and (-) samples. Total RNA isolation, microarray, and data analysis were performed in Cell Innovator, Co, Ltd, Japan. Genes with significantly different amounts of expression that met the criteria described previously were imported into the DAVID v6.8 annotation tool (https://david.ncifcrf.gov), and Kyoto Encyclopedia of Genes and Genomes pathway analysis was carried out. The detected pathways and P-values are shown in Supplementary Figure S3. The gene map in the peroxisome proliferator-activated receptor signaling pathway was generated with KEGG Mapper (https://www.kegg.jp/kegg/tool/map_pathway1.html). Reverse transcription of total RNA was performed with Transcriptor First Strand cDNA Synthesis Kit (Roche Diagnostics GmbH, Mannheim, Germany) according to the manufacturer’s instructions. Complementary DNA products were amplified on a LightCycler 480 System (Roche Diagnostics GmbH), as described previously (Sakai et al., 2014Sakai T. Hatano Y. Zhang W. Fujiwara S. Defective maintenance of pH of stratum corneum is correlated with preferential emergence and exacerbation of atopic-dermatitis-like dermatitis in flaky-tail mice.J Dermatol Sci. 2014; 74: 222-228Abstract Full Text Full Text PDF PubMed Scopus (17) Google Scholar). Product specificity was evaluated by melting curve analysis, and relative gene expression was calculated by comparative Ct method. Relative mRNA expression levels were normalized with the housekeeping gene β-actin. The mouse primers used for real-time PCR are shown in Supplementary Table S1. Physiological assessments and results of reverse transcriptase–PCR were analyzed by two-tailed Student’s t-test or Welch’s t-test and the results presented as means ± standard error of the mean of the number of experiments. A P-value < 0.05 was considered evidence of statistical significance.Supplementary Figure S2Gene expression of Flg and Flg2. Expression of each gene was measured by (a) microarray or (b, c) RT-PCR. Analysis by both microarray and RT-PCR shows that the expression of Flg is significantly upregulated, whereas the expression of Flg2 is downregulated in the necks of old FTM. FTM, flaky tail mice; RT-PCR, reverse transcriptase–PCR.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Figure S3Results of KEGG pathway analysis with DAVID. KEGG pathway analysis was performed with DAVID as shown in Supplementary Materials and Methods. Some of the most statistically significant differences in old FTM were pathways involved in lipid metabolisms such as metabolic pathways and the PPAR signaling pathway. (a) The results of top 30 are shown. (b) Differences in gene expression in the neck compared with the flank of old FTM in the KEGG PPAR signaling pathway are shown (the blue panel indicates downregulated genes and the red panel indicates upregulated genes). Several genes in the pathway, including PPAR-α were downregulated. FTM, flaky tail mice; KEGG, Kyoto Encyclopedia of Genes and Genomes; PPAR, peroxisome proliferator-activated receptor.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Figure S4Heatmap with the genes in KEGG PPAR signaling pathway. The expression ratios (neck/flank) and P-values were calculated as shown in Supplementary Materials and Methods. The results were ordered by neck/flank ratio. Several genes in the pathway were downregulated on the necks of old FTM. FTM, flaky tail mice; KEGG, Kyoto Encyclopedia of Genes and Genomes; PPAR, peroxisome proliferator-activated receptor.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Figure S5Gene expressions in KEGG PPAR signaling pathway. Some gene expressions in KEGG PPAR signaling pathway were confirmed by RT-PCR. PPAR-α and PPAR-γ, but not PPAR-δ, were downregulated in the necks of old FTM. Several other genes were also downregulated. N = 12. FTM, flaky tail mice; KEGG, Kyoto Encyclopedia of Genes and Genomes; NS, not significant; PPAR, peroxisome proliferator-activated receptor; RT-PCR, reverse transcriptase–PCR.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Table S1Sequences of PCR PrimersMouse GeneForwardReverseFlgGAACTTCTGGAAGGACAACTACATGTCATCGTGGTCCACATCTFlg2CTTATCCTACTTGTTCCTTTGGTGAGCATTCTTCATCTTGCTTGGTPparaACACGACCTGAAAGATTCGGAAGCGTCTTCTCGGCCATACPpardATGAAGACAAACCCACGGTAAAGTCCTGTGGCTGTTCCATGACPpargGAAGCTCCAAGAATACCAAAGTGCAGACTCGGCACTCAATGGFabp4GGTTTACAAAATGTGTGATGCCTCACTCCCACTTCTTTCATGTAATCScd3CACCTGCTGCAAGAAGAGATGACCTTCACCTTCTCTCGTCCATTCTGPlin1CTGTCCACCCAGTTCACAGCTTCAGTTCAGAGGCGATCTTLplCTGAGGACACTTGTCATCTCATTCGGGCACCCAACTCTCATACCpt1bCACCGACAGAAGCAAACCTGAGTCACAGTGAACTGGAAAGCTACAdipoqTGGATCTGACGACACCAAAAGCATGACTGGGCAGGATTAAGAGSorbs1GCCCGACTCCAGACATTACCTCTTCACTGCATGGAAGTTGActbCGTTGACATCCGTAAAGACCTCAGCCACCGATCCACACAGA Open table in a new tab" @default.
• W2799506802 created "2018-05-17" @default.
• W2799506802 creator A5001863012 @default.
• W2799506802 creator A5007579744 @default.
• W2799506802 creator A5057087207 @default.
• W2799506802 creator A5080665381 @default.
• W2799506802 creator A5081523770 @default.
• W2799506802 creator A5082393408 @default.
• W2799506802 date "2019-12-01" @default.
• W2799506802 modified "2023-09-27" @default.
• W2799506802 title "Site-Specific Microarray Evaluation of Spontaneous Dermatitis in Flaky Tail Mice" @default.
• W2799506802 cites W1580233091 @default.
• W2799506802 cites W1853417530 @default.
• W2799506802 cites W1968348731 @default.
• W2799506802 cites W1982848064 @default.
• W2799506802 cites W1999975793 @default.
• W2799506802 cites W2007152833 @default.
• W2799506802 cites W2011776385 @default.
• W2799506802 cites W2011791204 @default.
• W2799506802 cites W2019388460 @default.
• W2799506802 cites W2062659963 @default.
• W2799506802 cites W2086919233 @default.
• W2799506802 cites W2105897562 @default.
• W2799506802 cites W2117000242 @default.
• W2799506802 cites W2164900506 @default.
• W2799506802 cites W2168622944 @default.
• W2799506802 cites W2528377687 @default.
• W2799506802 cites W45534775 @default.
• W2799506802 doi "https://doi.org/10.1016/j.jid.2019.04.024" @default.
• W2799506802 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/31226263" @default.
• W2799506802 hasPublicationYear "2019" @default.
• W2799506802 type Work @default.
• W2799506802 sameAs 2799506802 @default.
• W2799506802 citedByCount "1" @default.
• W2799506802 countsByYear W27995068022023 @default.
• W2799506802 crossrefType "journal-article" @default.
• W2799506802 hasAuthorship W2799506802A5001863012 @default.
• W2799506802 hasAuthorship W2799506802A5007579744 @default.
• W2799506802 hasAuthorship W2799506802A5057087207 @default.
• W2799506802 hasAuthorship W2799506802A5080665381 @default.
• W2799506802 hasAuthorship W2799506802A5081523770 @default.
• W2799506802 hasAuthorship W2799506802A5082393408 @default.
• W2799506802 hasBestOaLocation W27995068021 @default.
• W2799506802 hasConcept C104317684 @default.
• W2799506802 hasConcept C150194340 @default.
• W2799506802 hasConcept C16005928 @default.
• W2799506802 hasConcept C186836561 @default.
• W2799506802 hasConcept C54355233 @default.
• W2799506802 hasConcept C70721500 @default.
• W2799506802 hasConcept C71924100 @default.
• W2799506802 hasConcept C8415881 @default.
• W2799506802 hasConcept C86803240 @default.
• W2799506802 hasConceptScore W2799506802C104317684 @default.
• W2799506802 hasConceptScore W2799506802C150194340 @default.
• W2799506802 hasConceptScore W2799506802C16005928 @default.
• W2799506802 hasConceptScore W2799506802C186836561 @default.
• W2799506802 hasConceptScore W2799506802C54355233 @default.
• W2799506802 hasConceptScore W2799506802C70721500 @default.
• W2799506802 hasConceptScore W2799506802C71924100 @default.
• W2799506802 hasConceptScore W2799506802C8415881 @default.
• W2799506802 hasConceptScore W2799506802C86803240 @default.
• W2799506802 hasIssue "12" @default.
• W2799506802 hasLocation W27995068021 @default.
• W2799506802 hasLocation W27995068022 @default.
• W2799506802 hasOpenAccess W2799506802 @default.
• W2799506802 hasPrimaryLocation W27995068021 @default.
• W2799506802 hasRelatedWork W1597614051 @default.
• W2799506802 hasRelatedWork W2037383042 @default.
• W2799506802 hasRelatedWork W2038153693 @default.
• W2799506802 hasRelatedWork W2097822643 @default.
• W2799506802 hasRelatedWork W2099388441 @default.
• W2799506802 hasRelatedWork W2371322776 @default.
• W2799506802 hasRelatedWork W2417887690 @default.
• W2799506802 hasRelatedWork W2595364407 @default.
• W2799506802 hasRelatedWork W2625305039 @default.
• W2799506802 hasRelatedWork W3127817617 @default.
• W2799506802 hasVolume "139" @default.
• W2799506802 isParatext "false" @default.
• W2799506802 isRetracted "false" @default.
• W2799506802 magId "2799506802" @default.
• W2799506802 workType "article" @default.