FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2804890131> ?p ?o ?g. }

• W2804890131 endingPage "666" @default.
• W2804890131 startingPage "657" @default.
• W2804890131 abstract "Newcastle disease (ND) caused by avian paramyxovirus serotype-1 (APMV-1) is long known as an acute contagious and infectious disease of various bird species. Prior studies have acknowledged that the virus could cause up to 100% morbidity and mortality as well as reducing eggs production. In theory, hemagglutinin-neuraminidase (HN) in ND virus (NDV) is one of the surface glycoproteins that functions during the attachment, assembly, and maturation of the virus. On the fields, Indonesia has been recognized as an endemic country for ND where continuous outbreaks of ND in commercial chicken farms have been reported despite the implementation of periodical vaccination programs. Thus, this study aims at characterizing NDV isolated from periodically vaccinated commercial farms, comparing its genetic correlation based on their HN gene fragment with registered NDV originated from Indonesia as well as with existing vaccine strains.The HN gene fragment of NDV isolated from well-vaccinated farms was amplified using primer pairs of forward 5' GTGAGTGCAACCCCTTTAGGTTGT 3' and reverse 3' TAGACCCCAGTGATGCATGAGTTG 3' with a 694 bp product length. The nucleotide sequences of nine samples, which were gathered from Kulon Progo, Gunung Kidul (2), Boyolali (2), Magelang, Muntilan (2), Palembang, and Medan, were later compared with the sequences of HN gene of NDV available in NCBI Genbank database. The amino acid sequence analysis and multiple sequence alignment were conducted using the Mega7 program.The data analysis on amino acid sequences showed that the structure of amino acid residue at positions 345-353 for all isolates appears to be PDEQDYQIR. The structure is the same as for archived samples from Indonesia and either LaSota or B1 vaccine strains. The amino acid distance between observed isolates and LaSota vaccine strain is 8.2-8.8% with a homology value at 91.2-91.7%.Looking at amino acid sequence analysis, LaSota vaccines can considerably be stated as being protective against ND disease outbreak. However, the distant homology value from a perfect condition for the protection might have acted as the root cause of vaccination failures." @default.
• W2804890131 created "2018-06-01" @default.
• W2804890131 creator A5045754813 @default.
• W2804890131 creator A5056597465 @default.
• W2804890131 creator A5082162803 @default.
• W2804890131 date "2018-05-01" @default.
• W2804890131 modified "2023-09-23" @default.
• W2804890131 title "Molecular characterization of hemagglutinin-neuraminidase fragment gene of Newcastle disease virus isolated from periodically-vaccinated farms" @default.
• W2804890131 cites W1533570709 @default.
• W2804890131 cites W1634071366 @default.
• W2804890131 cites W188064665 @default.
• W2804890131 cites W1979362486 @default.
• W2804890131 cites W1983552892 @default.
• W2804890131 cites W1993648099 @default.
• W2804890131 cites W2000572812 @default.
• W2804890131 cites W2001004221 @default.
• W2804890131 cites W2007802515 @default.
• W2804890131 cites W2008545186 @default.
• W2804890131 cites W2010015089 @default.
• W2804890131 cites W2012481679 @default.
• W2804890131 cites W2015595608 @default.
• W2804890131 cites W2019632525 @default.
• W2804890131 cites W2024463718 @default.
• W2804890131 cites W2033517861 @default.
• W2804890131 cites W2041376754 @default.
• W2804890131 cites W2047972388 @default.
• W2804890131 cites W2048573278 @default.
• W2804890131 cites W2051263432 @default.
• W2804890131 cites W2065823820 @default.
• W2804890131 cites W2069956266 @default.
• W2804890131 cites W2081284647 @default.
• W2804890131 cites W2090300722 @default.
• W2804890131 cites W2090430306 @default.
• W2804890131 cites W2092903084 @default.
• W2804890131 cites W2093238533 @default.
• W2804890131 cites W2096058800 @default.
• W2804890131 cites W2096540325 @default.
• W2804890131 cites W2097403532 @default.
• W2804890131 cites W2100671275 @default.
• W2804890131 cites W2107935667 @default.
• W2804890131 cites W2108336472 @default.
• W2804890131 cites W2111417185 @default.
• W2804890131 cites W2116716663 @default.
• W2804890131 cites W2127487653 @default.
• W2804890131 cites W2129946136 @default.
• W2804890131 cites W2134622732 @default.
• W2804890131 cites W2157922349 @default.
• W2804890131 cites W2159735578 @default.
• W2804890131 cites W2299844689 @default.
• W2804890131 cites W2311203695 @default.
• W2804890131 cites W2331221414 @default.
• W2804890131 cites W2414796558 @default.
• W2804890131 cites W2435721327 @default.
• W2804890131 cites W2436000380 @default.
• W2804890131 cites W2466546943 @default.
• W2804890131 cites W2526950960 @default.
• W2804890131 cites W2551307357 @default.
• W2804890131 cites W2553420848 @default.
• W2804890131 cites W2562029022 @default.
• W2804890131 cites W2746795251 @default.
• W2804890131 cites W2763709306 @default.
• W2804890131 cites W2790759421 @default.
• W2804890131 cites W2793999624 @default.
• W2804890131 doi "https://doi.org/10.14202/vetworld.2018.657-666" @default.
• W2804890131 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/5993761" @default.
• W2804890131 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/29915505" @default.
• W2804890131 hasPublicationYear "2018" @default.
• W2804890131 type Work @default.
• W2804890131 sameAs 2804890131 @default.
• W2804890131 citedByCount "4" @default.
• W2804890131 countsByYear W28048901312019 @default.
• W2804890131 countsByYear W28048901312022 @default.
• W2804890131 crossrefType "journal-article" @default.
• W2804890131 hasAuthorship W2804890131A5045754813 @default.
• W2804890131 hasAuthorship W2804890131A5056597465 @default.
• W2804890131 hasAuthorship W2804890131A5082162803 @default.
• W2804890131 hasBestOaLocation W28048901311 @default.
• W2804890131 hasConcept C10389963 @default.
• W2804890131 hasConcept C104317684 @default.
• W2804890131 hasConcept C116675565 @default.
• W2804890131 hasConcept C134164806 @default.
• W2804890131 hasConcept C134215735 @default.
• W2804890131 hasConcept C151730666 @default.
• W2804890131 hasConcept C159047783 @default.
• W2804890131 hasConcept C2522874641 @default.
• W2804890131 hasConcept C2778116459 @default.
• W2804890131 hasConcept C2778692840 @default.
• W2804890131 hasConcept C54355233 @default.
• W2804890131 hasConcept C61053724 @default.
• W2804890131 hasConcept C79029880 @default.
• W2804890131 hasConcept C84148353 @default.
• W2804890131 hasConcept C86803240 @default.
• W2804890131 hasConceptScore W2804890131C10389963 @default.
• W2804890131 hasConceptScore W2804890131C104317684 @default.
• W2804890131 hasConceptScore W2804890131C116675565 @default.
• W2804890131 hasConceptScore W2804890131C134164806 @default.
• W2804890131 hasConceptScore W2804890131C134215735 @default.
• W2804890131 hasConceptScore W2804890131C151730666 @default.

• next