FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2890722171> ?p ?o ?g. }

• W2890722171 endingPage "79.e3" @default.
• W2890722171 startingPage "66" @default.
• W2890722171 abstract "•Granulocyte colony-stimulating factor (G-CSF) upregulated microRNA-146a (miR-146a) and decreased downstream CXCR4 and Smad4 expression.•CXCR4 and Smad4 downregulation led to impaired chemotaxis properties and increased sensitivity to cytarabine.•G-CSF upregulated miR-146a via the upstream nuclear factor kappa beta (NF-κB) pathway.•High miR-146a expression levels in acute myeloid leukemia (AML) patients predict better clinical outcomes. The selection of chemotherapy regimen for elderly patients with acute myeloid leukemia (AML) remains challenging. Here, we report that granulocyte colony-stimulating factor (G-CSF) upregulates the expression of microRNA (miR)-146a in a nuclear factor kappaB-dependent manner, leading to direct decreases in the expression of the target proteins CXCR4 and Smad4 in AML cells in vitro. The reduction in CXCR4 expression suppressed the migration abilities of leukemia cells. Downregulation of Smad4 promoted cell cycle entry in leukemia cells. Furthermore, an increase in apoptosis was observed when leukemia cells were treated sequentially with G-CSF and cytosine arabinoside in vitro. These findings suggest that G-CSF treatment may disrupt the protection of bone marrow niches from leukemia cells. In a review of data from 78 cases of primary AML, we found that a high miR-146a expression and/or upregulation of this miRNA during G-CSF priming chemotherapy was predictive of better clinical outcomes. Our findings suggest that miR-146a may be a novel biomarker for evaluating the clinical prognosis and treatment effects of a G-CSF priming protocol in elderly patients with AML. The selection of chemotherapy regimen for elderly patients with acute myeloid leukemia (AML) remains challenging. Here, we report that granulocyte colony-stimulating factor (G-CSF) upregulates the expression of microRNA (miR)-146a in a nuclear factor kappaB-dependent manner, leading to direct decreases in the expression of the target proteins CXCR4 and Smad4 in AML cells in vitro. The reduction in CXCR4 expression suppressed the migration abilities of leukemia cells. Downregulation of Smad4 promoted cell cycle entry in leukemia cells. Furthermore, an increase in apoptosis was observed when leukemia cells were treated sequentially with G-CSF and cytosine arabinoside in vitro. These findings suggest that G-CSF treatment may disrupt the protection of bone marrow niches from leukemia cells. In a review of data from 78 cases of primary AML, we found that a high miR-146a expression and/or upregulation of this miRNA during G-CSF priming chemotherapy was predictive of better clinical outcomes. Our findings suggest that miR-146a may be a novel biomarker for evaluating the clinical prognosis and treatment effects of a G-CSF priming protocol in elderly patients with AML. Acute myeloid leukemia (AML) is a heterogeneous group of aggressive malignancies characterized by the uncontrolled proliferation of leukemia cells. Among patients with AML younger than 60 years, the complete remission (CR) rate is approximately 60% and the 5-year overall survival (OS) is approximately 40% after intensive chemotherapy and progressive, supportive treatment [1Hao M Zhang L An G et al.Bone marrow stromal cells protect myeloma cells from bortezomib induced apoptosis by suppressing microRNA-15a expression.Leuk Lymphoma. 2011; 52: 1787-1794Crossref PubMed Scopus (96) Google Scholar]. Unfortunately, the median age of patients with AML is approximately 65 years [2Nagel G Weber D Fromm E et al.German-Austrian AML Study Group (AMLSG). Epidemiological, genetic, and clinical characterization by age of newly diagnosed acute myeloid leukemia based on an academic population-based registry study (AMLSG BiO).Ann Hematol. 2017; 96: 1993-2003Crossref PubMed Scopus (81) Google Scholar] and the CR and long-term disease-free survival rates remain low in this population. These elderly patients cannot endure severe chemotherapy-related toxicities given their poor physical statuses, organ dysfunction, and drug resistance [3Appelbaum FR Gundacker H Head DR et al.Age and acute myeloid leukemia.Blood. 2006; 107: 3481-3485Crossref PubMed Scopus (958) Google Scholar, 4Juliusson G Antunovic P Derolf A et al.Age and acute myeloid leukemia: real world data on decision to treat and outcomes from the Swedish Acute Leukemia Registry.Blood. 2009; 113: 4179-4187Crossref PubMed Scopus (667) Google Scholar]. Therefore, identifying novel treatment protocols with minimal toxicities and overcoming drug resistance remain the most challenging scenarios facing this population of patients. The CAG protocol, which comprises low-dosage aclarubicin plus cytosine arabinoside and granulocyte colony-stimulating factor (G-CSF) for priming, has been widely applied in China and Japan and has yielded good CR rates and chemotherapy tolerability in patients with AML [5Takahashi W Nakamura Y Tadokoro J et al.CAG-GO therapy for patients with relapsed or primary refractory CD33-positive acute myelogenous leukemia.Rinsho Ketsueki. 2012; 53: 71-77PubMed Google Scholar]. Recent data, however, also show that the clinical outcomes of the CAG regimen vary widely by age, chromosomal status, gene expression, and other established prognostic indexes. In other words, not all patients benefit from this regimen. Therefore, it is important to clarify the mechanism by which G-CSF exerts its effects during leukemia therapy to ensure that suitable patients are included in this protocol. In the present study, which was based on in vitro experimental data of leukemia cells and clinical observations, we assumed that, during the CAG protocol, nuclear factor-kappaB (NF-κB expression in leukemia cells would be activated by exogenous G-CSF, which would in turn upregulate the expression of microRNA (miR)-146a. miR-146a is a negative regulatory factor of CXCR4/Smad4 expression in leukemia cells. In this capacity, miR-146a plays vital roles in the homing of leukemia stem cells and release of these cells from bone marrow (BM) niches, which promotes cell cycle entry and sensitizes the cells to the chemotherapy. Accordingly, in the present study, we illustrate the underlying value of miR-146a as a useful biomarker for predicting CAG protocol efficacy. HL-60 human leukemia cells were purchased from the cell bank of the Chinese Academy of Sciences (Shanghai, China) and cultured in Iscove's modified Dulbecco's medium (IMDM) solution (Invitrogen, Grand Island, NY, USA) supplemented with 20% fetal bovine serum (FBS) under standard conditions (37°C, 5% CO2 in a humidified atmosphere). HS-5 human marrow stromal cells were purchased from ATCC (Manassas, VA, USA) and cultured in Dulbecco's modified Eagle medium (Invitrogen) supplemented with 10% FBS under standard conditions. BM samples from 78 patients were obtained from the Department of Hematology at Ren Ji Hospital, School of Medicine, Shanghai Jiao Tong University. The patients’ characteristics are shown in Table 1. Written informed consent was obtained from all patients in accordance with the Declaration of Helsinki. The project outlines and consent procedures were submitted to and approved by the Ethics Committee of Renji Hospital.Table 1Clinical characteristics and laboratory findings of patientsCharacteristicsValueNo. of patients78Sex, n Male36 Female42 Median age, years (range)61 (45–73)FAB classification, n M211 M427 M537 M62 Undefined by FAB1Cytogenetic abnormality Favorable5 Intermediate63 Unfavorable10 Median WBC count, , ic9/L (range)7.58 (0.9–11.48) Median LDH level, U/L (range)338.5 (91–6548) Median PLT count, U/Lc9/L (range)51.5 (2–361)miR-146a expression level Low39 High39 Median follow-up time, months (range)11 (0.2–104) Open table in a new tab Mononuclear cell (MNC) fractions were obtained by density gradient centrifugation using Ficoll-Paque PREMIUM. Briefly, the samples were diluted twice, gently layered onto Ficoll-Paque PREMIUM solution, and centrifuged for 20 min at 2500 rpm at room temperature. The MNCs were carefully aspirated from the Ficoll–plasma interface, washed twice with phosphate-buffered saline (PBS) at 1500 rpm for 5 min, resuspended in 70% Roswell Park Memorial Institute medium (RPMI) containing 20% FBS and 10% dimethyl sulfoxide and frozen in the Hematology Laboratory of Ren Ji Hospital. When needed, the MNCs were thawed quickly at 37°C (water bath), treated directly with 125 μL of filtered DNase (1 mg/mL), and immediately transferred to 10 mL of IMDM medium (20% FBS) and centrifuged at 1500 rpm for 5 min. After aspirating the supernatant, 10 mL of fresh IMDM medium (20% FBS) was added and the cells were transferred to a cell culture flask and incubated under standard conditions. Trypan blue staining was used to determine cell viability at 24 hours after seeding. A qualified sample was defined as containing sample w+ cells after thawing. For fundamental and functional assays, HL-60 cells and primary leukemia cells (density: 1 × 107/L) were treated with G-CSF (200 ng/mL) and/or cytosine arabinoside (Ara-C) for 48 hours. To determine the proper concentration of Ara-C, we conducted a dose–response evaluation of cytarabine from 0.04 to 20 μmol/L (Supplementary Figure 1, online only, available at www.exphem.org) and selected the half-maximal inhibitory concentration value as the final Ara-C concentration. We established a HS-5/AML cell direct-contact co-culture model. Briefly, HS-5 cells (1 × 105 cells/mL/well) were seeded onto 12-well plates 2 days before the experiments and incubated under standard conditions. After confirming the confluence of the stromal layer using phase-contrast microscopy, differently treated (as described in the previous section) leukemia cells (HL-60 and primary AML cells) were added to the HS-5 layers with or without cytarabine (0.05 µM). After a 48-hour incubation, the cells were detached and washed twice with PBS. miR-146a-5p mimics or inhibitors and their corresponding negative controls were purchased from GenePharma (Shanghai, China). To knock down CXCR4 and Smad4 expression, cells were transfected with small interfering RNAs (siRNAs) specific for CXCR4, Smad4, or negative control (Ribobio, Guangzhou, China). All transfections were performed using Lipofectamine 2000 (Invitrogen) according to the manufacturer's recommendations. To monitor the siRNA transfection efficiency, FAM-labeled negative control siRNA was transfected in parallel during all transfections. A transfection efficiency of at least 80% was achieved for all attempts (Supplementary Figure 2, online only, available at www.exphem.org). HL-60 and primary AML cells were seeded into 96-well plates at a density of 1 × 104 cells/well and incubated with Ara-C for 48 hours. Cell proliferation was measured using a CCK-8 Kit (Dojindo, Tabaru, Japan) according to the following protocol: after adding 10% CCK-8 solution to each well, the cells were incubated under standard conditions for 2 hours. The resulting absorbance values at 450 nm were measured. The optical density (OD) values of the samples were recorded as the measured values and the OD values of untreated samples were noted as control values. The terminal value was calculated as the measured value minus the control value. For the cell cycle analysis, cells were plated into 3.5 cm dishes (1 × 106 cells/dish) and collected by centrifugal separation after 24, 48, or 72 hours. Subsequently, the cells were fixed overnight in 70% ethanol, incubated for 30 min with 40 μg/mL RNase A (Roche, Basel, Switzerland), and analyzed using a FACSort flow cytometer (BD Biosciences, San Jose, CA, USA). Apoptosis was assessed flow cytometrically using an Alexa Fluor 488 Annexin V Apoptosis Kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's protocol. Briefly, cells were washed with cold PBS and resuspended in 1 × AnnexinV-binding buffer at a density of 5 × 105 cell/mL. Next, 5.0 μL of Alexa Fluor 488 Annexin V was added to 100 μl aliquots of cell suspension and the samples were incubated at room temperature for 15 min. Finally, 400 μl of 1 × Annexin-binding buffer was added to each sample, which was mixed gently and kept on ice. The stained cells stained were evaluated by flow cytometry as soon as possible. The percentage of apoptotic cells was calculated as the number of Annexin V+ HL-60 cells divided by the total number of input cells. Total RNA was extracted from cell lines or frozen tissues using TRIzol reagent and a miRNeasy mini kit (Invitrogen). The quantitative real-time polymerase chain reactions (qRT-PCRs) were performed using an All-in-One miRNA qRT-PCR Detection Kit (GeneCopoeia, Inc.). An iQ-5 device (Bio-Rad) was used for the real-time monitoring of the PCRs. The average Ct was calculated from triplicate assays and used for further calculations. Relative gene expression levels were normalized to controls. The endogenous U6 snRNA was selected as the internal control. The primer sequences are described below.Tabled 1GeneForward (5′–3′)Reverse (5′–3′)h-ß-actinGGCACTCTTCCAGCCTTCCGAGCCGCCGATCCACACCXCR4CCACGCCACCAACAGTCAGAGGCAGGATAAGGCCAACATSmad4CTCATGTGATCTATGCCCGTCTCGGTGGATGCTGGATGGTTTGp-IκBTGAGGACGAGGACGATAAGCACAACGTGATCGCCATTACCTGp-P65CAAGAAGAGCAGCGTGGGAAAGATGGGATGGAAAGGACA Open table in a new tab Cells were lysed in RIPA lysis buffer (Beyotime, Shanghai, China) containing 50 nmol/L Tris (pH 7.4), 0.1% sodium dodecylsulfate (SDS), and 1 mmol/L protease inhibitor phenylmethanesulfonyl fluoride. After centrifugation at 14,000 g for 3 min, the lysates were kept on ice for 30 min. The protein concentrations of the supernatants were determined using a BCA Protein Assay Kit (Beyotime) according to the manufacturer's protocol. Thirty micrograms of total protein per sample was denatured by boiling in loading buffer for 5 min, separated using 10% SDS-polyacrylamide gel electrophoresis, and transferred to a polyvinylidene difluoride membrane (Millipore, Billerica, MA, USA). The membranes were blocked for 30 min with 5% nonfat milk in Tris-buffered saline with Tween-20 at room temperature and probed overnight with primary antibodies (1:1000) at 4°C. The labeled protein bands were visualized using horseradish peroxidase-conjugated goat anti-rabbit antibodies (1:1000) and an enhanced chemiluminescence detection system (ECL; PerkinElmer, Waltham, MA, USA). The results were analyzed on a Tanon 5500 system (Tanon Biology, Shanghai, China) using ImageCal software (Tanon Biology). Protein expression was normalized to β-tubulin (1:1000). To evaluate the membrane expression of CXCR4, pretreated HL-60 or primary AML cells were washed in PBS and labeled using a phycoerythrin (PE)-conjugated antibody specific for CXCR4 (12G5). The labeled cells were then analyzed on a FACSCalibur flow cytometer (BD Biosciences) equipped with Cell Quest software (BD Biosciences) for acquisition and analysis. CXCR4 expression was determined by comparison with cells incubated with a PE-conjugated isotype control antibody. The results are reported in terms of the mean fluorescence intensity, which represents the ratio between the mean fluorescence values observed in CXCR4-labeled cells and isotype control-labeled cells. To reduce nonspecific migration and increase the sensitivities of leukemia cells toward stromal cell-derived factor 1(SDF-1), cells from each group were incubated in FBS-free RPMI-1640 medium for 48 hours before the experiments. Transwell chambers were prepared with serum-starvation medium for 2 hours before the experiments. Pretreated HL-60 cells were collected, washed twice with PBS, and suspended in serum-starvation medium to a density of 5 × 106 cells/mL. Subsequently, 100 μl aliquots of these cell suspensions were added to the upper Transwell chambers. The bottom chambers were supplemented with chemokines (including 600 μl of serum-starved medium or HS-5 cell liquid supernatant). Cells not exposed to chemokines were designated as controls. All cells were incubated under standard culture conditions for 4 hours, after which the liquid from the bottom chambers was centrifuged, the supernatant discarded, and the pellet suspended in 0.5 mL of serum-starvation medium. The resuspended cells were counted using flow cytometry for 20 sec at high-speed channels. The migration index was calculated as the number of migrated cells in the bottom chamber containing chemokine divided by the number of migrated cells in the bottom chamber without chemokine. To study the relationship between the miR-146a expression level and patient survival, we collected the data of 46 patients with AML who achieved a CR in response to CAG regimen as an induction therapy. Patients who did not receive intensive therapy or achieve a CR after one or more lines of induction (i.e., primary refractory) were excluded. The eligible patients had an average age of 61 years; had been diagnosed with AML via morphology, immunophenotyping, and clinical examinations; and had no other active malignancies. The CAG regimen comprises Ara-C at 10 mg/m2 injected subcutaneously every 12 hours for a total of 28 doses (days 1–14), aclarubicin at 5–7 mg/m2 injected intravenously on each of 8 days (days 1–8), and concurrent treatment with 200 µg/m2/d of G-CSF injected subcutaneously unless the patient had a white blood cell (WBC) count > 20 × 109 cells/L. After achieving a CR, the patient received five courses of Ara-C (1.5 g/m2 every 12 hours on days 1, 3,and 5) as consolidation therapy. The clinical characteristics of the patients are described in Table 1. The survival and relapse-free survival (RFS) durations were calculated from the time of diagnosis and plotted using the Lifetest procedure for Kaplan–Meier estimates. GraphPad Prism, version 3.0 for Windows (GraphPad Software, San Diego, CA, USA), was used to graph the Kaplan–Meier estimates. OS was calculated from the date of first diagnosis to the date of death. RFS was calculated from the date of first diagnosis to the date of relapse and included antecedent CRs. The log–rank test was used to calculate the significance of differences between survival curves. Group-wise comparisons of the distributions of variables were performed using the generalized Wilcoxon test. A Cox regression was used to identify differences in survival due to prognostic factors.p values <0.05 were considered significant. All data were analyzed using SPSS version 19.0 software (SPSS, Inc.,Chicago, IL, USA). All p values were two-sided and considered significant if <0.05. Previous reports have described the effects of G-CSF on several miRNAs [6Itkin T Kumari A Schneider E et al.MicroRNA-155 promotes G-CSF-induced mobilization of murine hematopoietic stem and progenitor cells via propagation of CXCL12 signaling.Leukemia. 2017; 31: 1247-1250Crossref PubMed Scopus (16) Google Scholar, 7Báez A Martín-Antonio B Piruat JI et al.Granulocyte colony-stimulating factor produces long-term changes in gene and microRNA expression profiles in CD34+ cells from healthy donors.Haematologica. 2014; 99: 243-251Crossref PubMed Scopus (10) Google Scholar]. Therefore, we investigated whether G-CSF might affect miR-146a expression. Because our previous experiments identified CXCR4 as a downstream target of miR-146a [8Spoo AC Lübbert M Wierda WG Burger JA CXCR4 is a prognosis marker in acute myelogenous leukemia.Blood. 2007; 109: 786-791Crossref PubMed Scopus (250) Google Scholar], we assumed that G-CSF might influence CXCR4 expression by upregulating miR-146a. As shown in Figures 1A and 1B, G-CSF significantly increased the expression of miR-146a and reduced the expression of CXCR4 expression in both HL-60 cells and human primary leukemia cells. Similar results were observed in cells engineered to exogenously overexpress miR-146a (miR-146-5p). Flow cytometry also indicated decreased surface levels of CXCR4 on HL-60 cells and primary leukemia cells in response to G-CSF treatment (Figures 1C and 1D). We next evaluated whether G-CSF suppressed the migration of AML cells by targeting the SDF-1α/CXCR4 axis. As shown in Figures 1E and 1F, G-CSF inhibited the migration of AML cells toward HS-5 regardless of miR-146a overexpression (miR-146-5p) or CXCR4 knockdown (si-CXCR4). When HS-5 cells were replaced by SDF-1α, G-CSF treatment similarly inhibited the migration of AML cells in the presence and absence of miR-146a overexpression (miR-146a-5p) and CXCR4 knockdown (si-CXCR4) (Figures 1G and 1H). These results indicate that G-CSF potently suppresses the migration of leukemia cells by blocking the SDF-1α/CXCR4 signal axis. Smad4 has also been identified as a target of miR-146a. We transfected HL-60 cells or primary leukemia cells with a miR-146a mimic and found that overexpression of miR-146a could repress the Smad4 protein level, as shown in the Smad4 direct interference groups (Figures 2A and 2B). We also observed a significant decrease in Smad4 levels in cells that had been pretreated with G-CSF compared with the control group (Figures 2A and 2B). These data suggest that Smad4, a target of miR-146a, can be regulated by the G-CSF/miR-146a signaling pathway. The effect of Smad4 expression on proliferation was determined in cells treated with G-CSF treatment or transfected with si-Smad4 and miR-146a-5p using cell proliferation and cell cycle assays. As shown inFigures 2C–2F, the proportions of cells in the G2/M and S phases of the cell cycle increased significantly in the Smad4-downregulated groups (i.e., G-CSF, miR-146a-5p, and si-Smad4). In the cell proliferation assay, miR-146a overexpression or G-CSF pretreatment significantly promoted the proliferation of leukemia cells, as indicated by the increase in cell viability relative to the negative control group (Figures 2G and 2H). We thus confirm that G-CSF can induce the downregulation of Smad4 and thus accelerate the proliferation of leukemia cells by directing more cells into the G2/M and S phases. To simulate in vivo interactions between leukemia cells and the BM niche, we constructed a co-culture model of AML cells and HS-5 stromal cells. As shown in Figure 3, we observed significant decreases in viability inhibition (p < 0.01) and the apoptosis rate (p < 0.001) when leukemia cells were co-cultured with stromal cells. However, treatment of the leukemia cells with G-CSF and cytarabine led to significant increases in the cytarabine-induced viability inhibition and apoptosis rates (p < 0.01). The overexpression of miR-146a or downregulation of CXCR4 in leukemia cells also increased the viability inhibition and apoptosis rates. Taken together, these data indicate that G-CSF can disrupt the interactions between leukemia cells and BM stromal cells and eventually sensitize the cells to cytotoxic drugs. We previously confirmed that both CXCR4 and Smad4 are downstream targets of miR-146a. To further explore the upstream components of this signaling pathway, we measured the phosphorylation of P65 (p-P65) and IκB (p-IκB), which are indicators of NF-κB transcriptional expression, before and after G-CSF treatment. As shown in Figure 4, the protein levels of both p-P65 and p-IκB were significantly upregulated and the levels of CXCR4 and Smad4 were downregulated in response to G-CSF. Sanguinarine was proven to block the phosphorylation of NF-κB pathway components. G-CSF failed to increase miR-146a expression in sanguinarine-treated cells. These data confirm that G-CSF upregulates miR-146a expression by activating the NF-κB- signaling pathway, which eventually leads to the downregulation of the downstream targets CXCR4 and Smad4. As shown in Figure 5A, patients exhibited distinct patterns of miR-146a expression at diagnosis. After the first course of induction chemotherapy, the miR-146a expression levels tended to increase in these patients. Patients who achieved a CR were then divided into two groups according to their miR-146a expression levels before treatment. Those with values exceeding 2.93 were defined as Group I (n = 39), whereas those with values below 2.93 were defined as Group II (n = 39, Figure 5B). A comparison of the prognostic data between these different miR-146a expression groups is presented in Table 2. Compared with patients with high levels of miR-146a expression (Group I), those with lower levels (Group II) had higher rates of relapse and death and shorter OS and RFS durations.Table 2Clinical features and laboratory findings comparison between different groups according to miR-146a expressionGroup IGroup IIp valueNo. of patients3939–Median miR-146a, ΔΔdi (range)5.19 (2.97–21.37)1.33 (0.54–2.89)<0.01Median age, years (range)56 (45–70)53 (46–73)0.32Median WBC count, ssi9/L(range)8.08 (0.9–11.48)7.7 (1.61–10.5)0.61Median LDH level, U/L (range)240 (91–2230)357 (133–6548)0.182Unfavorable cytogenetics, %4 (10.3)6 (15.4)0.7971Relapses, %6 (15.4)15 (38.5)0.022FLT3-ITD mutation2 (5.1)5 (12.8)0.241CEBPA mutation5 (12.8)4 (10.3)0.727Total deaths, %9 (23.1)23 (59)<0.01Mean OS, months (SEM)21.6 (4.2)20.8 (4.2)0.901Mean relapse-free survival, months (SEM)20.2 (3.54)18.6 (4.07)0.770 Open table in a new tab To determine the prognostic effect of the miR-146a levels in AML cells, we evaluated OS and RFS with respect to all included prognostic parameters using the Kaplan–Meier protocol. Figure 6A presents the prognostic effect of the miR-146a levels in AML cells, we evaluated OS and RFS with respect to log–rank test and generalized Wilcoxon test (Table 3). As expected, the associations of sex, high WBC counts, FLT3-internal tandem duplication mutation positivity, and cytogenetic abnormalities did not reach statistical significance. However, older age, high lactate dehydrogenase (LDH) value, and low level of miR-146a expression correlated with a poor prognosisTable 3p values for measuring effects of possible prognostic factors on OSp valuePrognostic markerLog–rank testWilcoxon testmiR-146a0.01580.0677Age0.00280.0014Sex0.60770.8249Abnormal cytogenetics0.85320.6366LDH level0.05300.0448WBC count0.10250.2031FLT3/ITD mutation0.06970.3740CEBPA mutation0.75300.8453 Open table in a new tab In our study, we found that the primary leukemia cells of some patients who exhibited little molecular response to CAG treatment did not exhibit obvious miR-146a upregulation. Therefore, we divided all 78 patients into two groups according to their miR-146a expression levels after the first course of chemotherapy. Patients exhibiting significant increases in miR-146a expression were classified as miR-146a-Sen (37 patients); the others were classified as miR-146a-nonSen (41 patients, Figure 5C). The clinical characteristics of the two groups are shown in Table 4. As shown in Figure 6B, we found that patients sensitive toG-CSF treatment had relatively high miR-146a levels and significantly longer OS and RFS durations (p = 0.0043 and p = 0.0034, respectively).Table 4Clinical features and laboratory findings comparison between groups according to miR-146a expression range on G-CSF treatmentmiR-146a-SenmiR-146a-nonSenp valueNo. of patients3741-Alive, %28 (75.7)18 (43.9)0.004Median age, years (range)61 (45–73)58 (47–70)0.329Median WBC count, and9/L (range)5.86 (1.11–11.48)7.32 (0.9–10.53)0.003Median LDH level, U/L (range)260 (91–776)527 (138–6548)0.007Unfavorable gene mutation, n360.374Relapses, %4 (10.8)17 (41.5)0.002 Open table in a new tab To define the prognostic significance of the observed correlations of disease outcome with molecular sensitivity to G-CSF treatment, as well as the prognostic relevance of other parameters such as sex, age, WBC count, LDH, cytogenetic abnormalities, and miR-146a expression, we performed a multivariate Cox regression analysis (Table 5). We identified miR-146a expression, age, and the miR-146a response to G-CSF treatment as significant predictive factors for OS and potential risk factors for relapse. A multivariate Cox proportional hazards analysis of miR-146a expression and other prognostic markers as predictors of the time from diagnosis to relapse or death yielded hazard ratios of 0.730 for OS and 0.728 for RFS in association with miR-146a expression.Table 5Results of multivariate Cox regression analysisMultivariateVariableHR95%CIpOS miR-146a0.7300.567–0.9410.015 Sensitivity to G-CSF6.7352.263–20.0480.001 Age1.0381.005–1.0720.023 LDH level1.0000.999–1.0010.993 WBC count1.0040.996–1.0130.337 FLT3-ITD mutation0.8600.344–2.1490.746RFS miR-146a0.7280.565–0.9380.014 Sensitivity to G-CSF6.6772.235–19.9510.001 Age1.0351.002–1.0680.036 LDH level1.0000.999–1.0010.967 WBC count1.0040.995–1.0120.377 FLT3-ITD mutation0.9300.371–2.3290.877 Open table in a new tab To investigate whether G-CSF priming therapy could reverse an adverse prognosis and achieve a long-term cure by upregulating miR-146a expression, we further divided Group II into Groups II1 and II2, which, respectively, comprised patients with high and low miR-146a levels after chemotherapy (Figure 5D). Figure 6C presents the OS and RFS associated with miR-146a expression in these subgroups. Specifically, patients with elevated levels of miR-146a expression after treatment had a better OS and RFS compared with those with persistently low miR-146a levels (p = 0.0290 for OS and p = 0.0296 for RFS). We conclude that patients exhibiting miR-146a upregulation after G-CSF treatment could also benefit from G-CSF priming chemotherapy. Accordingly, miR-146a might be considered a molecular indicator of chemosensitivity among AML patients. During treatment planning, the risk stratification of patients with AML remains challenging, especially among those with normal karyotypes. In addition to patient-dependent factors, pretreatment cytogenetic and molecular abnormalities (e.g., NPM1, CE" @default.
• W2890722171 created "2018-09-27" @default.
• W2890722171 creator A5008206344 @default.
• W2890722171 creator A5009149585 @default.
• W2890722171 creator A5022526821 @default.
• W2890722171 creator A5031545246 @default.
• W2890722171 creator A5038709939 @default.
• W2890722171 creator A5050351309 @default.
• W2890722171 creator A5057117256 @default.
• W2890722171 creator A5087407670 @default.
• W2890722171 creator A5090596512 @default.
• W2890722171 date "2018-12-01" @default.
• W2890722171 modified "2023-10-18" @default.
• W2890722171 title "Upregulated microRNA-146a expression induced by granulocyte colony-stimulating factor enhanced low-dosage chemotherapy response in aged acute myeloid leukemia patients" @default.
• W2890722171 cites W1094448410 @default.
• W2890722171 cites W1978324270 @default.
• W2890722171 cites W1980952112 @default.
• W2890722171 cites W1982432532 @default.
• W2890722171 cites W1988356885 @default.
• W2890722171 cites W1989457547 @default.
• W2890722171 cites W2000213929 @default.
• W2890722171 cites W2000980282 @default.
• W2890722171 cites W2027364921 @default.
• W2890722171 cites W2035614371 @default.
• W2890722171 cites W2040446110 @default.
• W2890722171 cites W2042728323 @default.
• W2890722171 cites W2043634641 @default.
• W2890722171 cites W2052215513 @default.
• W2890722171 cites W2056761639 @default.
• W2890722171 cites W2058188142 @default.
• W2890722171 cites W2058792589 @default.
• W2890722171 cites W2075860675 @default.
• W2890722171 cites W2091552147 @default.
• W2890722171 cites W2092296376 @default.
• W2890722171 cites W2100766766 @default.
• W2890722171 cites W2109065151 @default.
• W2890722171 cites W2113262521 @default.
• W2890722171 cites W2113472355 @default.
• W2890722171 cites W2117199255 @default.
• W2890722171 cites W2128959938 @default.
• W2890722171 cites W2148047805 @default.
• W2890722171 cites W2149888039 @default.
• W2890722171 cites W2193117853 @default.
• W2890722171 cites W2586853705 @default.
• W2890722171 cites W2766330759 @default.
• W2890722171 doi "https://doi.org/10.1016/j.exphem.2018.09.002" @default.
• W2890722171 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/30208330" @default.
• W2890722171 hasPublicationYear "2018" @default.
• W2890722171 type Work @default.
• W2890722171 sameAs 2890722171 @default.
• W2890722171 citedByCount "6" @default.
• W2890722171 countsByYear W28907221712019 @default.
• W2890722171 countsByYear W28907221712020 @default.
• W2890722171 countsByYear W28907221712022 @default.
• W2890722171 countsByYear W28907221712023 @default.
• W2890722171 crossrefType "journal-article" @default.
• W2890722171 hasAuthorship W2890722171A5008206344 @default.
• W2890722171 hasAuthorship W2890722171A5009149585 @default.
• W2890722171 hasAuthorship W2890722171A5022526821 @default.
• W2890722171 hasAuthorship W2890722171A5031545246 @default.
• W2890722171 hasAuthorship W2890722171A5038709939 @default.
• W2890722171 hasAuthorship W2890722171A5050351309 @default.
• W2890722171 hasAuthorship W2890722171A5057117256 @default.
• W2890722171 hasAuthorship W2890722171A5087407670 @default.
• W2890722171 hasAuthorship W2890722171A5090596512 @default.
• W2890722171 hasBestOaLocation W28907221711 @default.
• W2890722171 hasConcept C104317684 @default.
• W2890722171 hasConcept C126322002 @default.
• W2890722171 hasConcept C127561419 @default.
• W2890722171 hasConcept C143998085 @default.
• W2890722171 hasConcept C145059251 @default.
• W2890722171 hasConcept C203014093 @default.
• W2890722171 hasConcept C2776694085 @default.
• W2890722171 hasConcept C2777767877 @default.
• W2890722171 hasConcept C2777983669 @default.
• W2890722171 hasConcept C2778461978 @default.
• W2890722171 hasConcept C2778729363 @default.
• W2890722171 hasConcept C2779282312 @default.
• W2890722171 hasConcept C502942594 @default.
• W2890722171 hasConcept C55493867 @default.
• W2890722171 hasConcept C71924100 @default.
• W2890722171 hasConcept C86803240 @default.
• W2890722171 hasConceptScore W2890722171C104317684 @default.
• W2890722171 hasConceptScore W2890722171C126322002 @default.
• W2890722171 hasConceptScore W2890722171C127561419 @default.
• W2890722171 hasConceptScore W2890722171C143998085 @default.
• W2890722171 hasConceptScore W2890722171C145059251 @default.
• W2890722171 hasConceptScore W2890722171C203014093 @default.
• W2890722171 hasConceptScore W2890722171C2776694085 @default.
• W2890722171 hasConceptScore W2890722171C2777767877 @default.
• W2890722171 hasConceptScore W2890722171C2777983669 @default.
• W2890722171 hasConceptScore W2890722171C2778461978 @default.
• W2890722171 hasConceptScore W2890722171C2778729363 @default.
• W2890722171 hasConceptScore W2890722171C2779282312 @default.
• W2890722171 hasConceptScore W2890722171C502942594 @default.
• W2890722171 hasConceptScore W2890722171C55493867 @default.
• W2890722171 hasConceptScore W2890722171C71924100 @default.
• W2890722171 hasConceptScore W2890722171C86803240 @default.

• next