FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2893585798> ?p ?o ?g. }

• W2893585798 endingPage "57" @default.
• W2893585798 startingPage "44" @default.
• W2893585798 abstract "ApoA-I and ABCA1 play important roles in nascent HDL (nHDL) biogenesis, the first step in the pathway of reverse cholesterol transport that protects against cardiovascular disease. On the basis of the crystal structure of a C-terminally truncated form of apoA-I[Δ(185-243)] determined in our laboratory, we hypothesized that opening the N-terminal helix bundle would facilitate lipid binding. To that end, we structurally designed a mutant (L38G/K40G) to destabilize the N-terminal helical bundle at the first hinge region. Conformational characterization of this mutant in solution revealed minimally reduced α-helical content, a less-compact overall structure, and increased lipid-binding ability. In solution-binding studies, apoA-I and purified ABCA1 also showed direct binding between them. In ABCA1-transfected HEK293 cells, L38G/K40G had a significantly enhanced ability to form nHDL, which suggests that a destabilized N-terminal bundle facilitates nHDL formation. The total cholesterol efflux from ABCA1-transfected HEK293 cells was unchanged in mutant versus WT apoA-I, though, which suggests that cholesterol efflux and nHDL particle formation might be uncoupled events. Analysis of the particles in the efflux media revealed a population of apoA-I-free lipid particles along with nHDL. This model improves knowledge of nHDL formation for future research. ApoA-I and ABCA1 play important roles in nascent HDL (nHDL) biogenesis, the first step in the pathway of reverse cholesterol transport that protects against cardiovascular disease. On the basis of the crystal structure of a C-terminally truncated form of apoA-I[Δ(185-243)] determined in our laboratory, we hypothesized that opening the N-terminal helix bundle would facilitate lipid binding. To that end, we structurally designed a mutant (L38G/K40G) to destabilize the N-terminal helical bundle at the first hinge region. Conformational characterization of this mutant in solution revealed minimally reduced α-helical content, a less-compact overall structure, and increased lipid-binding ability. In solution-binding studies, apoA-I and purified ABCA1 also showed direct binding between them. In ABCA1-transfected HEK293 cells, L38G/K40G had a significantly enhanced ability to form nHDL, which suggests that a destabilized N-terminal bundle facilitates nHDL formation. The total cholesterol efflux from ABCA1-transfected HEK293 cells was unchanged in mutant versus WT apoA-I, though, which suggests that cholesterol efflux and nHDL particle formation might be uncoupled events. Analysis of the particles in the efflux media revealed a population of apoA-I-free lipid particles along with nHDL. This model improves knowledge of nHDL formation for future research. Cardiovascular diseases remain the leading cause of death in the US and other developed countries today (1Mozaffarian D. Benjamin E.J. Go A.S. Arnett D.K. Blaha M.J. Cushman M. de Ferranti S. Després J-P. Fullerton H.J. Howard V.J. et al.American Heart Association Statistics Committee and Stroke Statistics Subcommittee.Heart disease and stroke statistics–2015 update: a report from the American Heart Association. 2015; 131: e29-e322Google Scholar). HDL has long been known to have a cardio-protective effect due to its role in the reverse cholesterol transport pathway (2Asztalos B.F. Cupples L.A. Demissie S. Horvath K.V. Cox C.E. Batista M.C. Schaefer E.J. High-density lipoprotein subpopulation profile and coronary heart disease prevalence in male participants of the Framingham Offspring Study.Arterioscler. Thromb. Vasc. Biol. 2004; 24: 2181-2187Crossref PubMed Scopus (262) Google Scholar, 3Asztalos B.F. Collins D. Cupples L.A. Demissie S. Horvath K.V. Bloomfield H.E. Robins S.J. Schaefer E.J. Value of high-density lipoprotein (HDL) subpopulations in predicting recurrent cardiovascular events in the Veterans Affairs HDL Intervention Trial.Arterioscler. Thromb. Vasc. Biol. 2005; 25: 2185-2191Crossref PubMed Scopus (239) Google Scholar). During reverse cholesterol transport, HDL delivers excess peripheral cholesterol to the liver, thus preventing the formation of foam cells that may ultimately lead to atherosclerosis (4Assmann G. Gotto A.M. HDL cholesterol and protective factors in atherosclerosis.Circulation. 2004; 109: III8-III14Crossref PubMed Google Scholar). The first step in HDL formation involves the interaction between apoA-I and ABCA1 (5Tall A.R. An overview of reverse cholesterol transport.Eur. Heart J. 1998; 19 (Suppl. A): A31-A35PubMed Google Scholar). Mutations in ABCA1 lead to Tangier disease, which results in an enlarged spleen and liver, yellow tonsils, <5% normal plasma HDL level, and premature coronary artery disease (6Serfaty-Lacrosniere C. Civeira F. Lanzberg A. Isaia P. Berg J. Janus E.D. Smith Jr., M.P. Pritchard P.H. Frohlich J. Lees R.S. et al.Homozygous Tangier disease and cardiovascular disease.Atherosclerosis. 1994; 107: 85-98Abstract Full Text PDF PubMed Scopus (216) Google Scholar, 7Rust S. Rosier M. Funke H. Real J. Amoura Z. Piette J.C. Deleuze J.F. Brewer H.B. Duverger N. Denèfle P. et al.Tangier disease is caused by mutations in the gene encoding ATP-binding cassette transporter 1.Nat. Genet. 1999; 22: 352-355Crossref PubMed Scopus (1264) Google Scholar). Mutations in apoA-I are also associated with premature coronary artery disease (8von Eckardstein A. Nofer J.R. Assmann G. High density lipoproteins and arteriosclerosis. Role of cholesterol efflux and reverse cholesterol transport.Arterioscler. Thromb. Vasc. Biol. 2001; 21: 13-27Crossref PubMed Scopus (645) Google Scholar). In this first step, apoA-I recruits effluxed lipid promoted by ABCA1 and makes discoidal nascent HDL (nHDL) particles (5Tall A.R. An overview of reverse cholesterol transport.Eur. Heart J. 1998; 19 (Suppl. A): A31-A35PubMed Google Scholar, 9Landry Y.D. Denis M. Nandi S. Bell S. Vaughan A.M. Zha X. ATP-binding cassette transporter A1 expression disrupts raft membrane microdomains through its ATPase-related functions.J. Biol. Chem. 2006; 281: 36091-36101Abstract Full Text Full Text PDF PubMed Scopus (184) Google Scholar, 10Fielding P.E. Nagao K. Hakamata H. Chimini G. Fielding C.J. A two-step mechanism for free cholesterol and phospholipid efflux from human vascular cells to apolipoprotein A-1.Biochemistry. 2000; 39: 14113-14120Crossref PubMed Scopus (183) Google Scholar, 11Rigot V. Distinct sites on ABCA1 control distinct steps required for cellular release of phospholipids.J. Lipid Res. 2002; 43: 2077-2086Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar, 12Hamon Y. Broccardo C. Chambenoit O. Luciani M.F. Toti F. Chaslin S. Freyssinet J.M. Devaux P.F. McNeish J. Marguet D. et al.ABC1 promotes engulfment of apoptotic cells and transbilayer redistribution of phosphatidylserine.Nat. Cell Biol. 2000; 2: 399-406Crossref PubMed Scopus (464) Google Scholar, 13Vedhachalam C. Duong P.T. Nickel M. Nguyen D. Dhanasekaran P. Saito H. Rothblat G.H. Lund-Katz S. Phillips M.C. Mechanism of ATP-binding cassette transporter A1-mediated cellular lipid efflux to apolipoprotein A-I and formation of high density lipoprotein particles.J. Biol. Chem. 2007; 282: 25123-25130Abstract Full Text Full Text PDF PubMed Scopus (285) Google Scholar, 14Fitzgerald M.L. Morris A.L. Chroni A. Mendez A.J. Zannis V.I. Freeman M.W. ABCA1 and amphipathic apolipoproteins form high-affinity molecular complexes required for cholesterol efflux.J. Lipid Res. 2004; 45: 287-294Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar). However, the detailed molecular mechanism underlying this process has remained unclear. In previous work, we determined the structure of a C-terminally truncated apoA-I, apoA-I[Δ(185-243)], in a dimeric form (15Mei X. Atkinson D. Crystal structure of C-terminal truncated apolipoprotein A-I reveals the assembly of high density lipoprotein (HDL) by dimerization.J. Biol. Chem. 2011; 286: 38570-38582Abstract Full Text Full Text PDF PubMed Scopus (158) Google Scholar). In this structure, the N-terminal region forms a helix-bundle, stabilized by a cluster of hydrophobic residues. These aromatic clusters [W8, F71, and W72 (from one apoA-I molecule) and F33, F104, and W108 (from the symmetry-related molecule)] together with π-cation interactions (K23-W50 and W8-R61) are major forces that hold the helical bundle together (15Mei X. Atkinson D. Crystal structure of C-terminal truncated apolipoprotein A-I reveals the assembly of high density lipoprotein (HDL) by dimerization.J. Biol. Chem. 2011; 286: 38570-38582Abstract Full Text Full Text PDF PubMed Scopus (158) Google Scholar, 16Mei X. Atkinson D. Lipid-free apolipoprotein A-I structure: insights into HDL formation and atherosclerosis development.Arch. Med. Res. 2015; 46: 351-360Crossref PubMed Scopus (48) Google Scholar). However, on discoidal nHDL particles, the helices are thought to be extended with two apoA-I molecules forming a double-belt structure (17Phillips M.C. New insights into the determination of HDL structure by apolipoproteins.J. Lipid Res. 2013; 54: 2034-2048Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar). We suggested that one step in the opening of the helical bundle occurs at the hinge region A37-Q41 (16Mei X. Atkinson D. Lipid-free apolipoprotein A-I structure: insights into HDL formation and atherosclerosis development.Arch. Med. Res. 2015; 46: 351-360Crossref PubMed Scopus (48) Google Scholar), which shows high flexibility (temperature factor) as revealed by the crystal structure. In this study, we designed an N-terminus destabilized mutant of apoA-I by perturbing the first hinge region at A37-Q41. Mutation of each residue flanking G39 to a glycine residue (L38G/K40G) (Fig. 1) resulted in tandem triple Gly (3× Gly), which, due to highly unconstrained ψ, φ angles, can act as a helix breaker (18Chou P.Y. Fasman G.D. Prediction of the secondary structure of proteins from their amino acid sequence.Adv. Enzymol. Relat. Areas Mol. Biol. 1978; 47: 45-148PubMed Google Scholar). We hypothesized that the unconstrained hinge would open more freely and the buried hydrophobic core would be readily accessible to lipid molecules. During nHDL biogenesis, it is controversial whether apoA-I interacts directly with ABCA1. Vedhachalam et al. (13Vedhachalam C. Duong P.T. Nickel M. Nguyen D. Dhanasekaran P. Saito H. Rothblat G.H. Lund-Katz S. Phillips M.C. Mechanism of ATP-binding cassette transporter A1-mediated cellular lipid efflux to apolipoprotein A-I and formation of high density lipoprotein particles.J. Biol. Chem. 2007; 282: 25123-25130Abstract Full Text Full Text PDF PubMed Scopus (285) Google Scholar) suggested that apoA-I binds to ABCA1 first, and activates ABCA1 to move lipids from the inner leaflet to the outer leaflet of the plasma membrane forming a bulge-like structure to release surface tension. This structure was considered essential for apoA-I to bind and form nHDL. Vaughan, Tang, and Oram (19Vaughan A.M. Tang C. Oram J.F. ABCA1 mutants reveal an interdependency between lipid export function, apoA-I binding activity, and Janus kinase 2 activation.J. Lipid Res. 2009; 50: 285-292Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar) suggested that there is no direct interaction between apoA-I and ABCA1, but rather lipids only get loaded to apoA-I through passive diffusion. The only evidence for a direct interaction between apoA-I and ABCA1 has been cross-linking-based studies (20Chroni A. Liu T. Fitzgerald M.L. Freeman M.W. Zannis V.I. Cross-linking and lipid efflux properties of apoA-I mutants suggest direct association between apoA-I helices and ABCA1.Biochemistry. 2004; 43: 2126-2139Crossref PubMed Scopus (95) Google Scholar). Thus, to investigate further whether there is directed interaction between the two proteins, we extracted and solubilized ABCA1 from HEK293 cells overexpressing ABCA1 and tested the interaction between purified ABCA1 and purified apoA-I in solution. We demonstrated, for the first time, that there is a direct interaction between apoA-I and ABCA1. Dimyristoyl phosphatidylcholine (DMPC) and 8-anilino-1-naphthalenesulfonate (ANS) were purchased from Sigma. DH5α competent cells were purchased from NEB. Complete EDTA-free protease-inhibitor cocktail was purchased from Roche. DMEM, FBS, penicillin, and streptomycin were purchased from Invitrogen. Bovine serum albumin, methyl-β-cyclodextrin, and HRP-conjugated antibodies to goat and mouse were purchased from Sigma. BODIPY-cholesterol (TopFluor) was purchased from Avanti. GenJet was purchased from SignaGen Laboratories. Polyethylenimine (MW 25,000 linear) and amphipol 8-35 were purchased from Polysciences. Rhodopsin 1d4 (rho1d4)-tag antibody beads and eluting peptide were purchased from Cube Biotech. TMB was purchased from Sigma. ApoA-I polyclonal goat antibody was from Abcam. ABCA1 mouse monoclonal antibody was from Gateway. Anti-lactate dehydrogenase (LDH) and anti-flotillin-2 mouse monoclonal antibody were from Santa Cruz Biotechnology. Denville Blue protein stain was purchased from Denville Scientific. The ATPase activity kit was purchased from Innova Biosciences. The AmplexRed cholesterol kit was purchased from Thermo Fisher. pcDNA1 containing the human ABCA1 gene was a generous gift from Dr. Freeman's laboratory at Harvard. A rho1d4 tag (T-E-T-S-Q-V-A-P-A) was added to the C terminus of ABCA1 using the Q5 site-directed mutagenesis kit from New England Biolabs. Primers used for making this construct were: forward, GTGGCGCCGGCGTGAATCCTGTTCATACGGGG; reverse, CTGGCTG­GTTTCGGTTAATACATAGCTTTCTTTCACTTTC. Refolded apoA-I and mutant proteins were placed in 1 or 2 mm quartz cuvettes for the experiments. Data were recorded on Aviv 62DS or Aviv 215 spectropolarimeters (Aviv Associates, Lakewood, NJ). Freshly refolded proteins at a concentration of ∼0.02–0.2 mg/ml [below the self-association concentration of apoA-I as characterized in previous studies (21Gorshkova I.N. Liadaki K. Gursky O. Atkinson D. Zannis V.I. Probing the lipid-free structure and stability of apolipoprotein A-I by mutation.Biochemistry. 2000; 39: 15910-15919Crossref PubMed Scopus (45) Google Scholar)] in 10 mM phosphate buffer (pH 7.4) at 25°C were used in these experiments. For far-UV spectra, wavelengths of 250–185 nm were scanned with 1 nm bandwidth, 1 nm step size, and 5 s accumulation time at 25°C. Each sample was scanned three times. The phosphate buffer baseline was subtracted for later calculations. The α-helical content was calculated as follows: α-helix% = (−[θ222] + 3,000)/39,000 (22Woody R.W. Theory of circular dichroism of proteins. In Cir­cular Dichroism and the Conformational Analysis of Biomolecules. G. D. Fasman, Springer US, Boston, MA1996: 25-67Google Scholar). For thermal unfolding experiments, the ellipticity of protein samples at 222 nm was monitored from 5°C to 95°C with 1°C step size and 90 s accumulation time for each data point. Melting temperature was derived from the peak of the first derivative of the thermal unfolding curve calculated using the Origin software (MicroCal). DMPC (10 mg) was dissolved in a glass tube in chloroform:methanol (2:1) and then dried under nitrogen and left in a desiccator at 4°C for 20–24 h to remove the residual solvent. An aliquot of 2 ml of PBS was added to the tube and the solution was vigorously vortexed. An aliquot of 50 μl of stock solution (5 mg/ml) was mixed with 1 ml 0.1 mg/ml WT or mutant forms of apoA-I pre-equilibrated at 24°C to give a 2.5:1 (w:w) lipid to protein ratio, respectively. The rate of DMPC clearance by WT and mutant forms of apoA-I was monitored by the change of the turbidity of the solution (absorbance at 325 nm) at 24°C for 1 h. The plot of absorbance at 325 nm versus time (min) was recorded. The ANS fluorescence binding assays were performed on a fluroMax-2 fluorescence spectrometer (Instruments S.A. Inc.) at 25°C. The excitation slit width was 5 nm and the emission slit width was 2.5 nm. ANS fluorescence emission was recorded at a concentration 0.25 mM in the presence of mutant L38G/K40G or WT apoA-I at 0.05 mg/ml in 5 mM phosphate buffer (pH 7.4). ANS fluorescence was excited at 395 nm and the emission spectra were recorded from 400 to 580 nm. HEK293 cells were plated at 60–70% confluence in 24-well collagen-coated plates in growth media [DMEM (low glucose) supplemented with 10% FBS, 100 U/ml penicillin, and 100 μg/ml streptomycin]. After 20–24 h incubation, the cells were transiently transfected with pcDNA1 containing human ABCA1 cDNA or pcDNA1 alone [empty vector (EV), as a negative control]. For each well, 0.8 μg of DNA was transfected. Twenty-four hours post transfection, BODIPY-cholesterol (1 μM) solubilized in DMSO or mixed with cholesterol (24 μg/ml)/methyl-β-cyclodextrin complex was added to the cells and incubated for 1 h (23Sankaranarayanan S. Kellner-Weibel G. de la Llera-Moya M. Phillips M.C. Asztalos B.F. Bittman R. Rothblat G.H. A sensitive assay for ABCA1-mediated cholesterol efflux using BODIPY-cholesterol.J. Lipid Res. 2011; 52: 2332-2340Abstract Full Text Full Text PDF PubMed Scopus (158) Google Scholar, 24Cho W. Kang J.L. Park Y.M. Corticotropin-releasing hormone (CRH) promotes macrophage foam cell formation via reduced expression of ATP binding cassette transporter-1 (ABCA1).PLoS One. 2015; 10: e0130587PubMed Google Scholar, 25Mao M. Lei H. Liu Q. Chen Y. Zhao L. Li Q. Luo S. Zuo Z. He Q. Huang W. et al.Effects of miR-33a-5P on ABCA1/G1-mediated cholesterol efflux under inflammatory stress in THP-1 macrophages.PLoS One. 2014; 9: e109722Crossref PubMed Scopus (36) Google Scholar, 26Zhang N. Lei J. Lei H. Ruan X. Liu Q. Chen Y. Huang W. MicroRNA-101 overexpression by IL-6 and TNF-α inhibits cholesterol efflux by suppressing ATP-binding cassette transporter A1 expression.Exp. Cell Res. 2015; 336: 33-42Crossref PubMed Scopus (56) Google Scholar, 27Rohatgi A. Khera A. Berry J.D. Givens E.G. Ayers C.R. Wedin K.E. Neeland I.J. Yuhanna I.S. Rader D.R. de Lemos J.A. et al.HDL cholesterol efflux capacity and incident cardiovascular events.N. Engl. J. Med. 2014; 371: 2383-2393Crossref PubMed Scopus (970) Google Scholar). BODIPY-cholesterol solubilized in DMSO was used to label cells with basal level cholesterol, while cholesterol/methyl-β-cyclodextrin/BODIPY-cholesterol complexes were used to label cells with elevated cholesterol. This treatment elevated the cholesterol level in the cells by 13.6 ± 1.3%. Measurement of cholesterol level was achieved using AmplexRed cholesterol kit according to manufacturer's instructions. Cells were then washed with DMEM and incubated with 4–10 μg/ml apoA-I or L38G/K40G mutant. Albumin at a concentration of 0.01% [a molar ratio of 8:1 to apoA-I (5 μg/ml) added] was used as a negative control. Media were collected after incubation for 20–24 h. For kinetic studies, 50 μl of media were collected at either 0, 2.5, 5, 7.5, 10, and 24 h or 4, 8, 12, and 24 h. Data at 4 and 5 h were combined into 4.5 h and data at 7.5 and 8 h were combined into 8 h time points. The conditioned media were filtered through a 0.22 μm membrane to remove cell debris and the cells were lysed with 1% sodium cholate at room temperature (25°C) for 4 h. Fluorescence in both media and cells was measured with a Tecan Infinite M1000 plate reader at excitation wavelength 490 nm (bandwidth 10 nm) and emission wavelength 520 nm (bandwidth 20 nm). Fluorescence derived from EV-transfected cells was subtracted to obtain the baseline. The percentage efflux was calculated by taking the fraction of fluorescence in the media over total fluorescence in both the media and the cells. nHDL formation was detected by immunoblotting following a 4–15% gradient native PAGE where membranes were probed with anti-apoA-I polyclonal antibody. nHDL bands were quantified using either ImageJ or Image Studio Lite. The ABCA1 level was determined by SDS-PAGE followed by immunoblotting using antibodies to ABCA1. The same membrane was subsequently probed with antibodies to actin, which served as loading control. Efflux media were collected and filtered as described above. For density gradient fractionation, solid KBr was added to the media and mixed thoroughly to reach a density of 1.25 g/ml. The media were then overlaid with 1.05 g/ml KBr. The samples were spun in a SW41 rotor at 190,000 g at 11°C for 24 h. One milliliter fractions were collected from the top and density determined using an Abbe refractometer (American Optical Corp.). Fluorescence was measured in a Tecan Infinite M1000 plate reader for cholesterol content. ApoA-I and the ganglioside, monosialotetrahexosylganglioside (GM1), were analyzed by dot blotting or by 4–15% gradient native-PAGE followed by immuno­blotting and ligand blotting, respectively. For non-gradient separation, efflux media were adjusted to 1.21 g/ml with KBr and ultracentrifuged in SW41 rotor at 39,000 rpm at 11°C for 24 h. After ultracentrifugation, all lipid-containing particles were in the top 2 ml fraction. The lipid composition of this fraction was analyzed by TLC. After ultracentrifugation, lipids were extracted as described (28Bligh E.G. Dyer W.J. A rapid method of total lipid extraction and purification.Can. J. Biochem. Physiol. 1959; 37: 911-917Crossref PubMed Scopus (42694) Google Scholar). The chloroform phase was dried under nitrogen. Lipids were dissolved in 40–50 μl of chloroform and loaded on a TLC plate. The plate was first developed to 25% in a polar system with solvent composition CHCl3:methanol:water:acetic acid (65:25:4:1) and then a neutral system with solvent composition hexane:diethylether:acetic acid (70:30:1). The plate was exposed to iodine vapors to visualize the lipids. Carbon-coated grids were glow-discharged before use. Four microliter aliquots from ultracentrifugation fractions were loaded onto the grid and incubated for 5 min and then blotted with filter paper. The grid was rinsed with Tris-buffered saline 10 times. Freshly prepared uranyl acetate (1%) stain was applied and incubated for 10 s, twice. Excess stain was blotted and the grid was air-dried for 3 min. The grids were observed in the CM12 electron microscope (Philips Electron Optics, Eindhoven, The Netherlands). HEK293 cells were plated in 24-well collagen-coated plates and transfected as described. Forty-eight hours post transfection, cells were incubated with 5 μg/ml apoA-I for 30 min at 37°C followed by 30 min at 4°C. For cholesterol-elevated cells, cholesterol (24 μg/ml)/methyl-β-cyclodextrin complex was added to the cells for 1 h at 37°C before apoA-I addition. Cells were washed twice with ice-cold PBS. Paraformaldehyde (2.5%) was added and cells incubated at room temperature for 30 min. The cells were then washed with PBS three times and incubated at 37°C for 30 min with 5% nonfat milk in PBS to block nonspecific binding of antibodies. Goat anti-apoA-I polyclonal antibodies were added and incubated at room temperature for 1 h. After washing three times with PBS, HRP-conjugated antibody to goat IgGs was added and cells incubated at room temperature for 1 h. After three washes with PBS, The TMB was added and incubated for 30 min. After TMB incubation, the solution was supplemented with 3 M H2SO4 (final concentration 1.5 M) to stop the reaction. The solution then turned yellow. Absorbance at 450 nm was determined in a Tecan Infinite M1000 plate reader. ApoA-I proteins were expressed and purified as described previously (15Mei X. Atkinson D. Crystal structure of C-terminal truncated apolipoprotein A-I reveals the assembly of high density lipoprotein (HDL) by dimerization.J. Biol. Chem. 2011; 286: 38570-38582Abstract Full Text Full Text PDF PubMed Scopus (158) Google Scholar, 29Mei X. Liu M. Herscovitz H. Atkinson D. Probing the C-terminal domain of lipid-free apoA-I demonstrates the vital role of the H10B sequence repeat in HDL formation.J. Lipid Res. 2016; 57: 1507-1517Abstract Full Text Full Text PDF PubMed Scopus (16) Google Scholar). For ABCA1 purification, HEK293F cells were grown in Freestyle Expression medium (Invitrogen) in 1 liter rotating flasks at 130 rpm, 8% CO2, 37°C. Once cell density reached 2.5 × 106 cells/ml, the cells were transfected with 3 μg ABCA1-rho DNA and 9 μg polyethylenimine per 1 ml of cell culture. Twenty-four hours post transfection, the culture was supplemented with 2 mM valproic acid to help stabilize protein expression (30Backliwal G. Hildinger M. Kuettel I. Delegrange F. Hacker D.L. Wurm F.M. Valproic acid: a viable alternative to sodium butyrate for enhancing protein expression in mammalian cell cultures.Biotechnol. Bioeng. 2008; 101: 182-189Crossref PubMed Scopus (127) Google Scholar). Forty-eight hours post transfection, cells were harvested and lysed with ice-cold HEPES (10 mM, pH 7.5) hypotonic buffer supplemented with protease inhibitor cocktail (Roche) using a Dounce homogenizer. Cell lysates were first centrifuged at 10,000 g to remove cell debris and nuclei, and then centrifuged at 100,000 g for 40 min to pellet membranes. The membrane pellet was resuspended in 50 mM HEPES, 150 mM NaCl, 2 mM TCEP (pH 7.5), and 1% (w/v) n-dodecyl-β-D-maltoside (DDM) and gently agitated for 1 h. This suspension was centrifuged at 100,000 g for 40 min and the supernatant was collected. The supernatant was incubated with rho1d4 antibody-conjugated agarose beads for 20–24 h. The beads were then washed twice with 10× bed volume of wash buffer [50 mM HEPES, 150 mM NaCl, 2 mM TCEP (pH 7.5), and 0.02% DDM]. For DDM-solubilized ABCA1, the protein was eluted with three fractions of elution buffer [50 mM HEPES, 150 mM NaCl (pH 7.5), and 0.02% DDM, with 500 μM rho1d4 peptide] for 1 h each at 4°C. For amphipol-solubilized ABCA1, DDM was substituted with amphipol 8-35 (ABCA1:amphipol = 1:3 w:w) for 1 h at room temperature followed by 1 h at 4°C. The beads were washed three times with 10× bed volume wash buffer without DDM. ABCA1-rho was eluted by 50 mM HEPES and 150 mM NaCl (pH 7.5), with 500 μM rho1d4 peptide for 1 h per fraction. Three fractions were collected. Bis(sulfosuccinimidyl)suberate (5 mM) in 25 mM phosphate buffer (pH 7.4) was incubated with 100 μg/ml DDM-solubilized ABCA1 or apoA-I at room temperature for 1 h. The cross-linking reaction was stopped by the addition of 25 mM Tris buffer for 15 min at room temperature. Proteins were then resolved on SDS-PAGE at 200 V for 45 min followed by immunoblotting and membrane probed by anti-ABCA1 and anti-apoA-I antibody. The ATPase activity was measured by Innova Biosciences' ATPase activity kit. The content of phosphate released from ATP molecules was measured using a colorimetric method according to the manufacturer's protocol. Activity was determined by absorbance between 590 and 660 nm using a Tecan Infinite M1000 plate reader. After exchange for amphipol on the beads, 100–150 μg/ml of eluted ABCA1 was incubated with 10–15 μg/ml of apoA-I (1:1 molar ratio of apoA-I:ABCA1) at room temperature for 1 h. The concentration of apoA-I was the same as in the efflux assay and cross-linking experiments described. After 1 h incubation, samples were resolved on native-PAGE and analyzed by immunoblotting and membranes probed with anti-apoA-I antibody. The same blot was then stripped with stripping buffer (0.1 M glycine, pH 2) and probed again with anti-ABCA1 antibody. Figure 2A shows the far-UV circular dichroism (CD) spectra of mutant L38G/K40G and WT apoA-I. Both forms exhibited negative peaks at 222 and 208 nm, characteristic of α-helical structure. Based on the [θ]222 signal, the calculated α-helical content of WT was 54 ± 2%, consistent with previously reported helical content of WT apoA-I (21Gorshkova I.N. Liadaki K. Gursky O. Atkinson D. Zannis V.I. Probing the lipid-free structure and stability of apolipoprotein A-I by mutation.Biochemistry. 2000; 39: 15910-15919Crossref PubMed Scopus (45) Google Scholar). Helical content of L38G/K40G was similar to that of WT, 51 ± 2%. This result indicates that this mutation had minimally affected the helical content of the lipid-free apoA-I form, rather than perturbing the overall helical structure. Interestingly, for the L38G/K40G mutant, although the melting temperature remained the same as WT, at 62 ± 2°C, the thermal unfolding cooperativity decreased (more flattened curve, rather than a sigmoidal shape in WT shown in Fig. 2B), suggesting that although the protein's stability was not affected, it had become less compact. On binding to hydrophobic surfaces, intrinsic ANS fluorescence is enhanced and blue-shifted. Therefore, we used the ANS fluorescence assay to access the exposed hydrophobic surface of apoA-I and its mutant as described in previous work (15Mei X. Atkinson D. Crystal structure of C-terminal truncated apolipoprotein A-I reveals the assembly of high density lipoprotein (HDL) by dimerization.J. Biol. Chem. 2011; 286: 38570-38582Abstract Full Text Full Text PDF PubMed Scopus (158) Google Scholar, 21Gorshkova I.N. Liadaki K. Gursky O. Atkinson D. Zannis V.I. Probing the lipid-free structure and stability of apolipoprotein A-I by mutation.Biochemistry. 2000; 39: 15910-15919Crossref PubMed Scopus (45) Google Scholar). As shown in Fig. 2C, ANS alone in phosphate buffer had a very low-intensity emission at 518 nm. When WT apoA-I was added, the emission peak of ANS fluorescence blue shifted to 478 nm, and the intensity increased 6-fold. With mutant L38G/K40G, the emission peak was at 474 nm, and the intensity increased 10-fold. This finding suggested that mutant L38G/K40G has a larger exposed hydrophobic surface, indicative of a loosely packed structure, exposing the hydrophobic pocket in apoA-I buried within the helical bundle. Clearance of DMPC multilamellar vesicles provides a measure of the kinetics of mutant L38G/K40G and WT apoA-I to form DMPC-apoA-I complexes. This assay reflects the apoA-I lipid binding ability. As shown in Fig. 2D, the turbidity of DMPC multilamellar vesicles was reduced faster by L3" @default.
• W2893585798 created "2018-10-05" @default.
• W2893585798 creator A5007989071 @default.
• W2893585798 creator A5024374500 @default.
• W2893585798 creator A5034695786 @default.
• W2893585798 creator A5042465286 @default.
• W2893585798 date "2019-01-01" @default.
• W2893585798 modified "2023-10-17" @default.
• W2893585798 title "N-terminal mutation of apoA-I and interaction with ABCA1 reveal mechanisms of nascent HDL biogenesis" @default.
• W2893585798 cites W1591670239 @default.
• W2893585798 cites W1964094832 @default.
• W2893585798 cites W1966450809 @default.
• W2893585798 cites W1969668277 @default.
• W2893585798 cites W1978921170 @default.
• W2893585798 cites W1993012149 @default.
• W2893585798 cites W1996603800 @default.
• W2893585798 cites W2013132728 @default.
• W2893585798 cites W2021267305 @default.
• W2893585798 cites W2022619537 @default.
• W2893585798 cites W2024271923 @default.
• W2893585798 cites W2025155898 @default.
• W2893585798 cites W2026358730 @default.
• W2893585798 cites W2033299688 @default.
• W2893585798 cites W2051560414 @default.
• W2893585798 cites W2054680310 @default.
• W2893585798 cites W2056472930 @default.
• W2893585798 cites W2060181247 @default.
• W2893585798 cites W2060956030 @default.
• W2893585798 cites W2066313978 @default.
• W2893585798 cites W2066557706 @default.
• W2893585798 cites W2070060517 @default.
• W2893585798 cites W2071122867 @default.
• W2893585798 cites W2079948289 @default.
• W2893585798 cites W2080826271 @default.
• W2893585798 cites W2086716171 @default.
• W2893585798 cites W2095014740 @default.
• W2893585798 cites W2103507414 @default.
• W2893585798 cites W2107290681 @default.
• W2893585798 cites W2107768042 @default.
• W2893585798 cites W2109429564 @default.
• W2893585798 cites W2115220026 @default.
• W2893585798 cites W2116856926 @default.
• W2893585798 cites W2117471612 @default.
• W2893585798 cites W2121076428 @default.
• W2893585798 cites W2121354606 @default.
• W2893585798 cites W2125209926 @default.
• W2893585798 cites W2132804909 @default.
• W2893585798 cites W2133331493 @default.
• W2893585798 cites W2140312315 @default.
• W2893585798 cites W2150625048 @default.
• W2893585798 cites W2160230170 @default.
• W2893585798 cites W2165006892 @default.
• W2893585798 cites W2166492699 @default.
• W2893585798 cites W2261862398 @default.
• W2893585798 cites W2300552860 @default.
• W2893585798 cites W2423399237 @default.
• W2893585798 cites W2514953532 @default.
• W2893585798 cites W2578430805 @default.
• W2893585798 cites W2622325226 @default.
• W2893585798 cites W2781767669 @default.
• W2893585798 cites W381962402 @default.
• W2893585798 cites W803479915 @default.
• W2893585798 doi "https://doi.org/10.1194/jlr.m084376" @default.
• W2893585798 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/6314262" @default.
• W2893585798 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/30249788" @default.
• W2893585798 hasPublicationYear "2019" @default.
• W2893585798 type Work @default.
• W2893585798 sameAs 2893585798 @default.
• W2893585798 citedByCount "20" @default.
• W2893585798 countsByYear W28935857982019 @default.
• W2893585798 countsByYear W28935857982020 @default.
• W2893585798 countsByYear W28935857982021 @default.
• W2893585798 countsByYear W28935857982022 @default.
• W2893585798 countsByYear W28935857982023 @default.
• W2893585798 crossrefType "journal-article" @default.
• W2893585798 hasAuthorship W2893585798A5007989071 @default.
• W2893585798 hasAuthorship W2893585798A5024374500 @default.
• W2893585798 hasAuthorship W2893585798A5034695786 @default.
• W2893585798 hasAuthorship W2893585798A5042465286 @default.
• W2893585798 hasBestOaLocation W28935857981 @default.
• W2893585798 hasConcept C104317684 @default.
• W2893585798 hasConcept C131934819 @default.
• W2893585798 hasConcept C149011108 @default.
• W2893585798 hasConcept C185592680 @default.
• W2893585798 hasConcept C2777704780 @default.
• W2893585798 hasConcept C2779664074 @default.
• W2893585798 hasConcept C41008148 @default.
• W2893585798 hasConcept C501734568 @default.
• W2893585798 hasConcept C54355233 @default.
• W2893585798 hasConcept C70721500 @default.
• W2893585798 hasConcept C76155785 @default.
• W2893585798 hasConcept C86803240 @default.
• W2893585798 hasConceptScore W2893585798C104317684 @default.
• W2893585798 hasConceptScore W2893585798C131934819 @default.
• W2893585798 hasConceptScore W2893585798C149011108 @default.
• W2893585798 hasConceptScore W2893585798C185592680 @default.
• W2893585798 hasConceptScore W2893585798C2777704780 @default.
• W2893585798 hasConceptScore W2893585798C2779664074 @default.

• next