FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2895513135> ?p ?o ?g. }

• W2895513135 endingPage "502" @default.
• W2895513135 startingPage "493" @default.
• W2895513135 abstract "Giant cell tumors of bone (GCTBs) exhibit high recurrence and aggressive bone lytic behavior; but, the mechanism of GCTB progression is largely unknown. In GCTB, we detected abundant levels of miR-125a, which were associated with tumor extension, grade, and recurrence. miR-125a stimulates stromal cell tumorigenicity and growth in vivo by promoting the expression of interleukin-17A (IL-17A) and β-catenin. In contrast, inhibition of miR-125a suppressed stromal cell tumorigenicity and growth. Then, we found that miR-125a stimulates IL-17A by targeting TET2 and Foxp3, and it stimulates β-catenin expression by targeting APC and GSK3β in stromal cells. Furthermore, we identified that IL-17A stimulates miR-125a by activating nuclear factor κB (NF-κB) signaling in stromal cells. Finally, our data show that simultaneous inhibition of IL-17A signaling and miR-125a more significantly inhibits stromal cell growth than miR-125a inhibition alone. miR-125a stimulates the progression of GCTB, and it might represent a useful candidate marker for progression. Simultaneously blocking miR-125a and IL-17A might represent a new therapeutic strategy for GCTB. Giant cell tumors of bone (GCTBs) exhibit high recurrence and aggressive bone lytic behavior; but, the mechanism of GCTB progression is largely unknown. In GCTB, we detected abundant levels of miR-125a, which were associated with tumor extension, grade, and recurrence. miR-125a stimulates stromal cell tumorigenicity and growth in vivo by promoting the expression of interleukin-17A (IL-17A) and β-catenin. In contrast, inhibition of miR-125a suppressed stromal cell tumorigenicity and growth. Then, we found that miR-125a stimulates IL-17A by targeting TET2 and Foxp3, and it stimulates β-catenin expression by targeting APC and GSK3β in stromal cells. Furthermore, we identified that IL-17A stimulates miR-125a by activating nuclear factor κB (NF-κB) signaling in stromal cells. Finally, our data show that simultaneous inhibition of IL-17A signaling and miR-125a more significantly inhibits stromal cell growth than miR-125a inhibition alone. miR-125a stimulates the progression of GCTB, and it might represent a useful candidate marker for progression. Simultaneously blocking miR-125a and IL-17A might represent a new therapeutic strategy for GCTB. Giant cell tumor of bone (GCTB) is a benign, locally aggressive, osteolytic tumor that causes significant bone destruction in the epiphysis of long bones. The major challenge in the clinical treatment of GCTB is recurrence. The primary method for GCTB treatment in the clinic is surgery. However, according to one report, 20%–50% of patients with GCTB exhibit local recurrence following primary surgical treatments, up to 5% of patients develop pulmonary metastases, and 2% develop spontaneous malignant transformation.1Turcotte R.E. Giant cell tumor of bone.Orthop. Clin. North Am. 2006; 37: 35-51Abstract Full Text Full Text PDF PubMed Scopus (251) Google Scholar Unfortunately, there are no specific methods or drugs that can effectively inhibit the recurrence of GCTB, and no known biomarker can predict its progression. Additionally, the cellular mechanism that leads to GCTB development and progression remains unclear. GCTB consists of three major cell types: osteoclast-like multinucleated giant cells (MNGCs), monocytic round-shaped macrophage-like cells, and spindle-shaped fibroblast-like stromal cells.2Werner M. Giant cell tumour of bone: morphological, biological and histogenetical aspects.Int. Orthop. 2006; 30: 484-489Crossref PubMed Scopus (163) Google Scholar The bone resorption activity of GCTB is primarily attributed to the MNGCs, the development and activity of which are significantly regulated by stromal cells via a complex network of cytokines and chemokines.1Turcotte R.E. Giant cell tumor of bone.Orthop. Clin. North Am. 2006; 37: 35-51Abstract Full Text Full Text PDF PubMed Scopus (251) Google Scholar, 2Werner M. Giant cell tumour of bone: morphological, biological and histogenetical aspects.Int. Orthop. 2006; 30: 484-489Crossref PubMed Scopus (163) Google Scholar These findings suggest that both MNGCs and stromal cells play important roles in GCTB development and progression. Thus, both MNGCs and stromal cells are important therapeutic targets in GCTB treatment. Recent studies showed that aberrantly increased expression of interleukin-17A (IL-17A) and β-catenin are closely associated with GCTB progression, including tumor growth, bone destruction, and recurrence.3Xu M. Song Z.G. Xu C.X. Rong G.H. Fan K.X. Chen J.Y. Zhang W. Jia J.P. Han G. Wang W. et al.IL-17A stimulates the progression of giant cell tumors of bone.Clin. Cancer Res. 2013; 19: 4697-4705Crossref PubMed Scopus (15) Google Scholar, 4Matsubayashi S. Nakashima M. Kumagai K. Egashira M. Naruke Y. Kondo H. Hayashi T. Shindo H. Immunohistochemical analyses of beta-catenin and cyclin D1 expression in giant cell tumor of bone (GCTB): a possible role of Wnt pathway in GCTB tumorigenesis.Pathol. Res. Pract. 2009; 205: 626-633Crossref PubMed Scopus (22) Google Scholar However, the regulatory mechanism of IL-17A and β-catenin in GCTB is not fully understood. MicroRNAs (miRNAs) comprise a class of small non-coding RNAs that negatively regulate the expression of target genes at the post-transcriptional level through interaction with the 3′ UTRs of the target genes.5Garzon R. Calin G.A. Croce C.M. MicroRNAs in Cancer.Annu. Rev. Med. 2009; 60: 167-179Crossref PubMed Scopus (1606) Google Scholar Dysregulated expression of miRNAs has been detected in most cancers, and certain aberrantly expressed miRNAs play key roles in cancer initiation and progression. Dysregulated miRNAs are also detected in GCTB,6Mosakhani N. Pazzaglia L. Benassi M.S. Borze I. Quattrini I. Picci P. Knuutila S. MicroRNA expression profiles in metastatic and non-metastatic giant cell tumor of bone.Histol. Histopathol. 2013; 28: 671-678PubMed Google Scholar and several miRNAs have been implicated in the progression of GCTB.7Fellenberg J. Sähr H. Kunz P. Zhao Z. Liu L. Tichy D. Herr I. Restoration of miR-127-3p and miR-376a-3p counteracts the neoplastic phenotype of giant cell tumor of bone derived stromal cells by targeting COA1, GLE1 and PDIA6.Cancer Lett. 2016; 371: 134-141Crossref PubMed Scopus (24) Google Scholar However, unlike other tumors, the role of miRNAs in GCTB is largely unknown. Interestingly, although not previously demonstrated in GCTBs, certain dysregulated miRNAs are involved in the regulation of IL-17A and β-catenin expression and functions.8Du C. Liu C. Kang J. Zhao G. Ye Z. Huang S. Li Z. Wu Z. Pei G. MicroRNA miR-326 regulates TH-17 differentiation and is associated with the pathogenesis of multiple sclerosis.Nat. Immunol. 2009; 10: 1252-1259Crossref PubMed Scopus (646) Google Scholar, 9Matsuyama H. Suzuki H.I. Nishimori H. Noguchi M. Yao T. Komatsu N. Mano H. Sugimoto K. Miyazono K. miR-135b mediates NPM-ALK-driven oncogenicity and renders IL-17-producing immunophenotype to anaplastic large cell lymphoma.Blood. 2011; 118: 6881-6892Crossref PubMed Scopus (150) Google Scholar, 10Jin H. Luo S. Wang Y. Liu C. Piao Z. Xu M. Guan W. Li Q. Zou H. Tan Q.Y. et al.miR-135b Stimulates Osteosarcoma Recurrence and Lung Metastasis via Notch and Wnt/β-Catenin Signaling.Mol. Ther. Nucleic Acids. 2017; 8: 111-122Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar Based on these findings, we speculated that dysregulated miRNAs may be involved in the regulation of IL-17A and β-catenin expression and function in GCTBs, thereby stimulating GCTB progression. Thus, in this study, we demonstrated that miRNAs play a key role in the progression of GCTB and are involved in the regulation of IL-17A and β-catenin expression. To identify GCTB progression-associated miRNAs, we performed miRNAs array analysis using recurrent GCTB tissues and their matched normal bone tissues from 3 patients. As shown in Figure 1A, miR-125a was significantly increased in GCTB tissues compared to their adjacent normal tissues. In addition, our data show that the miR-125a expression level was significantly higher in recurrent GCTB tissues compared to the primary tumor tissues (Figure 1B). Consistent with these results, we identified a higher recurrence rate in the miR-125a high-expressing GCTB patient group compared to the miR-125a low-expressing patient group (Figure 1C). Additionally, we found that miR-125a was more frequently overexpressed in aggressive and extracompartmental extension lesions (Table S1). Furthermore, the univariate and multivariate analyses showed that miR-125a level was significantly associated with GCTB recurrence (Table S2). These findings suggested that increased miR-125a might be involved in the stimulation of GCTB progression, including recurrence. The stromal cells are the only proliferating population in GCTBs, and the expression of miR-125a was significantly increased in stromal cells compared to normal bone (Figure 2A). Thus, to investigate whether miR-125a was directly involved in GCTB progression, we overexpressed or inhibited miR-125a in primary cultured stromal cells (Figure S1A), and then we performed a cell viability assay. Our data showed that overexpression of miR-125a significantly promoted stromal cell growth, while inhibition of miR-125a had the opposite effect (Figure 2B). Consistent with this finding, a soft agar assay also showed that overexpression or inhibition of miR-125a increased or inhibited stromal cell colony formation ability, respectively (Figure 2C). Furthermore, we confirmed these results observed in vitro using animal experiments. To investigate the effects of miR-125a on tumor growth and tumorigenicity in vivo, two doses of miR-125a-overexpressing stromal cells (Figure S1B), miR-125a sponge-transfected stromal cells (Figure S1C), and their corresponding vector control cells were subcutaneously inoculated into nude mice. As shown in Figures 2D and 2E, miR-125a-overexpressing stromal cells displayed higher tumorigenicity and formed larger tumors than the vector control stromal cells. In contrast, miR-125a-inhibited stromal cells showed weakened tumorigenicity and formed smaller tumors than the vector control stromal cells (Figures 2F and 2G). These results strongly supported the notion that miR-125a is a tumor promotion miRNA that significantly contributes to GCTB progression. Previous studies have shown that β-catenin and IL-17A are risk factors for GCTB progression.3Xu M. Song Z.G. Xu C.X. Rong G.H. Fan K.X. Chen J.Y. Zhang W. Jia J.P. Han G. Wang W. et al.IL-17A stimulates the progression of giant cell tumors of bone.Clin. Cancer Res. 2013; 19: 4697-4705Crossref PubMed Scopus (15) Google Scholar, 4Matsubayashi S. Nakashima M. Kumagai K. Egashira M. Naruke Y. Kondo H. Hayashi T. Shindo H. Immunohistochemical analyses of beta-catenin and cyclin D1 expression in giant cell tumor of bone (GCTB): a possible role of Wnt pathway in GCTB tumorigenesis.Pathol. Res. Pract. 2009; 205: 626-633Crossref PubMed Scopus (22) Google Scholar Thus, we investigated whether the expression level of miR-125a correlated with the expression of β-catenin and IL-17A in GCTB. As shown in Figure 3A, overexpression of miR-125a increased while inhibition of miR-125a suppressed β-catenin expression in stromal cells. Similar to β-catenin, we detected a high or low concentration of IL-17A in the conditioned media from the miR-125a-overexpressing or miR-125a-inhibited stromal cells compared to control stromal cells, respectively (Figure 3B). Additionally, we identified a positive correlation between the expression level of β-catenin (Figure 3C) and IL-17A (Figure 3D) with miR-125a in human GCTB specimens. These data suggest that miR-125a positively regulates β-catenin and IL-17A expression in GCTB. Next, to investigate whether β-catenin and IL-17A directly contribute to miR-125a function in GCTB, we silenced β-catenin and IL-17 receptor A (IL-17RA) in miR-125a-overexpressing stromal cells (Figure S1D), and then we performed a cell viability assay. As shown in Figure 3E, miR-125a-stimulated stromal cell growth was significantly inhibited by silencing of β-catenin and/or IL-17RA, indicating that miR-125a-induced stromal cell growth stimulation is dependent on β-catenin and IL-17A. Furthermore, we confirmed these in vitro experimental results in vivo using an miR-125a-overexpressing stromal cell xenograft model. Consistent with the in vitro results, β-catenin- or IL-17RA-silenced (Figures S1E and S1F) miR-125a-overexpressing stromal cells showed weakened tumorigenicity and formed smaller tumors than control cells (Figure 3F). Notably, simultaneous silencing of β-catenin and IL-17RA more strongly inhibited tumorigenicity and tumor growth compared to single-gene silencing in miR-125a-overexpressing stromal cell xenografts (Figure 3F). These data clearly indicate that miR-125a-stimulated tumor growth and tumorigenicity are mediated through increasing β-catenin and IL-17A expression in GCTB. To investigate how miR-125a enhances IL-17A and β-catenin expression, we screened miR-125a target genes using computational algorithm analysis, and we identified Foxp3, TET2, APC, and GSK3β as potential target genes of miR-125a (Figure 4A). APC and GSK3β are well studied negative regulators of β-catenin, and recent studies showed that Foxp3 inhibits IL-17A expression11Liao J. Liu Y. Wu H. Zhao M. Tan Y. Li D. Long H. Dai Y. Yung S. Chan T.M. Lu Q. The role of icaritin in regulating Foxp3/IL17a balance in systemic lupus erythematosus and its effects on the treatment of MRL/lpr mice.Clin. Immunol. 2016; 162: 74-83Crossref PubMed Scopus (28) Google Scholar and TET2 stimulates Foxp3 expression.12Yue X. Trifari S. Äijö T. Tsagaratou A. Pastor W.A. Zepeda-Martínez J.A. Lio C.W. Li X. Huang Y. Vijayanand P. et al.Control of Foxp3 stability through modulation of TET activity.J. Exp. Med. 2016; 213: 377-397Crossref PubMed Scopus (213) Google Scholar In addition, previous studies showed that TET213Cheng J. Guo S. Chen S. Mastriano S.J. Liu C. D’Alessio A.C. Hysolli E. Guo Y. Yao H. Megyola C.M. et al.An extensive network of TET2-targeting MicroRNAs regulates malignant hematopoiesis.Cell Rep. 2013; 5: 471-481Abstract Full Text Full Text PDF PubMed Scopus (117) Google Scholar and Foxp314Li J. Qiu D. Chen Z. Du W. Liu J. Mo X. Altered expression of miR-125a-5p in thymoma-associated myasthenia gravis and its down-regulation of foxp3 expression in Jurkat cells.Immunol. Lett. 2016; 172: 47-55Crossref PubMed Scopus (21) Google Scholar are targets of miR-125a, although not in GCTB. However, no studies have shown whether TET2 and Foxp3 are expressed in GCTB. Thus, we first investigated whether TET2 and Foxp3 are expressed in GCTB specimens. Our immunohistochemistry (IHC) results clearly showed that TET2 was expressed in both MNGCs and stromal cells, while Foxp3 was only expressed in stromal cells (Figure 4B), suggesting that TET2 and Foxp3 may be involved in the regulation of IL-17A expression in stromal cells. To confirm the negative regulation of miR-125a on these candidate target genes, we measured the expression level of the candidate target genes after overexpression of miR-125a in stromal cells. Our data showed that all candidate genes of miR-125a were significantly decreased in miR-125a-overexpressing stromal cells compared to control at both the mRNA and protein levels (Figures 4C and 4D). Then, we confirmed the direct binding between miR-125a and the 3′ UTR of candidate target genes by luciferase assay. Each 3′ UTR of the candidate target genes, harboring the complementary sequence to the miR-125a seed sequence, was cloned into a reporter plasmid. Transient cotransfection of each candidate target gene-3′ UTR construct with miR-125a into stromal cells led to a significant decrease in firefly luciferase activity compared to control. However, mutation of the putative target site in the 3′ UTR abolished this repression by miR-125a (Figure 4E), indicating that miR-125a negatively regulates the expression of APC, GSK3β, TET2, and Foxp3 by directly targeting the 3′ UTR of target genes in stromal cells. Next, we investigated whether these target genes directly contribute to miR-125a-induced expression and function of IL-17A and β-catenin. Our data showed that overexpression of TET2 or Foxp3 significantly abolished the miR-125a-induced IL-17A expression in stromal cells (Figure 4F). Notably, co-overexpression of TET2 and Foxp3 more significantly inhibited the miR-125a-induced IL-17A expression level compared to single-gene overexpression (Figure 4F). Additionally, TET2 and/or Foxp3 overexpression abolished IL-17A-induced receptor activator of nuclear factor κB ligand (RANKL) expression while inhibiting IL-17A-induced inhibition of osteoprotegerin (OPG) expression in stromal cells (Figure 4F). Additionally, overexpression of the miR-125a target gene APC and/or GSK3β significantly abolished miR-125a overexpression-induced β-catenin expression (Figure 4G). These findings suggest that miR-125a stimulates IL-17A expression by targeting TET2 and Foxp3 and stimulates β-catenin expression by targeting APC and GSK3β in stromal cells. Although not conducted in GCTB, previous studies showed that miR-17A activates nuclear factor κB (NF-κB) signaling, and activated NF-κB signaling is involved in the regulation of miRNAs, including miR-125a.15Potenza N. Panella M. Castiello F. Mosca N. Amendola E. Russo A. Molecular mechanisms governing microRNA-125a expression in human hepatocellular carcinoma cells.Sci. Rep. 2017; 7: 10712Crossref PubMed Scopus (17) Google Scholar, 16Ghose J. Bhattacharyya N.P. Transcriptional regulation of microRNA-100, -146a, and -150 genes by p53 and NFκB p65/RelA in mouse striatal STHdh(Q7)/ Hdh(Q7) cells and human cervical carcinoma HeLa cells.RNA Biol. 2015; 12: 457-477Crossref PubMed Scopus (26) Google Scholar Thus, here we investigated whether IL-17A is involved in the regulation of miR-125a expression in GCTB. As shown in Figure 5A, IL-17A treatment dose-dependently increased miR-125a expression in stromal cells. In addition, silencing of IL-17RA (Figure S1G) significantly abolished IL-17A-induced miR-125a expression in stromal cells (Figure 5B), indicating that miR-125a expression was partly regulated by IL-17A in stromal cells. Then, we investigated whether IL-17A stimulates miR-125a expression through NF-κB signaling. Consistent with findings in other tumors, our data showed that miR-17A significantly decreased cytoplasmic p65 while increasing nuclear p65 in stromal cells (Figure 5C). In addition, activation of NF-κB signaling by tumor necrosis factor alpha (TNF-α) stimulated the expression of miR-125a, and the TNF-α-stimulated miR-125a expression was abolished by NF-κB inhibitor BAY-117082 treatment of stromal cells (Figure 5D). Furthermore, our data showed that IL-17A-induced expression of miR-125a was also abolished by BAY-117082 treatment in stromal cells (Figure 5E). These results clearly indicate that IL-17A stimulates miR-125a expression by activating NF-κB signaling in stromal cells. Our previous study showed that IL-17A is expressed in both stromal cells and MNGCs and IL-17A can stimulate its self-expression in MNGCs.3Xu M. Song Z.G. Xu C.X. Rong G.H. Fan K.X. Chen J.Y. Zhang W. Jia J.P. Han G. Wang W. et al.IL-17A stimulates the progression of giant cell tumors of bone.Clin. Cancer Res. 2013; 19: 4697-4705Crossref PubMed Scopus (15) Google Scholar In addition, although not previously studied in GCTB, IL-17A can stimulate β-catenin expression.17Hyun Y.S. Han D.S. Lee A.R. Eun C.S. Youn J. Kim H.Y. Role of IL-17A in the development of colitis-associated cancer.Carcinogenesis. 2012; 33: 931-936Crossref PubMed Scopus (143) Google Scholar, 18Zhang Q. Liu S. Parajuli K.R. Zhang W. Zhang K. Mo Z. Liu J. Chen Z. Yang S. Wang A.R. et al.Interleukin-17 promotes prostate cancer via MMP7-induced epithelial-to-mesenchymal transition.Oncogene. 2017; 36: 687-699Crossref PubMed Scopus (103) Google Scholar Thus, here we investigated whether IL-17A affects IL-17A and β-catenin expression in stromal cells. Our data showed that IL-17A significantly stimulated the expression of IL-17A (Figure 6A) and β-catenin in stromal cells (Figure 6B). These data suggest that simultaneously blocking miR-125a and IL-17A may inhibit GCTB progression better than blocking miR-125a alone. As expected, simultaneously blocking miR-125a and IL-17RA most effectively inhibited miR-125a high-expressing stromal cell viability compared to single-gene inhibition in the presence of IL-17A (Figure 6C). In this study, we found that the expression level of miR-125a was significantly increased in GCTB specimens compared to normal bone tissues. In addition, we showed that an increased expression level of miR-125a was closely correlated with GCTB grade, extension, and recurrence in patients. These findings suggest miR-125a is a tumor-promoting miRNA and can be a prognostic marker for GCTB progression. Both MNGCs and stromal cells play important roles in GCTB progression. Notably, recent studies have suggested that stromal cells may be involved in GCTB development and recurrence. According to these reports, stromal cells are the only proliferating population in GCTB, and they express osteoblast factors,19Huang L. Teng X.Y. Cheng Y.Y. Lee K.M. Kumta S.M. Expression of preosteoblast markers and Cbfa-1 and Osterix gene transcripts in stromal tumour cells of giant cell tumour of bone.Bone. 2004; 34: 393-401Crossref PubMed Scopus (84) Google Scholar, 20Ghert M. Simunovic N. Cowan R.W. Colterjohn N. Singh G. Properties of the stromal cell in giant cell tumor of bone.Clin. Orthop. Relat. Res. 2007; 459: 8-13Crossref PubMed Scopus (51) Google Scholar contain subpopulations with stem cell-like properties,21Lan J. Liu X. Rong W. Wei F. Jiang L. Yu H. Dang G. Liu Z. Stro-1(+) stromal cells have stem-like features in giant cell tumor of bone.J. Surg. Oncol. 2012; 106: 826-836Crossref PubMed Scopus (13) Google Scholar, 22Liu L. Aleksandrowicz E. Fan P. Schönsiegel F. Zhang Y. Sähr H. Gladkich J. Mattern J. Depeweg D. Lehner B. et al.Enrichment of c-Met+ tumorigenic stromal cells of giant cell tumor of bone and targeting by cabozantinib.Cell Death Dis. 2014; 5: e1471Crossref PubMed Scopus (23) Google Scholar and can form tumors in nude mice.3Xu M. Song Z.G. Xu C.X. Rong G.H. Fan K.X. Chen J.Y. Zhang W. Jia J.P. Han G. Wang W. et al.IL-17A stimulates the progression of giant cell tumors of bone.Clin. Cancer Res. 2013; 19: 4697-4705Crossref PubMed Scopus (15) Google Scholar In recent years, new treatment options have been developed, such as the monoclonal antibody denosumab directed against RANKL; denosumab does not affect the GCTB recurrence rate because it mainly affects the bone destructive osteoclast-like giant cells within the tumor, rather than the stromal cells.7Fellenberg J. Sähr H. Kunz P. Zhao Z. Liu L. Tichy D. Herr I. Restoration of miR-127-3p and miR-376a-3p counteracts the neoplastic phenotype of giant cell tumor of bone derived stromal cells by targeting COA1, GLE1 and PDIA6.Cancer Lett. 2016; 371: 134-141Crossref PubMed Scopus (24) Google Scholar, 23Thomas D. Henshaw R. Skubitz K. Chawla S. Staddon A. Blay J.Y. Roudier M. Smith J. Ye Z. Sohn W. et al.Denosumab in patients with giant-cell tumour of bone: an open-label, phase 2 study.Lancet Oncol. 2010; 11: 275-280Abstract Full Text Full Text PDF PubMed Scopus (492) Google Scholar, 24Traub F. Singh J. Dickson B.C. Leung S. Mohankumar R. Blackstein M.E. Razak A.R. Griffin A.M. Ferguson P.C. Wunder J.S. Efficacy of denosumab in joint preservation for patients with giant cell tumour of the bone.Eur. J. Cancer. 2016; 59: 1-12Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar Here we used a series of in vitro and in vivo experiments to demonstrate that aberrantly increased expression of miR-125a stimulates stromal cell growth and tumorigenicity. Importantly, the inhibition of miR-125a significantly inhibited stromal cell tumorigenicity and tumor growth in a xenograft model. Taken together, our findings indicate that miR-125a is a novel therapeutic target of stromal cells and inhibition of miR-125a is a novel strategy to suppress GCTB progression. GCTB is characterized by a high recurrence rate, and studies have shown that aberrantly highly expressed β-catenin and IL-17A are closely associated with GCTB progression, including tumor growth and recurrence.3Xu M. Song Z.G. Xu C.X. Rong G.H. Fan K.X. Chen J.Y. Zhang W. Jia J.P. Han G. Wang W. et al.IL-17A stimulates the progression of giant cell tumors of bone.Clin. Cancer Res. 2013; 19: 4697-4705Crossref PubMed Scopus (15) Google Scholar, 4Matsubayashi S. Nakashima M. Kumagai K. Egashira M. Naruke Y. Kondo H. Hayashi T. Shindo H. Immunohistochemical analyses of beta-catenin and cyclin D1 expression in giant cell tumor of bone (GCTB): a possible role of Wnt pathway in GCTB tumorigenesis.Pathol. Res. Pract. 2009; 205: 626-633Crossref PubMed Scopus (22) Google Scholar Thus, understanding the biological basis for the deregulation of β-catenin and IL-17A is of great value for the future development of novel therapeutic strategies. Here we demonstrated that overexpression of miR-125a substantially increased the expression of β-catenin and IL-17A in stromal cells and promoted stromal cell growth and tumorigenicity through β-catenin and IL-17A. In addition, we showed that miR-125a stimulates β-catenin expression, by targeting the β-catenin negative regulators APC and GSK3β, and IL-17A expression, by targeting TET2 and Foxp3 in stromal cells. Taken together, miR-125a stimulates GCTB progression by increasing β-catenin and IL-17A expression through targeting their multiple inhibitors, providing a new layer of molecular mechanisms by which miR-125a promotes GCTB progression. In a previous study, we demonstrated that IL-17A was secreted by both stromal cells and MNGCs, thereby significantly promoting GCTB progression.3Xu M. Song Z.G. Xu C.X. Rong G.H. Fan K.X. Chen J.Y. Zhang W. Jia J.P. Han G. Wang W. et al.IL-17A stimulates the progression of giant cell tumors of bone.Clin. Cancer Res. 2013; 19: 4697-4705Crossref PubMed Scopus (15) Google Scholar In this study, we detected Foxp3 expression in stromal cells, but not in MNGCs, indicating that IL-17A expression in MNGCs is not dependent on miR-125a/Foxp3 signaling. Additionally, these results suggest that miR-125a inhibition cannot suppress the expression of IL-17A by MNGCs. Notably, our data show that IL-17A significantly stimulates miR-125a expression through activating NF-κB signaling. Additionally, IL-17A stimulates IL-17A and β-catenin expression in stromal cells, suggesting that simultaneous targeting of miR-125a and IL-17A is more effective in GCTB treatment. In fact, our results showed that simultaneously blocking miR-125a and IL-17RA more strongly inhibited stromal cell growth in medium containing added IL-17A compared to the miR-125a inhibition group. In summary, our study, to the best of our knowledge, is the first to have delineated the correlation between miR-125a and the progression of GCTBs. miR-125a stimulates the progression of GCTBs through increasing the expression of β-catenin and IL-17A by directly targeting their negative regulators. Our results suggest that miR-125a is a useful progression marker of GCTB and simultaneously blocking miR-125a and IL-17A might represent a new therapeutic strategy for GCTB. Tumor samples were obtained from 107 patients with GCTB, and all patients received extended curettage, with no adjuvant therapy. The clinical characteristics of the patients with GCTB are summarized in Table S3. The progression of the GCTB was evaluated using the Campanacci grading25Campanacci M. Baldini N. Boriani S. Sudanese A. Giant-cell tumor of bone.J. Bone Joint Surg. Am. 1987; 69: 106-114Crossref PubMed Scopus (906) Google Scholar and Enneking staging systems.26Enneking W.F. Spanier S.S. Goodman M.A. A system for the surgical staging of musculoskeletal sarcoma. 1980.Clin. Orthop. Relat. Res. 2003; : 4-18Crossref PubMed Scopus (220) Google Scholar This research was approved by the Research Ethics Board of the General Hospital of the People’s Liberation Army, China. The stromal cells were isolated from fresh tumor tissues of GCTB patients as described previously,3Xu M. Song Z.G. Xu C.X. Rong G.H. Fan K.X. Chen J.Y. Zhang W. Jia J.P. Han G. Wang W. et al.IL-17A stimulates the progression of giant cell tumors of bone.Clin. Cancer Res. 2013; 19: 4697-4705Crossref PubMed Scopus (15) Google Scholar and they were cultured in DMEM containing 4.5 g/L glucose with 10% fetal calf serum and 100 U/mL penicillin-streptomycin (Sigma, St. Louis, MO, USA). Each experiment was performed using stromal cells that were from 3 GCTB patients. Stromal cells were transfected with the indicated nucleotides (Ribo Bio, Guangzhou, China) or lentiviral vectors. After 24 hr of transfection, the cells were trypsinized. For the cell viability assay, the cells were reseeded in 96-well plates at a density of 5,000/well, and then the cell viability was measured at the indicated times using Cell Counting Kit-8 (MedChem Express, NJ, USA), according to the manufacturer’s instructions. For the soft agar assay, cells were re-suspended in 0.5 mL 0.35% agar (Sigma) in growth medium at a density of 5,000 cells/well (6-well plates). Then, the agar-cell mixture was plated on the top of a solid layer of 0.8% agar in growth medium. Colonies were counted 14 days later. RNA was isolated from cells and human specimens using the TRIzol reagent (Invitrogen, Carlsbad, CA, USA) or miRNeasy Mini Kits (QIAGEN, Hilden, Germany), according to the manufacturer’s protocol. Microarray analysis was performed using LC MicroRNA microarray Chip_H11.0_081344, which detects miRNA transcripts listed in Sanger miRBase Release 11.0. Imaging and quantifying analysis were performed using an Affymetrix scanner and a fag software. For miR-125a and RNU6B, reverse transcription and qPCR were performed with The TaqMan MicroRNA Reverse Transcription Kit and TaqMan Universal PCR Master Mix, respectively, using Ambion miRNA primers. The relative expression of miR-125a was normalized against RNU6 expression using the 2−ΔCt method, and the miR-125a expression fold change in GCTB samples matched to nontumor control samples was evaluated using the 2−ΔΔCt method. Based on the mean fold change of miR-125a expression, patients were divided into high (fold change > mean) and low (fold change < mean) miR-125a expression groups.27Li J. Huang H. Sun L. Yang M. Pan C. Chen W. Wu D. Lin Z. Zeng C. Yao Y. et al.MiR-21 indicates poor prognosis in tongue squamous cell carcinomas as an apoptosis inhibitor.Clin. Cancer Res. 2009; 15: 3998-4008Crossref PubMed Scopus (367) Google Scholar For other gene expression, reverse transcription and qPCR were performed with a High Capacity cDNA Reverse Transcription Kit and QuantiTect SYBR Green PCR kit, respectively. All materials for qRT-PCR were purchased from Life Technologies (Carlsbad, CA, USA). The primer sequences for the genes are provided in Table S4. 3′ UTR segments of miR-125a target genes that were predicted to interact with miR-125a were amplified by PCR from human genomic DNA and inserted into the Hind III and Sac I sites of the miRNA Expression Reporter Vector (Life Technologies). The primer sequences are provided in Table S5. Pre-miR-125a-encoding sequences were subcloned into the GV838 lentiviral vector (GENECHEM, Shanghai, China) and lentiviral vectors. For the miR-125a sponge, synthetic oligonucleotides containing five tandem repeats of bulged miR-125a-binding sites were ligated into the GV369 lentiviral vector (contain EGFP sequences) (GENECHEM). The sequence of the control sponge was as follows: 5′-ACTAGTTAATGTTAGCTAAGAGAAAACTTCGATTGTTAGCTAAGAGAAAACTTCGATTGTTAGCTAAGAGAAAACTTCGATTGTTAGCTAAGAGAAAACTTCGATTGTTAGCTAAGAGAAAACTTCGATTGTTAGCTAAGAGAAAACTTCGCGGATCC-3′. APC and GSK3β expression constructs were purchased from GeneCopoeia (Rockville, MD, USA). Small hairpin RNA (shRNA) of β-catenin and IL-17RA lentiviral vectors were obtained from Santa Cruz Biotechnology (Dallas, TX, USA). The TET2 construct was generated as described by Ito et al.28Ito S. D’Alessio A.C. Taranova O.V. Hong K. Sowers L.C. Zhang Y. Role of Tet proteins in 5mC to 5hmC conversion, ES-cell self-renewal and inner cell mass specification.Nature. 2010; 466: 1129-1133Crossref PubMed Scopus (1931) Google Scholar For the luciferase assay, stromal cells were cotransfected with the indicated reporter plasmids and either the miR-125a mimics or control oligonucleotides. These cells were also cotransfected with a renilla luciferase plasmid as an internal control. Luciferase activity was measured 72 hr post-transfection using a Dual-Luciferase Assay Kit (Promega, Madison, WI, USA), according to the manufacturer’s protocol, and the luciferase activity was normalized to the activity of renillar luciferase. Western blot analysis and IHC were conducted as previously described.29Xu C.X. Jere D. Jin H. Chang S.H. Chung Y.S. Shin J.Y. Kim J.E. Park S.J. Lee Y.H. Chae C.H. et al.Poly(ester amine)-mediated, aerosol-delivered Akt1 small interfering RNA suppresses lung tumorigenesis.Am. J. Respir. Crit. Care Med. 2008; 178: 60-73Crossref PubMed Scopus (98) Google Scholar Total, cytoplasmic, and nuclear proteins were extracted using protein extraction kits (101Bio, Palo Alto, CA, USA), and all antibodies were purchased from Abcam (Cambridge, MA, USA). Western blot bands were quantified using ImageJ software. The IL-17A in the media of primary cultured cells was measured using a human IL-17A ELISA kit (Abcam), according to the manufacturer’s instructions. The stromal cells were infected with the indicated lentiviral vectors. After 48 hr of infection, cells were injected subcutaneously into 6-week-old female nude mice. At 2 months after the cell injection, the mice were sacrificed. Kaplan-Meier survival analysis and x2 tests were used for calculating the recurrence rate of GCTB and the association of miR-125a expression with clinical parameters, respectively. All of the other results are expressed as the mean values ± SD. Statistical significance was analyzed by unpaired Student’s t tests or one-way ANOVA and Duncan’s multiple range tests using SAS statistical software package version 6.12 (SAS Institute); p ≤ 0.05 was considered to be statistically significant. H.J., M.X., and C.-X.X. contributed to the conception and design of the study. S.L., D.-W.L., Q.L., and M.X., collected the human samples and performed IHC. H.J., D.-W.L., and P.H. performed laboratory and animal experiments. H.J., S.-N.W., J.-M.W., and C.-X.X. analyzed the data. H.J. and C.-X.X. wrote the manuscript. The authors have no conflicts of interest. This work was supported by the National Natural Science Foundation of China (81402216 to M.X. and 81672657 to C.-X.X.), Beijing New-star Plan of Science and Technology (Z14110700181409 to M.X.), the Military Youth Innovation Training Program (16QNP145 to M.X.), the Translational Medicine Program of GHPLA (2016TM-019 to M.X.), the National Defense Program (3408080 to M.X.), and the Startup Fund for Talented Scholars of Daping Hospital and Research Institute of Surgery, Third Military Medical University (to C.-X.X. and H.J.). Download .pdf (.42 MB) Help with pdf files Document S1. Figure S1 and Tables S1–S5" @default.
• W2895513135 created "2018-10-12" @default.
• W2895513135 creator A5009714134 @default.
• W2895513135 creator A5029438350 @default.
• W2895513135 creator A5034562489 @default.
• W2895513135 creator A5034579434 @default.
• W2895513135 creator A5053780153 @default.
• W2895513135 creator A5057363110 @default.
• W2895513135 creator A5059857070 @default.
• W2895513135 creator A5076472783 @default.
• W2895513135 creator A5087544909 @default.
• W2895513135 date "2018-12-01" @default.
• W2895513135 modified "2023-10-16" @default.
• W2895513135 title "miR-125a Promotes the Progression of Giant Cell Tumors of Bone by Stimulating IL-17A and β-Catenin Expression" @default.
• W2895513135 cites W1580468049 @default.
• W2895513135 cites W1590964273 @default.
• W2895513135 cites W1979925584 @default.
• W2895513135 cites W1981463058 @default.
• W2895513135 cites W1994246752 @default.
• W2895513135 cites W1996106610 @default.
• W2895513135 cites W1999202349 @default.
• W2895513135 cites W2004898931 @default.
• W2895513135 cites W2010585094 @default.
• W2895513135 cites W2016987712 @default.
• W2895513135 cites W2034733905 @default.
• W2895513135 cites W2049216710 @default.
• W2895513135 cites W2087115595 @default.
• W2895513135 cites W2146640602 @default.
• W2895513135 cites W2159152276 @default.
• W2895513135 cites W2165460739 @default.
• W2895513135 cites W2180528699 @default.
• W2895513135 cites W2187587490 @default.
• W2895513135 cites W2273715522 @default.
• W2895513135 cites W2287054877 @default.
• W2895513135 cites W2299351315 @default.
• W2895513135 cites W2321228339 @default.
• W2895513135 cites W2470213520 @default.
• W2895513135 cites W2625139928 @default.
• W2895513135 cites W2752525946 @default.
• W2895513135 cites W3023299375 @default.
• W2895513135 cites W4292082731 @default.
• W2895513135 cites W4292542148 @default.
• W2895513135 doi "https://doi.org/10.1016/j.omtn.2018.09.021" @default.
• W2895513135 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/6205328" @default.
• W2895513135 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/30388623" @default.
• W2895513135 hasPublicationYear "2018" @default.
• W2895513135 type Work @default.
• W2895513135 sameAs 2895513135 @default.
• W2895513135 citedByCount "5" @default.
• W2895513135 countsByYear W28955131352019 @default.
• W2895513135 countsByYear W28955131352020 @default.
• W2895513135 countsByYear W28955131352021 @default.
• W2895513135 countsByYear W28955131352022 @default.
• W2895513135 crossrefType "journal-article" @default.
• W2895513135 hasAuthorship W2895513135A5009714134 @default.
• W2895513135 hasAuthorship W2895513135A5029438350 @default.
• W2895513135 hasAuthorship W2895513135A5034562489 @default.
• W2895513135 hasAuthorship W2895513135A5034579434 @default.
• W2895513135 hasAuthorship W2895513135A5053780153 @default.
• W2895513135 hasAuthorship W2895513135A5057363110 @default.
• W2895513135 hasAuthorship W2895513135A5059857070 @default.
• W2895513135 hasAuthorship W2895513135A5076472783 @default.
• W2895513135 hasAuthorship W2895513135A5087544909 @default.
• W2895513135 hasBestOaLocation W28955131351 @default.
• W2895513135 hasConcept C137620995 @default.
• W2895513135 hasConcept C142724271 @default.
• W2895513135 hasConcept C2777190185 @default.
• W2895513135 hasConcept C30145163 @default.
• W2895513135 hasConcept C502942594 @default.
• W2895513135 hasConcept C54355233 @default.
• W2895513135 hasConcept C62112901 @default.
• W2895513135 hasConcept C62478195 @default.
• W2895513135 hasConcept C71924100 @default.
• W2895513135 hasConcept C77076574 @default.
• W2895513135 hasConcept C86803240 @default.
• W2895513135 hasConcept C95444343 @default.
• W2895513135 hasConceptScore W2895513135C137620995 @default.
• W2895513135 hasConceptScore W2895513135C142724271 @default.
• W2895513135 hasConceptScore W2895513135C2777190185 @default.
• W2895513135 hasConceptScore W2895513135C30145163 @default.
• W2895513135 hasConceptScore W2895513135C502942594 @default.
• W2895513135 hasConceptScore W2895513135C54355233 @default.
• W2895513135 hasConceptScore W2895513135C62112901 @default.
• W2895513135 hasConceptScore W2895513135C62478195 @default.
• W2895513135 hasConceptScore W2895513135C71924100 @default.
• W2895513135 hasConceptScore W2895513135C77076574 @default.
• W2895513135 hasConceptScore W2895513135C86803240 @default.
• W2895513135 hasConceptScore W2895513135C95444343 @default.
• W2895513135 hasFunder F4320321001 @default.
• W2895513135 hasLocation W28955131351 @default.
• W2895513135 hasLocation W28955131352 @default.
• W2895513135 hasLocation W28955131353 @default.
• W2895513135 hasOpenAccess W2895513135 @default.
• W2895513135 hasPrimaryLocation W28955131351 @default.
• W2895513135 hasRelatedWork W2553659377 @default.
• W2895513135 hasRelatedWork W2768935185 @default.
• W2895513135 hasRelatedWork W2800932072 @default.
• W2895513135 hasRelatedWork W2912099029 @default.

• next