FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2895804881> ?p ?o ?g. }

• W2895804881 endingPage "42" @default.
• W2895804881 startingPage "37" @default.
• W2895804881 abstract "•Loss of Men1 has a greater impact on cell cycle progression than Mixed Lineage Leukemia 1; Mixed Lineage Leukemia 2 (Mll1;Mll2) loss.•Loss of Men1 in acute myeloid leukemia (AML) predominantly affects the MLL-AF9-driven leukemogenic program.•Mll1;Mll2 deletion increases AML sensitivity to menin inhibitors. Disrupting the protein–protein interaction for molecularly targeted cancer therapeutics can be a challenging but promising strategy. Compounds that disrupt the interaction between menin, a chromatin-binding protein, and oncogenic mixed lineage leukemia fusion proteins (MLL-FPs) have shown significant promise in preclinical models of leukemia and have a high degree of selectivity for leukemia versus normal hematopoietic cells. Biochemical and structural studies demonstrate that, in addition to disrupting the menin–MLL-FP interaction, such compounds also inhibit menin–MLL1, menin–MLL2, and other menin-interacting proteins. Here, we address the degree to which disruption of menin–MLL-FP interactions or menin–MLL1/MLL2 interactions contribute to the antileukemia effect of menin inhibition. We show that Men1 deletion in MLL-AF9-transformed leukemia cells produces distinct cellular and molecular consequences compared with Mll1;Mll2 co-deletion and that compounds disrupting menin–MLL N-terminal interactions largely phenocopy menin loss. Moreover, we show that Mll1;Mll2-deficient leukemia cells exhibit enhanced sensitivity to menin interaction inhibitors, which is consistent with each regulating complementary genetic pathways. These data illustrate the heightened dependency of MLL-FPs on menin compared with wild-type MLL1/MLL2 for regulation of downstream target genes and argue that the predominant action of menin inhibitory compounds is through direct inhibition of MLL-FPs without significant contribution from MLL1/MLL2 inhibition. Disrupting the protein–protein interaction for molecularly targeted cancer therapeutics can be a challenging but promising strategy. Compounds that disrupt the interaction between menin, a chromatin-binding protein, and oncogenic mixed lineage leukemia fusion proteins (MLL-FPs) have shown significant promise in preclinical models of leukemia and have a high degree of selectivity for leukemia versus normal hematopoietic cells. Biochemical and structural studies demonstrate that, in addition to disrupting the menin–MLL-FP interaction, such compounds also inhibit menin–MLL1, menin–MLL2, and other menin-interacting proteins. Here, we address the degree to which disruption of menin–MLL-FP interactions or menin–MLL1/MLL2 interactions contribute to the antileukemia effect of menin inhibition. We show that Men1 deletion in MLL-AF9-transformed leukemia cells produces distinct cellular and molecular consequences compared with Mll1;Mll2 co-deletion and that compounds disrupting menin–MLL N-terminal interactions largely phenocopy menin loss. Moreover, we show that Mll1;Mll2-deficient leukemia cells exhibit enhanced sensitivity to menin interaction inhibitors, which is consistent with each regulating complementary genetic pathways. These data illustrate the heightened dependency of MLL-FPs on menin compared with wild-type MLL1/MLL2 for regulation of downstream target genes and argue that the predominant action of menin inhibitory compounds is through direct inhibition of MLL-FPs without significant contribution from MLL1/MLL2 inhibition. Patients with chromosomal translocations involving the Mixed Lineage Leukemia 1 gene (MLL, MLL1, KMT2A) represent an exception to overall favorable outcomes for children with acute leukemia [1Pui CH Yang JJ Hunger SP et al.Childhood acute lymphoblastic leukemia: progress through collaboration.J Clin Oncol. 2015; 33: 2938-2948Crossref PubMed Scopus (575) Google Scholar]. Menin, which is encoded by the Men1 gene, is a tumor suppressor in neuroendocrine tissues but is essential for MLL1 fusion oncoprotein (MLL-FP)-mediated leukemogenesis. MLL-FP binding to menin bridges an interaction with Lens Epithelium-Derived Growth Factor (LEDGF), which in turn binds histone H3 dimethyl lysine 36 (H3K36me2)-modified chromatin [2Yokoyama A Somervaille TC Smith KS Rozenblatt-Rosen O Meyerson M Cleary ML The menin tumor suppressor protein is an essential oncogenic cofactor for MLL-associated leukemogenesis.Cell. 2005; 123: 207-218Abstract Full Text Full Text PDF PubMed Scopus (418) Google Scholar, 3Zhu L Li Q Wong SH et al.ASH1L links histone H3 lysine 36 dimethylation to MLL leukemia.Cancer Discov. 2016; 6: 770-783Crossref PubMed Scopus (89) Google Scholar]. Menin also interacts with endogenous wild-type MLL1 and MLL2 [2Yokoyama A Somervaille TC Smith KS Rozenblatt-Rosen O Meyerson M Cleary ML The menin tumor suppressor protein is an essential oncogenic cofactor for MLL-associated leukemogenesis.Cell. 2005; 123: 207-218Abstract Full Text Full Text PDF PubMed Scopus (418) Google Scholar, 4Hughes CM Rozenblatt-Rosen O Milne TA et al.menin associates with a trithorax family histone methyltransferase complex and with the hoxc8 locus.Mol Cell. 2004; 13: 587-597Abstract Full Text Full Text PDF PubMed Scopus (501) Google Scholar, 5Milne TA Briggs SD Brock HW et al.MLL targets SET domain methyltransferase activity to Hox gene promoters.Mol Cell. 2002; 10: 1107-1117Abstract Full Text Full Text PDF PubMed Scopus (866) Google Scholar] with quantitative proteomics indicating nearly 1:1 stoichiometry of menin with MLL1 and MLL2 complexes [6van Nuland R Smits AH Pallaki P Jansen PW Vermeulen M Timmers HT Quantitative dissection and stoichiometry determination of the human SET1/MLL histone methyltransferase complexes.Mol Cell Biol. 2013; 33: 2067-2077Crossref PubMed Scopus (150) Google Scholar]. Because of the essential nature of the menin/LEDGF interaction for MLL-FPs to target to chromatin, small-molecule inhibitors have been developed that disrupt menin binding to the N-terminus of MLL-FPs [7Murai MJ Pollock J He S et al.The same site on the integrase-binding domain of lens epithelium-derived growth factor is a therapeutic target for MLL leukemia and HIV.Blood. 2014; 124: 3730-3737Crossref PubMed Scopus (26) Google Scholar, 8Borkin D He S Miao H et al.Pharmacologic inhibition of the menin-MLL interaction blocks progression of MLL leukemia in vivo.Cancer Cell. 2015; 27: 589-602Abstract Full Text Full Text PDF PubMed Scopus (232) Google Scholar, 9Grembecka J He S Shi A et al.menin–MLL inhibitors reverse oncogenic activity of MLL fusion proteins in leukemia.Nat Chem Biol. 2012; 8: 277-284Crossref PubMed Scopus (283) Google Scholar, 10Shi A Murai MJ He S et al.Structural insights into inhibition of the bivalent menin–MLL interaction by small molecules in leukemia.Blood. 2012; 120: 4461-4469Crossref PubMed Scopus (138) Google Scholar, 11Xu S Aguilar A Xu T et al.Design of the first-in-class, highly potent irreversible inhibitor targeting the menin–MLL protein–protein interaction.Angew Chem Int Ed Engl. 2018; 57: 1601-1605Crossref Scopus (41) Google Scholar]. Menin binds to MLL-FPs, MLL1, MLL2, and other proteins using the same pocket, so small-molecule inhibitors may disrupt all of these interactions in cells. To clarify through which pathways inhibitors of the menin–MLL N-terminus act, we compared cellular and molecular alterations in in MLL-AF9-transformed leukemia cells using genetic and pharmacologic manipulation of menin, Mll1, and Mll2. Lin–/Sca-1+/c-Kit+ (LSK) or c-Kit+ cells were sorted from Cre:ERT2;Mll1F/F;Mll2F/F and Cre:ERT2;Men1F/F mice and transduced with MSCV-MLL-AF9-YFP or MSCV-MLL-AF9-GFP (gifts from Drs. Scott Armstrong and Mick Milsom) as described previously [12Chen Y Anastassiadis K Kranz A et al.MLL2, not MLL1, plays a major role in sustaining MLL-rearranged acute myeloid leukemia.Cancer Cell. 2017; 31: 755-770Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar]. Transduced cells were replated in M3434 medium (StemCell Technologies) for more than four rounds to generate transformed cells. Quantitative real-time polymerase chain reaction (qRT-PCR) procedures were as described previously [12Chen Y Anastassiadis K Kranz A et al.MLL2, not MLL1, plays a major role in sustaining MLL-rearranged acute myeloid leukemia.Cancer Cell. 2017; 31: 755-770Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar] using the TaqMan Gene Expression Master Mix (Applied Biosystems) assays or primers as follows: Magohb: Applied Biosystems Mm01200054_m1; Mef2c: Applied Biosystems Mm01340842_m1; Gapdh: Applied Biosystems 4308313; Meis1: GAGCAAGGTGATGGCTTGGA and TGTCCTTATCAGGGTCATCATCG; Meis1 Probe: AACAGTGTAGCTTCCCCCAGCACAGGT. The following primer pairs were fused with SYBR Green Supermix (Bio-Rad): Pigp: TGCCCGTCTACCTCCTTATC and ATGGGGACATCTCTCAATGC. Jmjd1c: CACATTCTTGGATCTGTGACCA and ATGCTGTCTTTGCAGTTGAGG. Cdkn2c: AACCATCCCAGTCCTTCTGTCA and CCCCTTTCCTTTGCTCCT AATC. Il3ra: CTGGCATCCCACTCTTCAGAT and GGTC CCAGCTCAGTGTGTA. RNA-sequencing (RNA-seq) and Gene Set Enrichment Analysis (GSEA) were performed as described previously [12Chen Y Anastassiadis K Kranz A et al.MLL2, not MLL1, plays a major role in sustaining MLL-rearranged acute myeloid leukemia.Cancer Cell. 2017; 31: 755-770Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar] and the gene lists represented in the Venn diagrams and supplemental files represent data filtered for greater than twofold change and p < 0.05. Diagrams and overlap lists were generated using BioVenn [13Hulsen T de Vlieg J Alkema W BioVenn: a web application for the comparison and visualization of biological lists using area-proportional Venn diagrams.BMC Genomics. 2008; 9: 488Crossref PubMed Scopus (937) Google Scholar]. The RNA-seq data reported here have been deposited at the National Center for Biotechnology Information Gene Expression Omnibus with the accession code GSE117933. Proliferation was assessed by bromodeoxyuridine (BrdU) incorporation according to the manufacturer's protocol using the allophycocyanin (APC) BrdU Flow Kit (BD Biosciences) with a 30-minute incubation with BrdU. Cell viability was determined by propidium iodide (PI, Sigma-Aldrich) and Annexin V-APC (BioLegend) staining. Cre induction in leukemia cells was initiated in culture medium supplemented with 100 nmol/L 4-OHT (Sigma-Aldrich). After 24 hours, 4-OHT was removed by exchanging the medium and cells were cultured for the times indicated in the figure legends. Both MI-2 (Cayman) and MI-2-2 were dissolved in dimethylsulfoxide. Three thousand cells in 200 µL were treated with MI-2 or MI-2-2 for 3 days. Chemical synthesis and chemical characterization of MI-2 and MI-2-2 compounds have been described previously [9Grembecka J He S Shi A et al.menin–MLL inhibitors reverse oncogenic activity of MLL fusion proteins in leukemia.Nat Chem Biol. 2012; 8: 277-284Crossref PubMed Scopus (283) Google Scholar, 10Shi A Murai MJ He S et al.Structural insights into inhibition of the bivalent menin–MLL interaction by small molecules in leukemia.Blood. 2012; 120: 4461-4469Crossref PubMed Scopus (138) Google Scholar]. We recently showed that co-deletion of Mll1 and Mll2 in MLL-FP-transformed leukemia inhibited cell growth through modulation of several leukemia survival pathways [12Chen Y Anastassiadis K Kranz A et al.MLL2, not MLL1, plays a major role in sustaining MLL-rearranged acute myeloid leukemia.Cancer Cell. 2017; 31: 755-770Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar]. MLL-FPs have also been shown to directly regulate anti-apoptotic survival pathways [14Kerry J Godfrey L Repapi E et al.MLL-AF4 spreading identifies binding sites that are distinct from super-enhancers and that govern sensitivity to DOT1L inhibition in leukemia.Cell Rep. 2017; 18: 482-495Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar]. To deconvolute the contributions of MLL-FP versus MLL1/MLL2 inhibition that would occur with menin inhibitors, we compared the effect of deleting Men1 with that of co-deletion of Mll1 and Mll2. We selected the time points for analysis based on complete gene deletion and loss of the corresponding transcript (observed by 48 hours, Supplementary Figure E1A, online only, available at www.exphem.org). A severe reduction in S-phase cells was observed 5 days after initiating Men1 deletion (from 56% to 16%) concomitant with a G0/G1 accumulation (Figures 1A and 1B). In contrast, Mll1;Mll2 deletion resulted in milder reduction in S-phase cells (from 56% to 32%) and much larger accumulation of sub-G0/G1 cells. The selective effect on cell cycle may be due to the fact that Men1 deletion affects expression of the cyclin-dependent kinases CDK4 and CDK6 and Mll1;Mll2 deletion does not (Figures 1A and 1B, Supplementary Figure E1B, online only, available at www.exphem.org). Mll1;Mll2-deleted cells exhibited increased Annexin V binding and PI permeability at day 3, which accumulated over time (Figure 1C and data not shown), suggesting that cell death plays a larger role in the growth inhibition observed upon co-deletion of Mll1 and Mll2 [12Chen Y Anastassiadis K Kranz A et al.MLL2, not MLL1, plays a major role in sustaining MLL-rearranged acute myeloid leukemia.Cancer Cell. 2017; 31: 755-770Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar]. To broadly compare the molecular characteristics of Men1 versus Mll1;Mll2 deficiency, we performed side-by-side RNA-seq analysis in MLL-AF9-transformed cells at day 3 prior to the execution of cell cycle/cell death phenotypes. Men1 deletion resulted in both upregulated and downregulated genes (366 and 347 genes, respectively, Figure 1D and Supplemental Table E1, online only, available at www.exphem.org), whereas Mll1;Mll2 deletion resulted in fewer changes using the same criteria for data analysis (70 upregulated and 194 downregulated, Figure 1D). Comparison of Men1- versus Mll1;Mll2-deregulated genes showed minimal overlap of differentially expressed genes; only 12% of the downregulated genes and 7% of the upregulated genes in Men1-deficient leukemia cells were shared with Mll1;Mll2-deficient cells (Figure 1D). We performed qRT-PCR validation in MLL-AF9 cells focusing on MLL-FP-regulated genes or those unique to the MLL1/MLL2-regulated pathways [12Chen Y Anastassiadis K Kranz A et al.MLL2, not MLL1, plays a major role in sustaining MLL-rearranged acute myeloid leukemia.Cancer Cell. 2017; 31: 755-770Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar, 15Zuber J Rappaport AR Luo W et al.An integrated approach to dissecting oncogene addiction implicates a Myb-coordinated self-renewal program as essential for leukemia maintenance.Genes Dev. 2011; 25: 1628-1640Crossref PubMed Scopus (216) Google Scholar]. The MLL-FP targets Meis1 and Jmjd1c were significantly and reproducibly downregulated upon Men1 deletion, as was the menin-regulated gene Cdkn2c/p18, whereas expression of these genes changed minimally or not at all upon Mll1;Mll2 deletion (Figure 1E and Chen et al. [12Chen Y Anastassiadis K Kranz A et al.MLL2, not MLL1, plays a major role in sustaining MLL-rearranged acute myeloid leukemia.Cancer Cell. 2017; 31: 755-770Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar]). In contrast, the MLL2-regulated genes Magohb, Pigp, and Il3ra were downregulated by Mll1;Mll2 deletion and not Men1 deletion (Figure 1E). Men1 deletion specifically reduced the expression of MLL-AF9-bound, MLL-AF9 upregulated, and Dot1L-dependent genes, consistent with its role as a requisite binding partner of MLL-FPs (Figure 1F). In contrast, Mll1;Mll2 deletion did not significantly affect the same gene sets (Figure 2A). These results illustrate that Men1 deletion specifically affects MLL-FP activity rather than the combined activity of MLL-FPs and endogenous MLL1/MLL2 [15Zuber J Rappaport AR Luo W et al.An integrated approach to dissecting oncogene addiction implicates a Myb-coordinated self-renewal program as essential for leukemia maintenance.Genes Dev. 2011; 25: 1628-1640Crossref PubMed Scopus (216) Google Scholar, 16Bernt KM Zhu N Sinha AU et al.MLL-rearranged leukemia is dependent on aberrant H3K79 methylation by DOT1L.Cancer Cell. 2011; 20: 66-78Abstract Full Text Full Text PDF PubMed Scopus (668) Google Scholar]. Although loss of MLL1/MLL2 effectively kills MLL-AF9 cells, it apparently does so through distinct mechanisms and pathways compared with Men1 deletion. MLL-FPs lack the C-terminal chromatin-targeting motifs of wild-type MLL1 and MLL2 [17Ali M Hom RA Blakeslee W Ikenouye L Kutateladze TG Diverse functions of PHD fingers of the MLL/KMT2 subfamily.Biochim Biophys Acta. 2014; 1843: 366-371Crossref PubMed Scopus (53) Google Scholar, 18Milne TA Kim J Wang GG et al.Multiple interactions recruit MLL1 and MLL1 fusion proteins to the HOXA9 locus in leukemogenesis.Mol Cell. 2010; 38: 853-863Abstract Full Text Full Text PDF PubMed Scopus (161) Google Scholar, 19Couture JF Collazo E Trievel RC Molecular recognition of histone H3 by the WD40 protein WDR5.Nat Struct Mol Biol. 2006; 13: 698-703Crossref PubMed Scopus (190) Google Scholar], which may result in a stronger dependency on the N-terminal menin-LEDGF complex than wild-type MLL1 or MLL2.Figure 2Menin inhibitors phenocopy Men1 deletion and collaborate with Mll1;Mll2 loss to kill leukemia cells. (A) GSEA plots showing enrichment of MI-2-2-regulated genes [20Xu J Li L Xiong J et al.MLL1 and MLL1 fusion proteins have distinct functions in regulating leukemic transcription program.Cell Discov. 2016; 2: 16008Crossref PubMed Scopus (29) Google Scholar] in Men1-deleted MLL-AF9 cells and in Mll1;Mll2-deleted MLL-AF9 cells. (B) qRT-PCR of selected target genes after MI-2-2 treatment in MLL-AF9-transformed cells. Gene expression was determined 72 hours after treatment. Data are represented as averages ± standard deviation (SD). (C,D) Relative cell viability after and MI-2-2 (C) and MI-2 (D) treatment in MLL-AF9-transformed cells with or without Mll1;Mll2. MLL-AF9-transformed cells with the genotype of Cre+;Mll1F/F;Mll2F/F were treated with ethanol or 4-OHT for 24 hours, washed, and then treated with compound or vehicle for 3 additional days. Cell viabilities were all normalized to the corresponding vehicle (ethanol) control. Data are represented as mean ± SD. One representative experiment of two is shown.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Because menin and MLL1/MLL2 regulate distinct pathways, we hypothesized that Mll1;Mll2 co-deletion would be complementary to inhibition of the menin–MLL-FP interaction. Therefore, we tested the combined effect of Mll1;Mll2 deletion with the menin–MLL1 small-molecule inhibitor MI-2 and its higher-affinity variant MI-2-2 [9Grembecka J He S Shi A et al.menin–MLL inhibitors reverse oncogenic activity of MLL fusion proteins in leukemia.Nat Chem Biol. 2012; 8: 277-284Crossref PubMed Scopus (283) Google Scholar, 10Shi A Murai MJ He S et al.Structural insights into inhibition of the bivalent menin–MLL interaction by small molecules in leukemia.Blood. 2012; 120: 4461-4469Crossref PubMed Scopus (138) Google Scholar]. Comparing Men1 deletion with the previously described effect of MI-2-2 on murine MLL-AF9 cells [20Xu J Li L Xiong J et al.MLL1 and MLL1 fusion proteins have distinct functions in regulating leukemic transcription program.Cell Discov. 2016; 2: 16008Crossref PubMed Scopus (29) Google Scholar], MI-2-2-downregulated genes were significantly enriched in our Men1–/– AML data using GSEA (Normalized Enrichment Score [NES] >2.7, p < 0.001), whereas Mll1;Mll2 double-knockout genes were not (NES <1.5, p > 0.1; Figure 2A). Validation experiments using independently transformed MLL-AF9 cells showed that MI-2-2 inhibited expression of the direct MLL-FP target genes Meis1, Cdkn2c, Jmjd1c, and Mef2c, but not MLL2 target genes (Figure 2B). We therefore tested the sensitivity of Mll1;Mll2-deleted, MLL-AF9-transformed cells to menin inhibitors relative to the parental cells to determine whether inhibition of both pathways provided additional cell killing. Strikingly, Mll1;Mll2-deficient MLL-AF9-transformed cells showed a more than 10-fold increased sensitivity to both MI-2 and MI-2-2 (Figures 2C and 2D) [9Grembecka J He S Shi A et al.menin–MLL inhibitors reverse oncogenic activity of MLL fusion proteins in leukemia.Nat Chem Biol. 2012; 8: 277-284Crossref PubMed Scopus (283) Google Scholar, 10Shi A Murai MJ He S et al.Structural insights into inhibition of the bivalent menin–MLL interaction by small molecules in leukemia.Blood. 2012; 120: 4461-4469Crossref PubMed Scopus (138) Google Scholar]. Therefore, combined inhibition of menin and MLL1/MLL2 more effectively kills MLL-rearranged leukemia cells, likely due to their effects on distinct genetic networks. These data also predict that targeting MLL1/MLL2 in combination with other MLL-FP-directed strategies (e.g., DOT1L inhibitors) may result in synergistic killing of leukemia cells, similar to the demonstration that targeting MLL-FPs with two different molecular inhibitors can produce synergistic effects [21Dafflon C Craig VJ Méreau H et al.Complementary activities of DOT1L and menin inhibitors in MLL-rearranged leukemia.Leukemia. 2017; 31: 1269-1277Crossref PubMed Scopus (67) Google Scholar]. The observation that MLL-FPs are much more strongly dependent upon menin genetically or upon menin interaction (based on use of MI-2-2) demonstrates an interesting and perhaps unanticipated gained dependency by the fusion oncoprotein. This phenomenon may be attributed to the distinct multivalent chromatin interactions between MLL1 and is fusion oncoprotein derivatives, which may also be related to the observed spreading of both MLL-FPs and menin into gene bodies in MLL-FP-expressing cell lines [14Kerry J Godfrey L Repapi E et al.MLL-AF4 spreading identifies binding sites that are distinct from super-enhancers and that govern sensitivity to DOT1L inhibition in leukemia.Cell Rep. 2017; 18: 482-495Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar, 22Ruthenburg AJ Li H Patel DJ Allis CD Multivalent engagement of chromatin modifications by linked binding modules.Nat Rev Mol Cell Biol. 2007; 8: 983-994Crossref PubMed Scopus (816) Google Scholar]. Our data begin to unravel the nature of this gained dependency, but further molecular characterization will be required to completely understand the basis for the apparently selective effect of menin inhibitors on MLL-FPs and how menin inhibition can be combined with additional strategies to maximize the specificity and selectivity of its antileukemia activity. PE owns Amgen stock and has consulted for Servier Oncology. JG receives research support, has equity ownership in, and consults for Kura Oncology, Inc. YC is employed by Seattle Genetics, Inc. The remaining authors declare no competing financial interests. We thank Kathrin Bernt for critical comments and our laboratory members for discussion and critical comments. This work was sup ported by grants from the National Institutes of Health (HL090036 and CA224436 to PE and CA046934 and CA160467 to JG). YC performed most experiments and collected and analyzed data. YC and PE designed the experiments, interpreted data, and wrote the manuscript. YC and KLJ analyzed the RNA-seq data. MM, KA, AK, and AFS generated essential animal models. JG developed and provided the MI-2-2 compound. Download .xlsx (.08 MB) Help with xlsx files Download .pdf (.18 MB) Help with pdf files" @default.
• W2895804881 created "2018-10-26" @default.
• W2895804881 creator A5005157412 @default.
• W2895804881 creator A5013095460 @default.
• W2895804881 creator A5056373767 @default.
• W2895804881 creator A5058017510 @default.
• W2895804881 creator A5074488634 @default.
• W2895804881 creator A5075707322 @default.
• W2895804881 creator A5080568394 @default.
• W2895804881 creator A5087616533 @default.
• W2895804881 date "2019-01-01" @default.
• W2895804881 modified "2023-10-15" @default.
• W2895804881 title "Distinct pathways affected by menin versus MLL1/MLL2 in MLL-rearranged acute myeloid leukemia" @default.
• W2895804881 cites W1979187818 @default.
• W2895804881 cites W1982315838 @default.
• W2895804881 cites W1990739246 @default.
• W2895804881 cites W2005909602 @default.
• W2895804881 cites W2022662964 @default.
• W2895804881 cites W2025014803 @default.
• W2895804881 cites W2027913461 @default.
• W2895804881 cites W2037856618 @default.
• W2895804881 cites W2053964757 @default.
• W2895804881 cites W2069918359 @default.
• W2895804881 cites W2122914905 @default.
• W2895804881 cites W2122958542 @default.
• W2895804881 cites W2125277492 @default.
• W2895804881 cites W2127976626 @default.
• W2895804881 cites W2151718828 @default.
• W2895804881 cites W2154218976 @default.
• W2895804881 cites W2346511653 @default.
• W2895804881 cites W2406490019 @default.
• W2895804881 cites W2554624179 @default.
• W2895804881 cites W2567975067 @default.
• W2895804881 cites W2625393357 @default.
• W2895804881 cites W2777307770 @default.
• W2895804881 doi "https://doi.org/10.1016/j.exphem.2018.10.001" @default.
• W2895804881 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/6472707" @default.
• W2895804881 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/30315824" @default.
• W2895804881 hasPublicationYear "2019" @default.
• W2895804881 type Work @default.
• W2895804881 sameAs 2895804881 @default.
• W2895804881 citedByCount "12" @default.
• W2895804881 countsByYear W28958048812019 @default.
• W2895804881 countsByYear W28958048812020 @default.
• W2895804881 countsByYear W28958048812021 @default.
• W2895804881 countsByYear W28958048812022 @default.
• W2895804881 countsByYear W28958048812023 @default.
• W2895804881 crossrefType "journal-article" @default.
• W2895804881 hasAuthorship W2895804881A5005157412 @default.
• W2895804881 hasAuthorship W2895804881A5013095460 @default.
• W2895804881 hasAuthorship W2895804881A5056373767 @default.
• W2895804881 hasAuthorship W2895804881A5058017510 @default.
• W2895804881 hasAuthorship W2895804881A5074488634 @default.
• W2895804881 hasAuthorship W2895804881A5075707322 @default.
• W2895804881 hasAuthorship W2895804881A5080568394 @default.
• W2895804881 hasAuthorship W2895804881A5087616533 @default.
• W2895804881 hasBestOaLocation W28958048811 @default.
• W2895804881 hasConcept C2778461978 @default.
• W2895804881 hasConcept C2778729363 @default.
• W2895804881 hasConcept C2779282312 @default.
• W2895804881 hasConcept C502942594 @default.
• W2895804881 hasConcept C54355233 @default.
• W2895804881 hasConcept C71924100 @default.
• W2895804881 hasConcept C86803240 @default.
• W2895804881 hasConceptScore W2895804881C2778461978 @default.
• W2895804881 hasConceptScore W2895804881C2778729363 @default.
• W2895804881 hasConceptScore W2895804881C2779282312 @default.
• W2895804881 hasConceptScore W2895804881C502942594 @default.
• W2895804881 hasConceptScore W2895804881C54355233 @default.
• W2895804881 hasConceptScore W2895804881C71924100 @default.
• W2895804881 hasConceptScore W2895804881C86803240 @default.
• W2895804881 hasFunder F4320332161 @default.
• W2895804881 hasLocation W28958048811 @default.
• W2895804881 hasLocation W28958048812 @default.
• W2895804881 hasLocation W28958048813 @default.
• W2895804881 hasLocation W28958048814 @default.
• W2895804881 hasOpenAccess W2895804881 @default.
• W2895804881 hasPrimaryLocation W28958048811 @default.
• W2895804881 hasRelatedWork W1493011226 @default.
• W2895804881 hasRelatedWork W1974032072 @default.
• W2895804881 hasRelatedWork W200513925 @default.
• W2895804881 hasRelatedWork W2414586291 @default.
• W2895804881 hasRelatedWork W2419389668 @default.
• W2895804881 hasRelatedWork W2560841524 @default.
• W2895804881 hasRelatedWork W2791968852 @default.
• W2895804881 hasRelatedWork W2909695583 @default.
• W2895804881 hasRelatedWork W3207807551 @default.
• W2895804881 hasRelatedWork W4308735896 @default.
• W2895804881 hasVolume "69" @default.
• W2895804881 isParatext "false" @default.
• W2895804881 isRetracted "false" @default.
• W2895804881 magId "2895804881" @default.
• W2895804881 workType "article" @default.