FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2897296916> ?p ?o ?g. }

• W2897296916 endingPage "2296" @default.
• W2897296916 startingPage "2287" @default.
• W2897296916 abstract "Production of 25-hydroxycholesterol (25HC), a potent inhibitor of viral infection, is catalyzed by cholesterol 25-hydroxylase (CH25H). We previously reported that 25HC induced CH25H expression in a liver X receptor (LXR)-dependent manner, implying that LXR can play an important role in antiviral infection. In this study, we determined that activation of LXR by 25HC or synthetic ligands [T0901317 (T317) or GW3965] inhibited infection of herpes simplex virus type 1 (HSV-1) or MLV-(VSV)-GFP in HepG2 cells or RAW 264.7 macrophages. Genetic deletion of LXRα, LXRβ, or CH25H expression in HepG2 cells by CRISPR/Cas9 method increased cell susceptibility to HSV-1 infection and attenuated the inhibition of LXR on viral infection. Lack of interferon (IFN)-γ expression also increased cell susceptibility to viral infection. However, it attenuated, but did not block, the inhibition of LXR on HSV-1 infection. In addition, expression of CH25H, but not IFN-γ, was inversely correlated to cell susceptibility to viral infection and the antiviral actions of LXR. Metabolism of 25HC into 25HC-3-sulfate (25HC3S) by cholesterol sulfotransferase-2B1b moderately reduced the antiviral actions of 25HC because 25HC3S is a weaker inhibitor of HSV-1 infection than 25HC. Furthermore, administration of T317 to BALB/c mice reduced HSV-1 growth in mouse tissues. Taken together, we demonstrate an antiviral system of 25HC with involvement of LXR activation, interaction between CH25H and IFN-γ, and 25HC metabolism. Production of 25-hydroxycholesterol (25HC), a potent inhibitor of viral infection, is catalyzed by cholesterol 25-hydroxylase (CH25H). We previously reported that 25HC induced CH25H expression in a liver X receptor (LXR)-dependent manner, implying that LXR can play an important role in antiviral infection. In this study, we determined that activation of LXR by 25HC or synthetic ligands [T0901317 (T317) or GW3965] inhibited infection of herpes simplex virus type 1 (HSV-1) or MLV-(VSV)-GFP in HepG2 cells or RAW 264.7 macrophages. Genetic deletion of LXRα, LXRβ, or CH25H expression in HepG2 cells by CRISPR/Cas9 method increased cell susceptibility to HSV-1 infection and attenuated the inhibition of LXR on viral infection. Lack of interferon (IFN)-γ expression also increased cell susceptibility to viral infection. However, it attenuated, but did not block, the inhibition of LXR on HSV-1 infection. In addition, expression of CH25H, but not IFN-γ, was inversely correlated to cell susceptibility to viral infection and the antiviral actions of LXR. Metabolism of 25HC into 25HC-3-sulfate (25HC3S) by cholesterol sulfotransferase-2B1b moderately reduced the antiviral actions of 25HC because 25HC3S is a weaker inhibitor of HSV-1 infection than 25HC. Furthermore, administration of T317 to BALB/c mice reduced HSV-1 growth in mouse tissues. Taken together, we demonstrate an antiviral system of 25HC with involvement of LXR activation, interaction between CH25H and IFN-γ, and 25HC metabolism. 25-Hydroxycholesterol (25HC) is produced in cells by an enzymatic reaction catalyzed by cholesterol 25-hydroxylase (CH25H). 25HC can function as an inhibitor of viral infection and an endogenous agonist of liver X receptor (LXR), a ligand-activated transcription factor. The previous studies have demonstrated the multiple biological functions of 25HC. For instance, CH25H expression and 25HC production are involved in immunological processes (1.Cyster J.G. Dang E.V. Reboldi A. Yi T. 25-Hydroxy­cholesterols in innate and adaptive immunity.Nat. Rev. Immunol. 2014; 14: 731-743Crossref PubMed Scopus (217) Google Scholar). Stimulation of macrophage Toll-like receptors can induce CH25H expression and consequently enhance 25HC production/secretion and suppress immunoglobulin A production (2.Bauman D.R. Bitmansour A.D. McDonald J.G. Thompson B.M. Liang G. Russell D.W. 25-Hydroxycholesterol secreted by macrophages in response to Toll-like receptor activation suppresses immunoglobulin A production.Proc. Natl. Acad. Sci. USA. 2009; 106: 16764-16769Crossref PubMed Scopus (234) Google Scholar). CH25H expression in bone marrow-derived dendritic cells and macrophages can be upregulated by interferons (IFNs) (3.Park K. Scott A.L. Cholesterol 25-hydroxylase production by dendritic cells and macrophages is regulated by type I interferons.J. Leukoc. Biol. 2010; 88: 1081-1087Crossref PubMed Scopus (161) Google Scholar). This finding results in the identification of CH25H as one of the IFN-stimulated genes and 25HC as a potent inhibitor of viral infection (4.Liu S.Y. Aliyari R. Chikere K. Li G. Marsden M.D. Smith J.K. Pernet O. Guo H. Nusbaum R. Zack J.A. et al.Interferon-inducible cholesterol-25-hydroxylase broadly inhibits viral entry by production of 25-hydroxycholesterol.Immunity. 2013; 38: 92-105Abstract Full Text Full Text PDF PubMed Scopus (416) Google Scholar, 5.Blanc M. Hsieh W.Y. Robertson K.A. Kropp K.A. Forster T. Shui G. Lacaze P. Watterson S. Griffiths S.J. Spann N.J. et al.The transcription factor STAT-1 couples macrophage synthesis of 25-hydroxycholesterol to the interferon antiviral response.Immunity. 2013; 38: 106-118Abstract Full Text Full Text PDF PubMed Scopus (270) Google Scholar). In vitro, 25HC can inhibit growth of multiple viruses in cells by blocking viral entry. The inhibition of viral infection by IFNs is also related to induction of CH25H expression and 25HC production (4.Liu S.Y. Aliyari R. Chikere K. Li G. Marsden M.D. Smith J.K. Pernet O. Guo H. Nusbaum R. Zack J.A. et al.Interferon-inducible cholesterol-25-hydroxylase broadly inhibits viral entry by production of 25-hydroxycholesterol.Immunity. 2013; 38: 92-105Abstract Full Text Full Text PDF PubMed Scopus (416) Google Scholar, 5.Blanc M. Hsieh W.Y. Robertson K.A. Kropp K.A. Forster T. Shui G. Lacaze P. Watterson S. Griffiths S.J. Spann N.J. et al.The transcription factor STAT-1 couples macrophage synthesis of 25-hydroxycholesterol to the interferon antiviral response.Immunity. 2013; 38: 106-118Abstract Full Text Full Text PDF PubMed Scopus (270) Google Scholar). In vivo, CH25H-deficient mice are more susceptible to viral infection than wild-type mice (4.Liu S.Y. Aliyari R. Chikere K. Li G. Marsden M.D. Smith J.K. Pernet O. Guo H. Nusbaum R. Zack J.A. et al.Interferon-inducible cholesterol-25-hydroxylase broadly inhibits viral entry by production of 25-hydroxycholesterol.Immunity. 2013; 38: 92-105Abstract Full Text Full Text PDF PubMed Scopus (416) Google Scholar). 25HC also functions as an amplifier of inflammatory signaling via the activator protein 1 signaling pathway (6.Gold E.S. Diercks A.H. Podolsky I. Podyminogin R.L. Askovich P.S. Treuting P.M. Aderem A. 25-Hydroxycholesterol acts as an amplifier of inflammatory signaling.Proc. Natl. Acad. Sci. USA. 2014; 111: 10666-10671Crossref PubMed Scopus (163) Google Scholar) and mediates the negative-feedback pathway of IFN signaling on interleukin 1 family cytokine production and inflammasome activity (7.Reboldi A. Dang E.V. McDonald J.G. Liang G. Russell D.W. Cyster J.G. Inflammation. 25-Hydroxycholesterol suppresses interleukin-1-driven inflammation downstream of type I interferon.Science. 2014; 345: 679-684Crossref PubMed Scopus (299) Google Scholar). Besides antiviral infection (4.Liu S.Y. Aliyari R. Chikere K. Li G. Marsden M.D. Smith J.K. Pernet O. Guo H. Nusbaum R. Zack J.A. et al.Interferon-inducible cholesterol-25-hydroxylase broadly inhibits viral entry by production of 25-hydroxycholesterol.Immunity. 2013; 38: 92-105Abstract Full Text Full Text PDF PubMed Scopus (416) Google Scholar, 5.Blanc M. Hsieh W.Y. Robertson K.A. Kropp K.A. Forster T. Shui G. Lacaze P. Watterson S. Griffiths S.J. Spann N.J. et al.The transcription factor STAT-1 couples macrophage synthesis of 25-hydroxycholesterol to the interferon antiviral response.Immunity. 2013; 38: 106-118Abstract Full Text Full Text PDF PubMed Scopus (270) Google Scholar, 8.Anggakusuma I. Romero-Brey C. Berger C.C. Colpitts T. Boldanova M. Engelmann D. Todt P.M. Perin P. Behrendt F.W. Vondran et al.Interferon-inducible cholesterol-25-hydroxylase restricts hepatitis C virus replication through blockage of membranous web formation.Hepatology. 2015; 62: 702-714Crossref PubMed Scopus (66) Google Scholar, 9.Chen Y. Wang S. Yi Z. Tian H. Aliyari R. Li Y. Chen G. Liu P. Zhong J. Chen X. et al.Interferon-inducible cholesterol-25-hydroxylase inhibits hepatitis C virus replication via distinct mechanisms.Sci. Rep. 2014; 4: 7242Crossref PubMed Scopus (73) Google Scholar, 10.Xiang Y. Tang J.J. Tao W. Cao X. Song B.L. Zhong J. Identification of cholesterol 25-hydroxylase as a novel host restriction factor and a part of the primary innate immune responses against hepatitis C virus infection.J. Virol. 2015; 89: 6805-6816Crossref PubMed Scopus (61) Google Scholar, 11.Li C. Deng Y.Q. Wang S. Ma F. Aliyari R. Huang X.Y. Zhang N.N. Watanabe M. Dong H.L. Liu P. et al.25-Hydroxycholesterol protects host against Zika virus infection and its associated microcephaly in a mouse model.Immunity. 2017; 46: 446-456Abstract Full Text Full Text PDF PubMed Scopus (216) Google Scholar), 25HC can regulate lipid/cholesterol metabolism by interacting with sterol regulatory element-binding proteins or LXR (12.Hong C. Tontonoz P. Liver X receptors in lipid metabolism: opportunities for drug discovery.Nat. Rev. Drug Discov. 2014; 13: 433-444Crossref PubMed Scopus (408) Google Scholar). LXR plays various biological roles, particularly in lipid metabolism (13.Calkin A.C. Tontonoz P. Transcriptional integration of metabolism by the nuclear sterol-activated receptors LXR and FXR.Nat. Rev. Mol. Cell Biol. 2012; 13: 213-224Crossref PubMed Scopus (539) Google Scholar). Binding of a ligand to LXR results in formation of a heterodimer between LXR and retinoid X receptor (RXR), the LXR/RXR complex. The LXR/RXR complex then binds to the LXR response elements in the promoter and initiates transcription of the target genes (14.Repa J.J. Mangelsdorf D.J. The role of orphan nuclear receptors in the regulation of cholesterol homeostasis.Annu. Rev. Cell Dev. Biol. 2000; 16: 459-481Crossref PubMed Scopus (604) Google Scholar). Previously, we identified several LXR response elements in the CH25H promoter, and found that both 25HC and synthetic LXR ligand [T0901317 (T317) or GW3965] induced CH25H expression in different cell types. Furthermore, treatment of mice with GW3965 increased CH25H expression in liver and peritoneal macrophages (15.Liu Y. Wei Z. Ma X. Yang X. Chen Y. Sun L. Ma C. Miao Q.R. Hajjar D.P. Han J. et al.25-Hydroxycholesterol activates the expression of cholesterol 25-hydroxylase in an LXR-dependent mechanism.J. Lipid Res. 2018; 59: 439-451Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar). Expression of CH25H can be activated by IFNs (4.Liu S.Y. Aliyari R. Chikere K. Li G. Marsden M.D. Smith J.K. Pernet O. Guo H. Nusbaum R. Zack J.A. et al.Interferon-inducible cholesterol-25-hydroxylase broadly inhibits viral entry by production of 25-hydroxycholesterol.Immunity. 2013; 38: 92-105Abstract Full Text Full Text PDF PubMed Scopus (416) Google Scholar). Interestingly, we have reported that LXR activation induced IFN-γ expression, particularly in macrophages (16.Wang Q. Ma X. Chen Y. Zhang L. Jiang M. Li X. Xiang R. Miao R. Hajjar D.P. Duan Y. et al.Identification of interferon-gamma as a new molecular target of liver X receptor.Biochem. J. 2014; 459: 345-354Crossref PubMed Scopus (27) Google Scholar). Administration of LXR ligand to mice inhibited xenograft- or carcinogen-induced tumor growth in an IFN-γ-dependent manner (16.Wang Q. Ma X. Chen Y. Zhang L. Jiang M. Li X. Xiang R. Miao R. Hajjar D.P. Duan Y. et al.Identification of interferon-gamma as a new molecular target of liver X receptor.Biochem. J. 2014; 459: 345-354Crossref PubMed Scopus (27) Google Scholar, 17.Wang Q. Sun L. Yang X. Ma X. Li Q. Chen Y. Liu Y. Zhang D. Li X. Xiang R. et al.Activation of liver X receptor inhibits the development of pulmonary carcinomas induced by 3-methylcholanthrene and butylated hydroxytoluene in BALB/c mice.Sci. Rep. 2016; 6: 27295Crossref PubMed Scopus (12) Google Scholar, 18.Ma X. Wang Q. Liu Y. Chen Y. Zhang L. Jiang M. Li X. Xiang R. Miao R.Q. Duan Y. et al.Inhibition of tumor growth by U0126 is associated with induction of interferon-gamma production.Int. J. Cancer. 2015; 136: 771-783Crossref PubMed Scopus (11) Google Scholar). 25HC can be further metabolized into 25HC-3-sulfate (25HC3S) in a reaction catalyzed by cholesterol sulfotransferase-2B1b (SULT2B1b) (19.Li X. Pandak W.M. Erickson S.K. Ma Y. Yin L. Hylemon P. Ren S. Biosynthesis of the regulatory oxysterol, 5-cholesten-3beta,25-diol 3-sulfate, in hepatocytes.J. Lipid Res. 2007; 48: 2587-2596Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar). Taken together, these studies suggest that LXR activation, interaction between CH25H and IFN-γ, and 25HC metabolism may form an antiviral system that can regulate 25HC production and its antiviral actions, with the central role played by LXR. 25HC was purchased from Sigma-Aldrich (St. Louis, MO). GW3965 and T317 were purchased from Cayman Chemical (Ann Arbor, MI). 25HC3S was purchased from Avanti Polar Lipids (Alabaster, AL). Human LXRα siRNA and LXRβ siRNA, rabbit anti-CH25H polyclonal antibody, mouse anti-α-tubulin, and GAPDH monoclonal antibodies were purchased from Santa Cruz Biotechnology (Dallas, TX). Rabbit anti-herpes simplex virus type 1 (HSV-1) protein polyclonal antibody was purchased from Dako Inc. (Agilent, Santa Clara, CA); rabbit anti-LXRα, -LXRβ, -IFN-γ, and -SULT2B1b polyclonal antibodies were purchased from Proteintech (Chicago, IL). RAW 264.7 cells (a murine macrophage cell line) and HepG2 cells (a human hepatic cell line) were purchased from ATCC (Manassas, VA) and cultured in complete RPMI 1640 and DMEM medium containing 10% FBS, 50 μg/ml streptomycin, 100 units/ml penicillin, and 2 mM glutamine, respectively. Primary hepatocytes were isolated from male C57BL/6 mice and IFN-γ-deficient (IFN-γ−/−) mice (C57BL/6 background) as described (20.Zhou X. Yin Z. Guo X. Hajjar D.P. Han J. Inhibition of ERK1/2 and activation of liver X receptor synergistically induce macrophage ABCA1 expression and cholesterol efflux.J. Biol. Chem. 2010; 285: 6316-6326Abstract Full Text Full Text PDF PubMed Scopus (78) Google Scholar, 21.Yao L. Wang C. Zhang X. Peng L. Liu W. Zhang X. Liu Y. He J. Jiang C. Ai D. et al.Hyperhomocysteinemia activates the aryl hydrocarbon receptor/CD36 pathway to promote hepatic steatosis in mice.Hepatology. 2016; 64: 92-105Crossref PubMed Scopus (51) Google Scholar). HSV-1 (F strain) and MLV-(VSV)-GFP pseudotyped viruses were kindly provided by Dr. Bing He from the University of Illinois at Chicago (Chicago, IL) and Dr. Wentao Qiao from Nankai University (Tianjin, China), respectively. Total RNA was extracted from cells followed by cDNA synthesis as described (22.Ma X. Liu Y. Wang Q. Chen Y. Liu M. Li X. Xiang R. Wei Y. Duan Y. Han J. Tamoxifen induces the development of hernia in mice by activating MMP-2 and MMP-13 expression.Biochim. Biophys. Acta. 2015; 1852: 1038-1048Crossref PubMed Scopus (14) Google Scholar). Real-time PCR was conducted using SYBR Green PCR Master Mix (Bio-Rad) and the following primers: CH25H forward, 5′-ATGTTGACCACGTGGAAGGT-3′ and CH25H reverse, 5′-TGGGAACTGTTTTCTTTGGG-3′ GAPDH forward, 5′-ACAACTTTGGCATTGTGAA-3′ and GAPDH reverse, 5′-GATGCAGGGATGATGTTCTG-3′. CH25H mRNA expression was normalized to GAPDH mRNA in the corresponding samples. After treatment, cellular proteins were extracted. Expression of CH25H, LXRα, LXRβ, IFN-γ, SULT2B1b protein, and total HSV-1 proteins in cellular lysate was determined by Western blot as described (15.Liu Y. Wei Z. Ma X. Yang X. Chen Y. Sun L. Ma C. Miao Q.R. Hajjar D.P. Han J. et al.25-Hydroxycholesterol activates the expression of cholesterol 25-hydroxylase in an LXR-dependent mechanism.J. Lipid Res. 2018; 59: 439-451Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar). Expression of GAPDH or α-tubulin was determined as loading control. After treatment, levels of HSV-1 proteins in intact HepG2 cells were determined by immunofluorescent staining as described (23.Zhang L. Chen Y. Yang X. Yang J. Cao X. Li X. Li L. Miao Q.R. Hajjar D.P. Duan Y. et al.MEK1/2 inhibitors activate macrophage ABCG1 expression and reverse cholesterol transport-an anti-atherogenic function of ERK1/2 inhibition.Biochim. Biophys. Acta. 2016; 1861: 1180-1191Crossref PubMed Scopus (18) Google Scholar). Briefly, cells were fixed with 4% paraformaldehyde for 30 min, washed with PBS for 10 min, and permeabilized in 0.5% Triton X-100/PBS for 10 min. Cells were then blocked with 2% BSA for 2 h at room temperature. After incubation with rabbit anti-HSV-1 protein antibody overnight at 4°C, cells were incubated with FITC-conjugated secondary antibody for 2 h. Cells were then stained with DAPI solution to detect the nucleus followed by observation and photographs with a fluorescence microscope (Leica, Wetzlar, Germany). Cells were pretreated with LXR ligand for 24 h followed by infection with HSV-1 for 2 h. After washing with PBS, cells were cultured in fresh complete medium or medium containing LXR ligand for 16 h. Cells were then lysed, followed by determination of HSV-1 proteins in cellular lysate by Western blot. The HSV-1-infected HepG2 cells were also used to determine infecting viruses by immunofluorescent staining with anti-HSV-1 protein antibody and the protocol as described above. The inhibition of LXR ligand on HSV-1 infection in HepG2 cells was also determined by viral plaque formation assay. HepG2 cells were pretreated with 25HC or T317 for 24 h followed by HSV-1 infection for 2 h. After removal of viruses, HepG2 cells were treated with 25HC or T317 for the indicated times. The infected HepG2 cells were harvested and the infecting viruses in HepG2 cells were released by repeated freezing and thawing. The cellular lysate was collected as the source of viruses. The collected viruses were diluted with 199v medium and then added to the monolayer of Vero cells. After viral growth for more than 24 h, Vero cells were observed under a microscope and the plaques formed were counted. The virus titers were calculated and normalized by the dilution factor. The infecting MLV-(VSV)-GFP pseudotyped viruses in HepG2 cells were determined by two methods, image assay and fluorescence-activated cell sorting (FACS) assay, based on the fact that the viruses were labeled with GFP. In an image assay, after infection, the virus-infected cells are observed under a fluorescence microscope and the cells' images are photographed. In a FACS assay, the infected cells are applied to an FACS machine to quantify infected cells, using the negative control cells (uninfected HepG2) as the set for gating. In this study, after infection and treatment, HepG2 cells were collected and then observed under a fluorescence microscope. Images of cells with fluorescence or phase contrast were photographed. For FACS assay, cells were harvested and subjected to the FACS machine directly to quantify cells containing GFP. Based on the gate with negative control cells, the percentage of MLV-(VSV)-GFP pseudotyped virus-infected cells out of total cells was determined. HepG2 cells lacking LXRα, LXRβ, CH25H, or SULT2B1 expression were established using the clustered regulatory interspaced short palindromic repeat (CRISPR)/CRISPR-associated protein 9 (Cas9) technology, respectively (24.Ran F.A. Hsu P.D. Wright J. Agarwala V. Scott D.A. Zhang F. Genome engineering using the CRISPR-Cas9 system.Nat. Protoc. 2013; 8: 2281-2308Crossref PubMed Scopus (6461) Google Scholar). The guide sequence was designed based on the online CRISPR Design Tool (http://tools.genome-engineering.org), and the sequences of the guide oligos are listed in Table 1. After ligation, HepG2 cells were transfected with plasmid of pSpCas9 (BB)-2A-Puro vector or vector ligated with guide oligos, respectively. The selection of mutated clonal cell lines was completed using the standard protocol (24.Ran F.A. Hsu P.D. Wright J. Agarwala V. Scott D.A. Zhang F. Genome engineering using the CRISPR-Cas9 system.Nat. Protoc. 2013; 8: 2281-2308Crossref PubMed Scopus (6461) Google Scholar), and the knockout of target genes was confirmed by Western blot. The cells lacking LXRα, LXRβ, CH25H, or SULT2B1b expression were defined as CRISPR-LXRα, CRISPR-LXRβ, CRISPR-CH25H, or CRISPR-SULT2B1b cells, while the corresponding control cells were defined as CRISPR-Ctrl cells.TABLE 1Sequences of the single guide RNA for CRISPR/Cas9 systemGene Name20 nt Guide SequenceLXRα (NR1H3)TCGGCTTCGCAAATGCCGTCLXRβ (NR1H2)ACCCCGGCAGGCATAGCGCCCH25HCAGGCAAAAGCCCACGTATGSULT2B1bTGTCGTCGTCCCGCACATCT Open table in a new tab The protocols for in vivo study with mice were approved by the Ethics Committee of Nankai University (Tianjin, China) and conform to the Guide for the Care and Use of Laboratory Animals published by the National Institutes of Health. BALB/c mice (∼6 weeks old) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China) and maintained at the Animal Center of Nankai University with free access to water and food. The mice were randomly divided into three groups and received the following treatment: mice in groups 1 and 2 were fed normal chow, and the mice in group 3 were fed normal chow containing T317 (5 mg/day/kg bodyweight) for 4 days. Mice in group 1 were then intraperitoneally injected with PBS (as a mock); mice in groups 2 and 3 were intraperitoneally injected with HSV-1 (5 × 105 PFU/mouse). Mice in groups 1 and 2 continued to be fed normal chow, while the mice in group 3 were fed normal chow containing T317. Seven days after viral injection, all the mice were euthanized. Mouse peritoneal fluid was first collected by lavage with PBS (2 ml/mouse), and it was named “peritoneal washing fluid (PWF)”. Liver and brain samples were then collected individually. A piece of liver or brain stem was weighed and then homogenized in PBS (0.1 g/ml). HSV-1 in PWF or homogenates of liver or brain stem were released by repeated freezing and thawing, the viral titers in mouse tissues were determined by the plaque formation assay as described above. All experiments were repeated at least three times, and the representative results are presented. Data are presented as mean ± SEM and were analyzed by two-tailed unpaired Student's t-test or post hoc test of one-way ANOVA analysis. The difference was considered significant if P < 0.05. CH25H has been identified as an antiviral molecule because it catalyzes the production of 25HC, a potent antiviral small chemical. In addition, CH25H is an IFN-inducible molecule (4.Liu S.Y. Aliyari R. Chikere K. Li G. Marsden M.D. Smith J.K. Pernet O. Guo H. Nusbaum R. Zack J.A. et al.Interferon-inducible cholesterol-25-hydroxylase broadly inhibits viral entry by production of 25-hydroxycholesterol.Immunity. 2013; 38: 92-105Abstract Full Text Full Text PDF PubMed Scopus (416) Google Scholar, 5.Blanc M. Hsieh W.Y. Robertson K.A. Kropp K.A. Forster T. Shui G. Lacaze P. Watterson S. Griffiths S.J. Spann N.J. et al.The transcription factor STAT-1 couples macrophage synthesis of 25-hydroxycholesterol to the interferon antiviral response.Immunity. 2013; 38: 106-118Abstract Full Text Full Text PDF PubMed Scopus (270) Google Scholar). Interestingly, we have reported that expression of hepatic CH25H or macrophage IFN-γ can be activated by LXR (15.Liu Y. Wei Z. Ma X. Yang X. Chen Y. Sun L. Ma C. Miao Q.R. Hajjar D.P. Han J. et al.25-Hydroxycholesterol activates the expression of cholesterol 25-hydroxylase in an LXR-dependent mechanism.J. Lipid Res. 2018; 59: 439-451Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar, 16.Wang Q. Ma X. Chen Y. Zhang L. Jiang M. Li X. Xiang R. Miao R. Hajjar D.P. Duan Y. et al.Identification of interferon-gamma as a new molecular target of liver X receptor.Biochem. J. 2014; 459: 345-354Crossref PubMed Scopus (27) Google Scholar). Based on the above studies, we hypothesized that LXR activation may play an important role in antiviral infection by activating CH25H expression. To test this, we initially infected HepG2 cells with HSV-1 and determined CH25H expression in response to viral infection. In contrast to the previous report that indicates viral infection can activate macrophage CH25H mRNA expression (5.Blanc M. Hsieh W.Y. Robertson K.A. Kropp K.A. Forster T. Shui G. Lacaze P. Watterson S. Griffiths S.J. Spann N.J. et al.The transcription factor STAT-1 couples macrophage synthesis of 25-hydroxycholesterol to the interferon antiviral response.Immunity. 2013; 38: 106-118Abstract Full Text Full Text PDF PubMed Scopus (270) Google Scholar), we found that HSV-1 infection had little effect on hepatic CH25H protein expression (Fig. 1A). This difference may be due to the fact that macrophages are a major cell type expressing IFNs, and viral infection to macrophages can induce IFN production, which, in turn, induces CH25H mRNA expression (5.Blanc M. Hsieh W.Y. Robertson K.A. Kropp K.A. Forster T. Shui G. Lacaze P. Watterson S. Griffiths S.J. Spann N.J. et al.The transcription factor STAT-1 couples macrophage synthesis of 25-hydroxycholesterol to the interferon antiviral response.Immunity. 2013; 38: 106-118Abstract Full Text Full Text PDF PubMed Scopus (270) Google Scholar). Meanwhile, HSV-1 infection had little effect on 25HC- or T317-induced CH25H expression in HepG2 cells (Fig. 1B). Next, we determined that pretreatment of HepG2 cells with 25HC or T317 reduced cellular HSV-1 protein levels in a dose-dependent manner with the greater effect by 25HC indicating either of them inhibits HSV-1 infection (Fig. 1C). The greater inhibition by 25HC than T317 should be partially attributed to the action of exogenously added 25HC. The results of immunofluorescent staining of cellular HSV-1 proteins show that the fluorescent intensity was substantially reduced by 25HC or T317 (Fig. 1D), which directly demonstrates that LXR activation inhibits viral infection. To further determine inhibition of HSV-1 growth by 25HC or T317, the 25HC- or T317-pretreated HepG2 cells were infected with HSV-1, and then continually exposed to 25HC or T317 for different times. The viruses collected from the above HepG2 cells were added to Vero cells for 36 h and the formed plaques were counted. The results of the virus titer assay shown in Fig. 1E confirm that 25HC and T317 inhibited viral growth in HepG2 cells dose dependently. To determine the effect of LXR on infection of other viruses in HepG2 cells, the pretreated HepG2 cells with LXR ligand were infected with MLV-(VSV)-GFP pseudotyped viruses. Because MLV-(VSV)-GFP pseudotyped viruses are labeled with GFP, we are able to determine viral infection using either image assay or FACS assay. As shown in Fig. 2A, B, LXR ligands (25HC, T317, or GW3965) inhibited growth of MLV-(VSV)-GFP pseudotyped viruses in a dose-dependent manner. To determine the role of LXR or CH25H expression in antiviral infection, we selectively inhibited LXR or CH25H expression by transfecting cells with the corresponding siRNA. Indeed, inhibition of LXR or CH25H expression by siRNA increased the cells' susceptibility to MLV-(VSV)-GFP pseudotyped virus infection, while the inhibition of viral infection by T317 or 25HC was attenuated (Fig. 2C, D). We created HepG2 cells lacking either LXRα or LXRβ expression by CRISPR-Cas9 method (right half of Fig. 3A, D) and infected control HepG2 cells or LXRα or LXRβ knockout HepG2 cells with HSV-1. Compared with CRISPR-Ctrl cells, more viral infection was determined in CRISPR-LXRα or CRISPR-LXRβ cells (Fig. 3A, D) indicating that deficiency of LXRα or LXRβ expression increased cell susceptibility to HSV-1 infection. 25HC substantially inhibited HSV-1 infection in CRISPR-Ctrl cells. However, the inhibition was clearly attenuated in cells lacking LXRα or LXRβ expression (Fig. 3B, E). The results in Fig. 3C and F demonstrate that although T317 moderately inhibited HSV-1 infection in CRISPR-Ctrl cells, it had little effect on viral infection in CRISPR-LXRα or CRISPR-LXRβ cells. The reduced inhibition or noninhibition of viral infection by 25HC or T317 was due to the induction of CH25H expression being impaired in CRISPR-LXRα or CRISPR-LXRβ cells (Fig. 3B, C, E, F) (15.Liu Y. Wei Z. Ma X. Yang X. Chen Y. Sun L. Ma C. Miao Q.R. Hajjar D.P. Han J. et al.25-Hydroxycholesterol activates the expression of cholesterol 25-hydroxylase in an LXR-dependent mechanism.J. Lipid Res. 2018; 59: 439-451Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar). The direct evidence demonstrating the importance of LXR-induced CH25H expression in 25HC-inhibited viral infection was obtained by the following experiment. HepG2 cells lacking CH25H expression (CRISPR-CH25H cells, Fig. 3G) were cultured in fresh medium for 24 h. The conditioned media were collected from CRISPR-Ctrl and CRISPR-CH25H cells, respectively, and then used to culture HSV-1 pre-infected HepG2 cells for 16 h. Compared with cells cultured in nonconditioned medium, reduced HSV-1 growth was determined in cells cultured in the conditioned medium collected from CRISPR-Ctrl cells. However, little reduction of HSV-1 growth was determined in the cells cultured in the conditioned medium collected from CRISPR-CH25H cells (Fig. 3H). The reduced viral growth in cells cultured in the conditioned medium collected from CRISPR-Ctrl cells should be attributed to the secreted 25HC. Similar to CRISPR-LXRα or CRISPR-LXRβ cells, inhibition of HSV-1 infection by 25HC or T317 was substantially reduced in CRISPR-CH25H cells (Fig. 3I, J). To compare the effects of LXRα, LXRβ, and CH25H expression on cell susceptibility to HSV-1 infection, CRISPR-Ctrl, CRISPR-LXRα, CRISPR-LXRβ, or CRISPR" @default.
• W2897296916 created "2018-10-26" @default.
• W2897296916 creator A5001017107 @default.
• W2897296916 creator A5002771707 @default.
• W2897296916 creator A5005205790 @default.
• W2897296916 creator A5007205089 @default.
• W2897296916 creator A5019613770 @default.
• W2897296916 creator A5027231505 @default.
• W2897296916 creator A5028875731 @default.
• W2897296916 creator A5031338308 @default.
• W2897296916 creator A5059838901 @default.
• W2897296916 creator A5060165452 @default.
• W2897296916 creator A5060454242 @default.
• W2897296916 creator A5072663357 @default.
• W2897296916 creator A5082117229 @default.
• W2897296916 date "2018-12-01" @default.
• W2897296916 modified "2023-10-18" @default.
• W2897296916 title "Activation of liver X receptor plays a central role in antiviral actions of 25-hydroxycholesterol" @default.
• W2897296916 cites W1970058349 @default.
• W2897296916 cites W1977709885 @default.
• W2897296916 cites W1982195228 @default.
• W2897296916 cites W1984391988 @default.
• W2897296916 cites W1998477311 @default.
• W2897296916 cites W2005911243 @default.
• W2897296916 cites W2009801812 @default.
• W2897296916 cites W2012397588 @default.
• W2897296916 cites W2038363528 @default.
• W2897296916 cites W2042429611 @default.
• W2897296916 cites W2046686885 @default.
• W2897296916 cites W2072517432 @default.
• W2897296916 cites W2081832076 @default.
• W2897296916 cites W2087709414 @default.
• W2897296916 cites W2089818689 @default.
• W2897296916 cites W2094212146 @default.
• W2897296916 cites W2104360930 @default.
• W2897296916 cites W2105164671 @default.
• W2897296916 cites W2113504004 @default.
• W2897296916 cites W2119448646 @default.
• W2897296916 cites W2131195043 @default.
• W2897296916 cites W2152725356 @default.
• W2897296916 cites W2153237652 @default.
• W2897296916 cites W2155385401 @default.
• W2897296916 cites W2157038552 @default.
• W2897296916 cites W2160613537 @default.
• W2897296916 cites W2292026162 @default.
• W2897296916 cites W2413059833 @default.
• W2897296916 cites W2464955316 @default.
• W2897296916 cites W2598033793 @default.
• W2897296916 cites W2782174944 @default.
• W2897296916 doi "https://doi.org/10.1194/jlr.m084558" @default.
• W2897296916 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/6277154" @default.
• W2897296916 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/30309895" @default.
• W2897296916 hasPublicationYear "2018" @default.
• W2897296916 type Work @default.
• W2897296916 sameAs 2897296916 @default.
• W2897296916 citedByCount "20" @default.
• W2897296916 countsByYear W28972969162019 @default.
• W2897296916 countsByYear W28972969162020 @default.
• W2897296916 countsByYear W28972969162021 @default.
• W2897296916 countsByYear W28972969162022 @default.
• W2897296916 countsByYear W28972969162023 @default.
• W2897296916 crossrefType "journal-article" @default.
• W2897296916 hasAuthorship W2897296916A5001017107 @default.
• W2897296916 hasAuthorship W2897296916A5002771707 @default.
• W2897296916 hasAuthorship W2897296916A5005205790 @default.
• W2897296916 hasAuthorship W2897296916A5007205089 @default.
• W2897296916 hasAuthorship W2897296916A5019613770 @default.
• W2897296916 hasAuthorship W2897296916A5027231505 @default.
• W2897296916 hasAuthorship W2897296916A5028875731 @default.
• W2897296916 hasAuthorship W2897296916A5031338308 @default.
• W2897296916 hasAuthorship W2897296916A5059838901 @default.
• W2897296916 hasAuthorship W2897296916A5060165452 @default.
• W2897296916 hasAuthorship W2897296916A5060454242 @default.
• W2897296916 hasAuthorship W2897296916A5072663357 @default.
• W2897296916 hasAuthorship W2897296916A5082117229 @default.
• W2897296916 hasBestOaLocation W28972969161 @default.
• W2897296916 hasConcept C170493617 @default.
• W2897296916 hasConcept C185592680 @default.
• W2897296916 hasConcept C55493867 @default.
• W2897296916 hasConcept C86803240 @default.
• W2897296916 hasConcept C95444343 @default.
• W2897296916 hasConcept C98274493 @default.
• W2897296916 hasConceptScore W2897296916C170493617 @default.
• W2897296916 hasConceptScore W2897296916C185592680 @default.
• W2897296916 hasConceptScore W2897296916C55493867 @default.
• W2897296916 hasConceptScore W2897296916C86803240 @default.
• W2897296916 hasConceptScore W2897296916C95444343 @default.
• W2897296916 hasConceptScore W2897296916C98274493 @default.
• W2897296916 hasFunder F4320321001 @default.
• W2897296916 hasFunder F4320321540 @default.
• W2897296916 hasIssue "12" @default.
• W2897296916 hasLocation W28972969161 @default.
• W2897296916 hasLocation W28972969162 @default.
• W2897296916 hasLocation W28972969163 @default.
• W2897296916 hasOpenAccess W2897296916 @default.
• W2897296916 hasPrimaryLocation W28972969161 @default.
• W2897296916 hasRelatedWork W1531601525 @default.
• W2897296916 hasRelatedWork W2050316456 @default.

• next