FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2897707989> ?p ?o ?g. }

• W2897707989 endingPage "450.e11" @default.
• W2897707989 startingPage "447" @default.
• W2897707989 abstract "Atopic dermatitis (AD) is a common chronic inflammatory disease of childhood. Up to 60% of cases appear during the first year of life, and most resolve during the first few years.1Weidinger S. Novak N. Atopic dermatitis.Lancet. 2016; 387: 1109-1122Abstract Full Text Full Text PDF PubMed Scopus (1154) Google Scholar The skin of patients with AD is characterized by several abnormalities in barrier function, including altered lipid composition, decreased number of tight junctions, altered protease activity, and altered antimicrobial activity.2Agrawal R. Woodfolk J.A. Skin barrier defects in atopic dermatitis.Curr Allergy Asthma Rep. 2014; 14: 433Crossref PubMed Scopus (112) Google Scholar The dual exposure to allergen hypothesis suggests that tolerance to antigens occurs in the neonate through high-dose oral exposure and allergen sensitization occurs through low-dose cutaneous exposure.3Renz H. Allen K.J. Sicherer S.H. Sampson H.A. Lack G. Beyer K. et al.Food allergy.Nat Rev Dis Primers. 2018; 4: 17098Crossref PubMed Scopus (180) Google Scholar This makes AD a gateway for the allergic march, highlighting the importance of preventing infantile AD. However, little is known about the initial changes that specifically occur in keratinocytes and lead to barrier dysfunction. MicroRNAs (miRNAs), which are short noncoding RNAs involved in posttranscriptional gene regulation, have been implicated in the pathogenesis of many diseases, including allergic diseases.4de Aguiar Vallim T.Q. Tarling E.J. Kim T. Civelek M. Baldán Á. Esau C. et al.MicroRNA-144 regulates hepatic ATP binding cassette transporter A1 and plasma high-density lipoprotein after activation of the nuclear receptor farnesoid X receptor.Circ Res. 2013; 112: 1602-1612Crossref PubMed Scopus (145) Google Scholar In this study we aimed to understand whether serum miRNAs expressed in the perinatal period could influence the development of AD in infancy. The samples for this study were obtained from a birth cohort at high risk for allergic diseases (unpublished data). Details of the cohort study are provided in the Methods section in this article's Online Repository at www.jacionline.org. To identify miRNA changes seen in maternal serum (MS) and umbilical cord serum (CS) of children with AD, we selected a nested case-control population of 36 children who did (AD) or did not (No AD) have AD at 1 year of age and their mothers using propensity score matching. The baseline characteristics of the infants and their mothers in the nested case-control population were similar to those of the cohort population (see Table E1, Table E2 in this article's Online Repository at www.jacionline.org). First, we determined the expression levels of 179 miRNAs in CS and MS using quantitative PCR (qPCR). The pool of change in cycle threshold (dCt) values obtained from qPCR was subjected to Orthogonal Projections to Latent Structures Discriminant Analysis (OPLS-DA) to understand the association between miRNAs in CS and MS and to distinguish between miRNAs that might or might not be associated with AD. Fig 1, A, shows the distinct expression patterns of miRNAs in CS and MS, describing 32.7% (R2X = 0.327) of the variation in X and 96.3% (R2Y = 0.963) of the variation in Y and predicting 93.3% (Q2Y = 0.933) of the variation in Y. Because OPLS-DA analysis could not distinguish miRNA profiles for the AD and No AD groups, we analyzed miRNAs in CS and MS separately and identified 24 miRNAs in CS and 23 in MS with a variable importance in projection (VIP) score of 1.5 or more that were independently associated with the development of AD (Fig 1, B, and see Table E3 in this article's Online Repository at www.jacionline.org). Because there was no association between miRNA expression in MS and CS, suggesting that maternal miRNAs might not have a direct effect on the baby (see Fig E1 in this article's Online Repository at www.jacionline.org), we further evaluated the candidate miRNAs in CS. Comparison of their expression levels in the AD and No AD groups showed that hsa-miR-144-3p (miR-144) expression was increased in CS of children with AD at 1 year of age. This change was not seen in MS or in serum at 1 year of age (Fig 1, C). As miR-144 expression in CS was not associated with total IgE levels at 1 year of age (see Fig E2 in this article's Online Repository at www.jacionline.org), miR-144 might play a role in the pathogenesis of AD independent of atopic status. Therefore we focused on the role of miR-144 in keratinocytes. Using Web-based software (microRNA.org, TargetScan, and miRBase), we identified ATP-binding cassette transporter A1 (ABCA1) as a target of miR-144. ABCA1 is involved in cholesterol efflux from cells, and miR-144 has been shown to downregulate ABCA1 levels, leading to cholesterol accumulation within cells.4de Aguiar Vallim T.Q. Tarling E.J. Kim T. Civelek M. Baldán Á. Esau C. et al.MicroRNA-144 regulates hepatic ATP binding cassette transporter A1 and plasma high-density lipoprotein after activation of the nuclear receptor farnesoid X receptor.Circ Res. 2013; 112: 1602-1612Crossref PubMed Scopus (145) Google Scholar To observe the effect of miR-144 on ABCA1 mRNA expression in keratinocytes, we transfected neonatal human primary epithelial keratinocytes (referred to hereafter as keratinocytes) with miR-144. Transfected keratinocytes showed decreased ABCA1 mRNA expression (see Fig E3, A, in this article's Online Repository at www.jacionline.org), decreased ABCA1 protein levels, and cholesterol accumulation (see Fig E3, B), demonstrating the role of miR-144 in disrupting the cholesterol composition of the cell membrane in keratinocytes. ABCA1 knockout in macrophages has been shown to exaggerate cytokine responses to TLR agonists through nuclear factor κB (NF-κB) and activator protein-1 signaling.5Zhu X. Lee J.Y. Timmins J.M. Brown J.M. Boudyguina E. Mulya A. et al.Increased cellular free cholesterol in macrophage-specific Abca1 knock-out mice enhances pro-inflammatory response of macrophages.J Biol Chem. 2008; 283: 22930-22941Crossref PubMed Scopus (285) Google Scholar In response to stimulation with house dust mite (HDM) extract, miR-144–transfected keratinocytes increased nuclear translocation of the NF-κB p65 subunit (Fig 2, A). We next looked at molecules downstream of NF-κB activation that might play a role in the pathogenesis of AD. As reported previously, stimulation of AD skin with HDM induces the expression of many cytokines and inflammatory markers, including IL-17A and the antimicrobial peptide human β-defensin (hBD) 2 encoded by DEFB4A.6Malik K. Ungar B. Garcet S. Dutt R. Dickstein D. Zheng X. et al.Dust mite induces multiple polar T cell axes in human skin.Clin Exp Allergy. 2017; 47: 1648-1660Crossref PubMed Scopus (21) Google Scholar Although hBDs at low concentrations can eliminate cutaneous pathogens, at high concentrations, they act as chemoattractants to TH2 cells and promote mast cell degranulation.7Chieosilapatham P. Ogawa H. Niyonsaba F. Current insights into the role of human β-defensins in atopic dermatitis.Clin Exp Immunol. 2017; 190: 155-166Crossref PubMed Scopus (34) Google Scholar When we looked at the mRNA expression of several antimicrobial peptides in keratinocytes, only hBD-2 mRNA levels showed a significant increase in response to miR-144 and HDM stimulation (Fig 2, B, and see Fig E4 in this article's Online Repository at www.jacionline.org). This was also seen in response to IL-17A stimulation (Fig 2, B, and see Fig E5 in this article's Online Repository at www.jacionline.org) and was abrogated by means of coincubation with JSH-23, a specific inhibitor of p65 translocation (Fig 2, B). We could not detect mRNA expression of CXCL1 and CXCL2 with HDM or IL-17A stimulation. To look at immune-related pathways activated by IL-17A, we evaluated the mRNA expression of STAT3, IL-23p19, SERPINB3, and SERPINB4. In response to miR-144 and IL-17A, SERPINB3 and SERPINB4 showed a significant increase in mRNA expression. This increase was also inhibited by JSH-23, showing that both molecules were downstream of IL-17A–mediated NF-κB activation (Fig 2, C). SERPINB4, a known enhancer of cell growth and inhibitor of apoptosis, has been shown to be important in initiating allergen-induced acute skin inflammation in a mouse model, with more recent studies correlating serum SERPINB4 with AD severity and serum thymus and activation-regulated chemokine levels in pediatric age groups.8Sivaprasad U. Kinker K.G. Ericksen M.B. Lindsey M. Gibson A.M. Bass S.A. et al.SERPINB3/B4 contributes to early inflammation and barrier dysfunction in an experimental murine model of atopic dermatitis.J Invest Dermatol. 2015; 135: 160-169Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar, 9Nagao M. Inagaki S. Kawano T. Azuma Y. Nomura N. Noguchi Y. et al.SCCA2 is a reliable biomarker for evaluating pediatric atopic dermatitis.J Allergy Clin Immunol. 2018; 141: 1934-1936.e11Abstract Full Text Full Text PDF PubMed Scopus (17) Google Scholar These results show that increased miR-144 can activate the NF-κB pathway, leading to an increase in hBD-2 and SERPINB4, 2 molecules that have a proinflammatory role in AD. Although this study is limited by being in vitro, these findings raise the possibility that miR-144 might be able to decrease the threshold for skin inflammation and provide preliminary insight into what prompts early-life AD. We thank Drs Hiroyuki Nakamura, Naohiro Hashimoto, and Risa Yamazaki for assistance with filipin staining and Dr Yusuke Endo for assistance with transfection experiments. The Chiba High risk Birth Cohort for Allergy study of newborn infants with a family history of allergic disease was set up in Seikei-kai Chiba Medical Center and Chiba University Hospital in Chiba, one of the prefectures around the Tokyo region, from January 2010 to December 2011. This study protocol was approved by the Bioethics Review Committee, Faculty of Medicine, Chiba University, Japan (approval no. 754). The study was advertised by use of a poster at the above hospitals, and all women attending the above hospitals who were at 34 weeks of gestation and who themselves, whose partner, and/or whose children had any allergic diseases, such as AD, asthma, allergic rhinitis, and/or food allergies, were invited to participate in the study. The eligibility criteria were as follows: (1) Japanese ethnicity, (2), parent or parents and/or sibling or siblings of the expected child had 1 or more allergic diseases, or (3) not having or expected to have any severe congenital abnormalities, such as congenital heart disease. The mothers and their expected babies were enrolled in the study after obtaining informed consent. After the birth of the study subjects, we reconfirmed the subject's eligibility, and there were no babies excluded because of congenital abnormalities. We did not exclude babies with any perinatal abnormalities. Guardians were requested by letter to take the study subjects to each clinic at 1 month, 6 months, 1 year, and 2 years of age for physical examinations. At 1 month, 6 months, 1 year, and 2 years of age, the guardians of the study subjects were interviewed about the health of their children (symptoms or a diagnosis of allergic diseases), breast-feeding, exposure to second-hand tobacco smoke at home, and exposure to dogs or cats. The diagnosis of wheezing was made based on a history of 3 or more episodes of wheezing or by the subject's family doctor. Diagnosis of both allergic rhinitis and food allergies was made by the subject's family doctor. Physical examinations were performed at 1 month and 6 months of age by Dr Naoki Shimojo at Chiba University Hospital or Dr Hiroko Suzuki at Seikei-kai Chiba Medical Center. Diagnosis of infantile eczema was made based on physical examination, history of itchy eczema on the face by 6 months of age, or both. Physical examination of all participants was repeated at 1 and 2 years of age by Dr Naoki Shimojo at Chiba University Hospital, and a diagnosis of AD was made by using guidelines for the management of AD by the Japanese Dermatological Association. Blood samples were collected from mothers at 36 weeks of gestation, and cord blood and blood samples at 1 and 2 years of age were collected from infants. Serum samples were stored at −30°C within 24 hours of collection until measurement of allergen-specific IgE. Levels of specific IgE to Dermatophagoides farinae, cat dander, and Japanese cedar pollen in MS and those to egg white, milk, D farinae, cat dander, and Japanese cedar pollen in CS and children's sera at 1 and 2 years of age were measured by using ImmunoCAP. A specific IgE level of greater than 0.7 UA/mL was considered positive. Neonatal human primary epithelial keratinocytes (referred to hereafter as keratinocytes) were obtained from CELLnTEC Advanced Cell Systems AG (Bern, Switzerland). The cells were cultured in CnT-Prime medium (CELLnTEC, Bern, Switzerland). All cells tested negative for Mycoplasma species. A human miR-144 mimic (C-300612-05-0002), an miRNA positive control for glyceraldehyde-3-phosphate dehydrogenase (CP-001000-02-05), and an miRNA-negative control (CN-001000-01-05) were purchased from Dharmacon (Horizon Discovery, Cambridge, United Kingdom). Keratinocytes were transfected with miRNAs by using the Lipofectamine RNAiMAX Transfection Reagent (Invitrogen, Carlsbad, Calif), according to the manufacturer's instructions. Briefly, keratinocytes were seeded to reach 60% to 80% confluency at transfection. For triplicates on a 24-well plate, the Lipofectamine RNAiMAX reagent was diluted in 50 μL of Opti-MEM medium (Gibco, Grand Island, NY) and added to 3 μL of the 10 mmol/L miRNA diluted in 50 μL of Opti-MEM, so that the final amount of miRNA in each well was 5 pmol. Cells were incubated with the miRNAs for 24 to 48 hours. Keratinocytes were stimulated with 25 μg/mL freeze-dried HDM (D farinae) or 200 ng/mL recombinant human IL-17A (BioLegend, San Diego, Calif) for a further 24 hours after transfection and then used for qPCR and immunostaining. The freeze-dried HDM extract was kindly provided by Torii Pharmaceutical (Tokyo, Japan). Total RNA was extracted from serum by using the miRNeasy Serum/Plasma Kit (Qiagen, Hilden, Germany). Initial screening of samples for candidate miRNAs was done with the Exiqon Serum/Plasma Focus microRNA PCR Panel, 96-well (V4.MI), which contains assays for 179 individual miRNAs (Exiqon, Vedbaek, Denmark). Total RNA was extracted from all cell types by using the miRCURY RNA Isolation Kit–Cell & Plant (Exiqon). cDNA was synthesized by using SuperScript III First-Strand Synthesis SuperMix (Invitrogen), and real-time PCR was performed with the QuantiTect SYBR Green PCR kit (Qiagen) on a CFX Connect Real-Time System (Bio-Rad Laboratories, Hercules, Calif). Primer sequences used in the study are listed in Table E4. Keratinocytes were grown to 60% to 70% confluence on glass coverslips and fixed in 4% paraformaldehyde for 10 minutes. Cells were permeabilized with 0.3% saponin for 20 minutes, washed, and blocked with 3% BSA in PBS for 1 hour. Cells were stained overnight with a 1:200 dilution of rabbit polyclonal antibodies to ABCA1 (ab7360; Abcam, Cambridge, United Kingdom). Goat polyclonal Alexa Fluor 488–conjugated antibodies to rabbit IgG (ab150077; Abcam) were used as secondary antibodies and incubated for 1 hour at a 1:300 dilution. Staining for cholesterol was done for a further 30 minutes with a working solution of 0.05 mg/mL Filipin III (CAS 480-49-9; Cayman Chemical, Ann Arbor, Mich) dissolved in dimethyl sulfoxide and diluted in PBS. Imaging was done on a Keyence BZ-X700 (Keyence, Osaka, Japan). Keratinocytes were grown on coverslips as for fluorescence microscopy, as mentioned above. Forty-eight hours after transfection, the cells were coincubated for 24 hours with 25 μg/mL HDM extract and 15 nmol of the NK-κB p65 inhibitor JSH-23 (Calbiochem, Merck, Germany) or 200 ng/mL rIL-17A (BioLegend) and 50 nmol of JSH-23. Cells were stained overnight with a 1:200 dilution of rabbit mAbs to the NF-κB p65 subunit (#8242; Cell Signaling Technology, Danvers, Mass). Goat polyclonal Alexa Fluor 488–conjugated antibodies to rabbit IgG (ab150077; Abcam) were used as secondary antibodies at a 1:300 dilution for 1 hour of staining. Cells were stained with a 300 nmol/L solution of 4′-6-diamidino-2-phenylindole dihydrochloride for 5 minutes. Imaging was done on a Keyence BZ-X700 microscope (Keyence). When comparing the baseline characteristics of study participants, maternal age, parity, body mass index, gestational age, and birth weight were compared by using the Student t test, and serum total IgE levels were compared with the Mann-Whitney test (2-sided). Other variables were compared by using the Pearson χ2 test. A P value less than .05 was considered significant. These analyses were performed with the SAS program (version 19.0; SPSS, Chicago, Ill). The OPLS-DA method was used for discrimination between MS and CS and the AD and No AD groups by using SIMCA 13 (Umetrics, Umeå, Sweden). R2 and Q2 values were calculated, where R2 shows the dispersion of the data from the model and Q2 shows the predicted variance in the data. The term Q2 was calculated by using 7-fold cross-validation. miRNAs with a variable importance in projection score of greater than 1.5 were considered to be influential for the separation of groups in the OPLS-DA analysis. Statistical analysis for results from in vitro experiments was done on GraphPad Prism 6.0f software. All data are shown as means ± SEMs. Mann-Whitney and Wilcoxon tests were used for comparison of groups (2-sided). All results shown are representative of 3 independent experiments.Fig E2miR-144 levels in CS are not related to total IgE levels in serum at 1 year of age. miR-144 levels in CS were plotted against serum total IgE levels at 1 year of age. There was no correlation between the levels. dCt, Change in cycle threshold.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig E3miR-144 transfection decreases ABCA1 expression in keratinocytes. A, Keratinocytes were transfected with miR-144 for 24 to 72 hours. ABCA1 mRNA levels were quantified by using qPCR. B, Keratinocytes grown in medium only or transfected with miR-144 for 24 and 48 hours were stained with Alexa Fluor 488 for ABCA1 (green) and filipin for cholesterol (blue).View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig E4mRNA levels of antimicrobial peptides induced by means of HDM stimulation of keratinocytes. Keratinocytes were incubated with 25 μg/mL HDM for 24 hours with or without miR-144 transfection for 48 hours. mRNA levels were quantified by using qPCR. Results show means ± SEMs pooled over 3 independent experiments.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig E5mRNA levels of antimicrobial peptides induced by IL-17A stimulation of keratinocytes. Keratinocytes were incubated with 200 ng/mL IL-17A for 24 hours with or without miR-144 transfection for 48 hours. mRNA levels were quantified by using qPCR. Results show means ± SEMs pooled over 3 independent experiments.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Table E1Baseline characteristics of the infants and their mothers in the cohort population and the nested case-control population defined by using propensity score matchingCohort population (n = 268), mean ± SD (%)Study population (n = 36), mean ± SD (%)P valueMaternal characteristics Age33.51 ± 4.6734.25 ± 4.66.357 Parity1.55 ± 0.711.64 ± 0.87.769 History of AD25.027.8.688 History of other allergic diseases86.683.3.608 BMI before pregnancy21.43 ± 3.1621.6 ± 2.83.502 BMI during pregnancy25.06 ± 3.1225.29 ± 2.96.577 Total IgE210.87 ± 508.29104.94 ± 135.07.213 Affected by AD1.52.8.470 Affected by bronchial asthma2.28.3.078Infant characteristics Sex (girls)50.441.7.377 Cesarean section29.530.61.000 Gestational age (wk)38.88 ± 1.3938.61 ± 1.23.180 Birth weight (g)3026 ± 360.763023.00 ± 317.47.830 Total IgE at birth0.74 ± 1.530.4 ± 0.46.051 Total IgE at 1 y45.22 ± 84.5646.92 ± 75.63.849Maternal age, parity, BMI, gestational age, and birth weight were all compared by using the Student t test, and serum total IgE levels were compared by using the Mann-Whitney test. Other variables were compared by using the Pearson χ2 test.BMI, Body mass index. Open table in a new tab Table E2Background information of the nested case-control populationCase IDInfantsMothersSexGestational age (wk)Birth weight (g)Total IgE (IU/mL)ADMaternal age (y)History of ADHistory of allergic diseaseADAsthmaTotal IgE (IU/mL)C019Boy3727100.32+40−+−−305.0C038Girl3928480.19−26−+−−12.8C051Boy3826600.09−36−+−−2.5C052Girl3831800.64+31−+−−136.0C062Boy4132440.08+36−+−−6.8C066Boy3830121.34+30+++−80.4C069Girl3929560.10+26++−−11.3C070Boy3833800.13−35−+−−10.0K007Boy3829520.04−40−−−−2.5K008Girl3831900.26+25−+−+62.5K013Boy3927061.98+39−−−−48.4K032Boy3930820.28+31−−−−87.8K040Boy3624640.31−37−+−−31.1K045Boy3824120.29−36−+−−131.0K059Girl3829900.04−38++−−9.6K074Girl4029120.18+33++−−48.0K078Boy3631100.45+39−+−−104.0K079Boy3833900.10−38−+−−13.2K083Girl3926420.04−30++−−13.6K085Boy3937120.70+39−−−−123.0K095Boy3929840.13+36−+−−11.4K102Boy4035080.30−35−−−−144.0K107Boy3835220.50−42++−−187.0K112Boy3826040.25+30−+−−126.0K132Boy4032020.17+38−+−−42.3K138Boy3732740.22+27++−−113.0K144Boy4135360.11+34−+−+27.6K146Girl3728020.30−30−+−+304.0K180Girl4028900.62−28−+−−688.0K196Girl3928320.04+40−−−−2.5K197Girl4031900.23+37++−−104.0K199Girl3929400.65−39−+−−255.0K205Girl4034680.26−36−+−−14.2K207Girl3827701.15−35++−−313.0K209Boy3829041.67−31++−−165.0K228Girl4028500.16−30−+−−41.4 Open table in a new tab Table E3miRNAs associated with development of AD at 1 year of agemiRNAs in MB (n = 36)miRNAs in CB (n = 36)VIP scoreVIP SECoefficientVIP scoreVIP SECoefficienthsa-miR-301a-3p2.8541.5940.051hsa-miR-361-3p2.5121.7260.046hsa-miR-133b2.7320.713−0.054hsa-miR-144-3p2.5000.811−0.037hsa-miR-133a2.6761.019−0.049hsa-miR-195-5p2.4841.7060.043hsa-miR-424-5p2.4070.5380.031hsa-miR-150-5p2.2570.7330.039hsa-miR-27b-3p2.2561.3410.030hsa-miR-423-3p2.1911.4050.042hsa-miR-485-3p2.1960.4370.020hsa-miR-146b-5p1.8160.8260.028hsa-miR-148b-3p2.1460.7600.031let-7i-5p1.8030.5150.034hsa-miR-142-3p1.9920.7490.021hsa-miR-30d-5p1.7581.9340.024hsa-miR-101-3p1.9430.5470.017hsa-miR-1071.7491.398−0.030hsa-miR-15a-5p1.9370.9670.020hsa-miR-500a-5p1.7321.143−0.030hsa-miR-296-5p1.9330.914−0.025hsa-miR-151a-3p1.7172.2350.014hsa-miR-1281.9121.2300.018hsa-miR-200c-3p1.7061.5560.039hsa-miR-21-5p1.8660.9840.010hsa-miR-162-3p1.6991.5180.025hsa-miR-141-3p1.8541.3290.019hsa-miR-191-5p1.6881.6180.025hsa-miR-30d-5p1.8121.9020.028hsa-miR-532-3p1.6820.521−0.020hsa-miR-191-5p1.7850.715−0.019let-7g-5p1.6780.8660.021hsa-miR-320a1.7801.1260.017hsa-miR-181a-5p1.6601.3410.022hsa-miR-154-5p1.7750.892−0.029hsa-miR-342-3p1.6481.0380.028hsa-miR-382-5p1.7761.037−0.026hsa-miR-133a1.5931.996−0.032hsa-miR-126-3p1.6541.0240.010hsa-miR-505-3p1.5751.1780.028hsa-miR-2151.6540.6300.016hsa-miR-335-5p1.5442.0760.018hsa-miR-3751.6261.3340.027hsa-miR-376a-3p1.5102.1770.025hsa-miR-766-3p1.6181.255−0.018hsa-miR-6051.5092.093−0.033let-7i-3p1.5390.9180.025OPLS-DA was used to identify miRNAs associated with the development of AD at 1 year of age. The miRNAs in CS and MS with a VIP score of greater than 1.5 were selected as candidates for further analysis.VIP, Variable importance in projection. Open table in a new tab Table E4Sequences of primers used in the studyGeneNucleotide sequence (5' → 3')ABCA1 SenseGCAAGGCTACCAGTTACATTTG Anti-senseGTCAGAAACATCACCTCCTGhBD-2 SenseTCCTCTTCTCGTTCCTCTTCATATTC Anti-senseTTAAGGCAGGTAACAGGATCGChBD-3 SenseGCTGCCTTCCAAAGGAGGA Anti-senseTTCTTCGGCAGCATTTTCGLL-37 SenseGCAGTCACCAGAGGATTGTGAC Anti-senseCACCGCTTCACCAGCCCS100A7 SenseACGTGATGACAAGATTGACAAGC Anti-senseGCGAGGTAATTTGTGCCCTTTS100A8 SenseATGCCGTCTACAGGGATGAC Anti-senseACTGAGGACACTCGGTCTCTAS100A9 SenseGGTCATAGAACACATCATGGAGG Anti-senseGGCCTGGCTTATGGTGGTGS100A12 SenseAGCATCTGGAGGGAATTGTCA Anti-senseGCAATGGCTACCAGGGATATGAACXCL1 SenseGGACTTCACGTTCACACTTTG Anti-senseAACCGAAGTCATAGCCACACCXCL2 SenseAGGAACAGCCACCAATAAGC Anti-senseCCACTCACCTCTTCAGAACGCXCL3 SenseTGCTGTACCAAGAGTTTGCTC Anti-senseCGCACACAGACAACTTTTTCTTTCCL20 SenseTGCTGTACCAAGAGTTTGCTC Anti-senseCGCACACAGACAACTTTTTCTTTPI3 SenseCACGGGAGTTCCTGTTAAAGG Anti-senseTCTTTCAAGCAGCGGTTAGGGFAM3A SenseTTCGTGGCATCCTACGACG Anti-senseGCGGGATACAGCCTTCCATCDermcidin SenseGAAGACCCAGGGTTAGCCAGA Anti-senseGCTCCTTTACCCACGCTTTCTRNAse5 SenseCTGGGCGTTTTGTTGTTGGTC Anti-senseGGTTTGGCATCATAGTGCTGGRNAse7 SenseGCAGTCACCAGAGGATTGTGAC Anti-senseCACCGCTTCACCAGCCCSTAT3 SenseCAGCAGCTTGACACACGGTA Anti-senseAAACACCAAAGTGGCATGTGAIL-23p19 SenseCTCAGGGACAACAGTCAGTTC Anti-senseACAGGGCTATCAGGGAGCAIL-22 SenseGCTTGACAAGTCCAACTTCCA Anti-senseGCTCACTCATACTGACTCCGTSERPINB3 SenseCGCGGTCTCGTGCTATCTG Anti-senseATCCGAATCCTACTACAGCGGSERPINB4 SenseCTGGGTGGAAAGTCAAACGAA Anti-senseTGTCGTATCATTGCCAATAGTCC Open table in a new tab Maternal age, parity, BMI, gestational age, and birth weight were all compared by using the Student t test, and serum total IgE levels were compared by using the Mann-Whitney test. Other variables were compared by using the Pearson χ2 test. BMI, Body mass index. OPLS-DA was used to identify miRNAs associated with the development of AD at 1 year of age. The miRNAs in CS and MS with a VIP score of greater than 1.5 were selected as candidates for further analysis. VIP, Variable importance in projection." @default.
• W2897707989 created "2018-10-26" @default.
• W2897707989 creator A5014108118 @default.
• W2897707989 creator A5025298795 @default.
• W2897707989 creator A5035894578 @default.
• W2897707989 creator A5039402819 @default.
• W2897707989 creator A5050355840 @default.
• W2897707989 creator A5052697343 @default.
• W2897707989 creator A5055622789 @default.
• W2897707989 creator A5060109805 @default.
• W2897707989 creator A5061056260 @default.
• W2897707989 creator A5069225878 @default.
• W2897707989 creator A5079943912 @default.
• W2897707989 creator A5081545180 @default.
• W2897707989 creator A5082866335 @default.
• W2897707989 date "2019-01-01" @default.
• W2897707989 modified "2023-09-25" @default.
• W2897707989 title "Hsa-mir-144-3p expression is increased in umbilical cord serum of infants with atopic dermatitis" @default.
• W2897707989 cites W1981310416 @default.
• W2897707989 cites W2046004620 @default.
• W2897707989 cites W2070316318 @default.
• W2897707989 cites W2119022074 @default.
• W2897707989 cites W2736056004 @default.
• W2897707989 cites W2764281577 @default.
• W2897707989 cites W2786823650 @default.
• W2897707989 cites W4211145137 @default.
• W2897707989 cites W4211171313 @default.
• W2897707989 doi "https://doi.org/10.1016/j.jaci.2018.09.024" @default.
• W2897707989 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/30312706" @default.
• W2897707989 hasPublicationYear "2019" @default.
• W2897707989 type Work @default.
• W2897707989 sameAs 2897707989 @default.
• W2897707989 citedByCount "11" @default.
• W2897707989 countsByYear W28977079892020 @default.
• W2897707989 countsByYear W28977079892021 @default.
• W2897707989 countsByYear W28977079892022 @default.
• W2897707989 countsByYear W28977079892023 @default.
• W2897707989 crossrefType "journal-article" @default.
• W2897707989 hasAuthorship W2897707989A5014108118 @default.
• W2897707989 hasAuthorship W2897707989A5025298795 @default.
• W2897707989 hasAuthorship W2897707989A5035894578 @default.
• W2897707989 hasAuthorship W2897707989A5039402819 @default.
• W2897707989 hasAuthorship W2897707989A5050355840 @default.
• W2897707989 hasAuthorship W2897707989A5052697343 @default.
• W2897707989 hasAuthorship W2897707989A5055622789 @default.
• W2897707989 hasAuthorship W2897707989A5060109805 @default.
• W2897707989 hasAuthorship W2897707989A5061056260 @default.
• W2897707989 hasAuthorship W2897707989A5069225878 @default.
• W2897707989 hasAuthorship W2897707989A5079943912 @default.
• W2897707989 hasAuthorship W2897707989A5081545180 @default.
• W2897707989 hasAuthorship W2897707989A5082866335 @default.
• W2897707989 hasBestOaLocation W28977079891 @default.
• W2897707989 hasConcept C16005928 @default.
• W2897707989 hasConcept C203014093 @default.
• W2897707989 hasConcept C2776955114 @default.
• W2897707989 hasConcept C2778329239 @default.
• W2897707989 hasConcept C71924100 @default.
• W2897707989 hasConceptScore W2897707989C16005928 @default.
• W2897707989 hasConceptScore W2897707989C203014093 @default.
• W2897707989 hasConceptScore W2897707989C2776955114 @default.
• W2897707989 hasConceptScore W2897707989C2778329239 @default.
• W2897707989 hasConceptScore W2897707989C71924100 @default.
• W2897707989 hasFunder F4320311405 @default.
• W2897707989 hasFunder F4320320912 @default.
• W2897707989 hasFunder F4320335125 @default.
• W2897707989 hasFunder F4320338075 @default.
• W2897707989 hasIssue "1" @default.
• W2897707989 hasLocation W28977079891 @default.
• W2897707989 hasLocation W28977079892 @default.
• W2897707989 hasOpenAccess W2897707989 @default.
• W2897707989 hasPrimaryLocation W28977079891 @default.
• W2897707989 hasRelatedWork W1989515154 @default.
• W2897707989 hasRelatedWork W2155174375 @default.
• W2897707989 hasRelatedWork W2397032069 @default.
• W2897707989 hasRelatedWork W2437395753 @default.
• W2897707989 hasRelatedWork W2487150375 @default.
• W2897707989 hasRelatedWork W2589009774 @default.
• W2897707989 hasRelatedWork W2603773804 @default.
• W2897707989 hasRelatedWork W3024829390 @default.
• W2897707989 hasRelatedWork W3030657224 @default.
• W2897707989 hasRelatedWork W4300773404 @default.
• W2897707989 hasVolume "143" @default.
• W2897707989 isParatext "false" @default.
• W2897707989 isRetracted "false" @default.
• W2897707989 magId "2897707989" @default.
• W2897707989 workType "article" @default.