FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2897806257> ?p ?o ?g. }

• W2897806257 endingPage "356" @default.
• W2897806257 startingPage "350" @default.
• W2897806257 abstract "•Dimethylation of H3K4 is enriched at piRNA-dependent genomic regions•H3K4me2 is subsequently erased in a PIWIL4-dependent manner•PIWIL4 functions through an interaction with KDM1A and KDM5B Retrotransposon genes are silenced by DNA methylation because of potential harm due to insertional mutagenesis. DNA methylation of retrotransposon genes is erased and re-established during male germ cell development. Both piRNA-dependent and piRNA-independent mechanisms are active during the re-establishment process, with the piRNA-independent mechanism occurring first. In this study, we analyzed the role of PIWIL4/MIWI2 in the modification of histone H3 and subsequent piRNA-dependent DNA methylation. Dimethylation at H3K4 is highly enriched at piRNA-dependent methylated regions and anti-correlated with de novo DNA methylation during the phase of piRNA-independent DNA methylation. In addition, PIWIL4, which binds the H3K4 demethylases KDM1A and KDM5B, is required for removing H3K4me2 marks. These data show that PIWIL4 plays important roles in histone modification and piRNA-dependent DNA methylation. Retrotransposon genes are silenced by DNA methylation because of potential harm due to insertional mutagenesis. DNA methylation of retrotransposon genes is erased and re-established during male germ cell development. Both piRNA-dependent and piRNA-independent mechanisms are active during the re-establishment process, with the piRNA-independent mechanism occurring first. In this study, we analyzed the role of PIWIL4/MIWI2 in the modification of histone H3 and subsequent piRNA-dependent DNA methylation. Dimethylation at H3K4 is highly enriched at piRNA-dependent methylated regions and anti-correlated with de novo DNA methylation during the phase of piRNA-independent DNA methylation. In addition, PIWIL4, which binds the H3K4 demethylases KDM1A and KDM5B, is required for removing H3K4me2 marks. These data show that PIWIL4 plays important roles in histone modification and piRNA-dependent DNA methylation. Around 40% of the mouse genome is occupied by retrotransposons and their related genes (Deininger and Batzer, 2002Deininger P.L. Batzer M.A. Mammalian retroelements.Genome Res. 2002; 12: 1455-1465Crossref PubMed Scopus (303) Google Scholar, Waterston et al., 2002Waterston R.H. Lindblad-Toh K. Birney E. Rogers J. Abril J.F. Agarwal P. Agarwala R. Ainscough R. Alexandersson M. An P. et al.Mouse Genome Sequencing ConsortiumInitial sequencing and comparative analysis of the mouse genome.Nature. 2002; 420: 520-562Crossref PubMed Scopus (5385) Google Scholar). Retrotransposons belong to two representative classes: a long terminal repeat (LTR) type and a non-LTR type such as long interspersed nuclear element 1 (LINE1) (Okamura and Nakai, 2008Okamura K. Nakai K. Retrotransposition as a source of new promoters.Mol. Biol. Evol. 2008; 25: 1231-1238Crossref PubMed Scopus (38) Google Scholar). Although the majority of LTR and LINE1 retrotransposons are inactivated by mutations and/or deletions in their promoter regions, a subset of them, especially evolutionarily young ones, maintain promoter activity during evolution (Okamura and Nakai, 2008Okamura K. Nakai K. Retrotransposition as a source of new promoters.Mol. Biol. Evol. 2008; 25: 1231-1238Crossref PubMed Scopus (38) Google Scholar). Because activation of retrotransposons is potentially harmful due to the risk of insertional mutagenesis, the promoter activity of retrotransposons is silenced by DNA methylation (Bourc’his and Bestor, 2004Bourc’his D. Bestor T.H. Meiotic catastrophe and retrotransposon reactivation in male germ cells lacking Dnmt3L.Nature. 2004; 431: 96-99Crossref PubMed Scopus (891) Google Scholar, Kaneda et al., 2004Kaneda M. Okano M. Hata K. Sado T. Tsujimoto N. Li E. Sasaki H. Essential role for de novo DNA methyltransferase Dnmt3a in paternal and maternal imprinting.Nature. 2004; 429: 900-903Crossref PubMed Scopus (1021) Google Scholar). The DNA methylation status of genes, including retrotransposons, changes dynamically during germ cell development (Lee et al., 2014Lee H.J. Hore T.A. Reik W. Reprogramming the methylome: erasing memory and creating diversity.Cell Stem Cell. 2014; 14: 710-719Abstract Full Text Full Text PDF PubMed Scopus (236) Google Scholar). In male germ cell development, DNA methylation is erased and re-established at the primordial germ cell and gonocyte stages, respectively (Kobayashi et al., 2013Kobayashi H. Sakurai T. Miura F. Imai M. Mochiduki K. Yanagisawa E. Sakashita A. Wakai T. Suzuki Y. Ito T. et al.High-resolution DNA methylome analysis of primordial germ cells identifies gender-specific reprogramming in mice.Genome Res. 2013; 23: 616-627Crossref PubMed Scopus (200) Google Scholar). Impaired de novo DNA methylation of retrotransposon genes in gonocytes brings about subsequent apoptosis of the germ cells, which has been shown in many types of genetically engineered mice (Aravin et al., 2007Aravin A.A. Sachidanandam R. Girard A. Fejes-Toth K. Hannon G.J. Developmentally regulated piRNA clusters implicate MILI in transposon control.Science. 2007; 316: 744-747Crossref PubMed Scopus (762) Google Scholar, Carmell et al., 2007Carmell M.A. Girard A. van de Kant H.J. Bourc’his D. Bestor T.H. de Rooij D.G. Hannon G.J. MIWI2 is essential for spermatogenesis and repression of transposons in the mouse male germline.Dev. Cell. 2007; 12: 503-514Abstract Full Text Full Text PDF PubMed Scopus (858) Google Scholar, Kuramochi-Miyagawa et al., 2008Kuramochi-Miyagawa S. Watanabe T. Gotoh K. Totoki Y. Toyoda A. Ikawa M. Asada N. Kojima K. Yamaguchi Y. Ijiri T.W. et al.DNA methylation of retrotransposon genes is regulated by Piwi family members MILI and MIWI2 in murine fetal testes.Genes Dev. 2008; 22: 908-917Crossref PubMed Scopus (703) Google Scholar). P-element-induced wimpy testis (PIWI)-interacting RNAs (piRNAs), which are gonad-specific non-coding small RNAs, play important roles in the silencing of retrotransposons by DNA methylation in male embryonic germ cells (Aravin et al., 2007Aravin A.A. Sachidanandam R. Girard A. Fejes-Toth K. Hannon G.J. Developmentally regulated piRNA clusters implicate MILI in transposon control.Science. 2007; 316: 744-747Crossref PubMed Scopus (762) Google Scholar, Carmell et al., 2007Carmell M.A. Girard A. van de Kant H.J. Bourc’his D. Bestor T.H. de Rooij D.G. Hannon G.J. MIWI2 is essential for spermatogenesis and repression of transposons in the mouse male germline.Dev. Cell. 2007; 12: 503-514Abstract Full Text Full Text PDF PubMed Scopus (858) Google Scholar, Kuramochi-Miyagawa et al., 2008Kuramochi-Miyagawa S. Watanabe T. Gotoh K. Totoki Y. Toyoda A. Ikawa M. Asada N. Kojima K. Yamaguchi Y. Ijiri T.W. et al.DNA methylation of retrotransposon genes is regulated by Piwi family members MILI and MIWI2 in murine fetal testes.Genes Dev. 2008; 22: 908-917Crossref PubMed Scopus (703) Google Scholar, Watanabe et al., 2011Watanabe T. Chuma S. Yamamoto Y. Kuramochi-Miyagawa S. Totoki Y. Toyoda A. Hoki Y. Fujiyama A. Shibata T. Sado T. et al.MITOPLD is a mitochondrial protein essential for nuage formation and piRNA biogenesis in the mouse germline.Dev. Cell. 2011; 20: 364-375Abstract Full Text Full Text PDF PubMed Scopus (211) Google Scholar). Mouse PIWI-like (MILI/PIWIL2) and mouse PIWI 2 (MIWI2/PIWIL4) are required for this process. There are virtually no piRNAs in PIWIL2-deficient germ cells since PIWIL2 is essential for piRNA biogenesis (Aravin et al., 2006Aravin A. Gaidatzis D. Pfeffer S. Lagos-Quintana M. Landgraf P. Iovino N. Morris P. Brownstein M.J. Kuramochi-Miyagawa S. Nakano T. et al.A novel class of small RNAs bind to MILI protein in mouse testes.Nature. 2006; 442: 203-207Crossref PubMed Scopus (1125) Google Scholar, Girard et al., 2006Girard A. Sachidanandam R. Hannon G.J. Carmell M.A. A germline-specific class of small RNAs binds mammalian Piwi proteins.Nature. 2006; 442: 199-202Crossref PubMed Scopus (1245) Google Scholar, Kuramochi-Miyagawa et al., 2008Kuramochi-Miyagawa S. Watanabe T. Gotoh K. Totoki Y. Toyoda A. Ikawa M. Asada N. Kojima K. Yamaguchi Y. Ijiri T.W. et al.DNA methylation of retrotransposon genes is regulated by Piwi family members MILI and MIWI2 in murine fetal testes.Genes Dev. 2008; 22: 908-917Crossref PubMed Scopus (703) Google Scholar). Although PIWIL4 also participates in piRNA production to some extent, its role is relatively limited (Aravin et al., 2008Aravin A.A. Sachidanandam R. Bourc’his D. Schaefer C. Pezic D. Toth K.F. Bestor T. Hannon G.J. A piRNA pathway primed by individual transposons is linked to de novo DNA methylation in mice.Mol. Cell. 2008; 31: 785-799Abstract Full Text Full Text PDF PubMed Scopus (854) Google Scholar, Kuramochi-Miyagawa et al., 2008Kuramochi-Miyagawa S. Watanabe T. Gotoh K. Totoki Y. Toyoda A. Ikawa M. Asada N. Kojima K. Yamaguchi Y. Ijiri T.W. et al.DNA methylation of retrotransposon genes is regulated by Piwi family members MILI and MIWI2 in murine fetal testes.Genes Dev. 2008; 22: 908-917Crossref PubMed Scopus (703) Google Scholar). Instead, PIWIL4 plays essential roles in the de novo DNA methylation process per se, as we recently showed using a fusion protein of PIWIL4 and a zinc finger protein recognizing promoter regions of LINE1 retrotransposons (Kojima-Kita et al., 2016Kojima-Kita K. Kuramochi-Miyagawa S. Nagamori I. Ogonuki N. Ogura A. Hasuwa H. Akazawa T. Inoue N. Nakano T. MIWI2 as an effector of DNA methylation and gene silencing in embryonic male germ cells.Cell Rep. 2016; 16: 2819-2828Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar). piRNA-dependent DNA methylation is slightly delayed compared to the piRNA-independent mechanism (Molaro et al., 2014Molaro A. Falciatori I. Hodges E. Aravin A.A. Marran K. Rafii S. McCombie W.R. Smith A.D. Hannon G.J. Two waves of de novo methylation during mouse germ cell development.Genes Dev. 2014; 28: 1544-1549Crossref PubMed Scopus (85) Google Scholar). This observation generates two important hypotheses. First, the region of piRNA-dependent DNA methylation is protected from the molecular mechanism of piRNA-independent DNA methylation. Second, piRNA-dependent machinery can overcome the mechanisms. To test this, we analyzed histone modifications of retrotransposon genes that utilized piRNA-dependent mechanisms for DNA methylation. We found that an active histone modification, dimethylation at Lys4 of histone H3 (H3K4me2), was highly enriched at retrotransposons where DNA methylation was piRNA dependent. We propose that lysine demethylases 1A and 5B (KDM1A and KDM5B, respectively) erased the histone modification because the enzymes bound to PIWIL4, an essential factor needed to recruit de novo DNA methylation machinery. There are many kinds of functional relationships between DNA methylation and histone modifications. H3K4me2/me3, di- and tri-methylated histone H3 lysine 4, was reported to have a reciprocal relationship with DNA methylation. We postulated that H3K4me2/me3 would play roles in the delay of piRNA-dependent de novo DNA methylation. To examine this notion, we first used two previously published datasets: chromatin immunoprecipitation (ChIP)-on-chip data of gonocytes and DNA methylation data of control and PIWIL2-null spermatocytes (Singh et al., 2013Singh P. Li A.X. Tran D.A. Oates N. Kang E.R. Wu X. Szabó P.E. De novo DNA methylation in the male germ line occurs by default but is excluded at sites of H3K4 methylation.Cell Rep. 2013; 4: 205-219Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar, Molaro et al., 2014Molaro A. Falciatori I. Hodges E. Aravin A.A. Marran K. Rafii S. McCombie W.R. Smith A.D. Hannon G.J. Two waves of de novo methylation during mouse germ cell development.Genes Dev. 2014; 28: 1544-1549Crossref PubMed Scopus (85) Google Scholar). These datasets of the ChIP-on-chip probes cover virtually no LINE1s but do cover some LTR retrotransposons (Singh et al., 2013Singh P. Li A.X. Tran D.A. Oates N. Kang E.R. Wu X. Szabó P.E. De novo DNA methylation in the male germ line occurs by default but is excluded at sites of H3K4 methylation.Cell Rep. 2013; 4: 205-219Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar). Subsequently, the relationship between piRNA-dependent methylation and histone modifications of some LTR retrotransposons could be extracted from the datasets. First, we ensured the fidelity of the DNA methylation levels determined by the selected chip probes with more than 20 mapped reads of samples of control and PIWIL2-null spermatocytes. We chose three categories: low-DNA methylation (low-MeC), high-DNA methylation (high-MeC), and piRNA-dependent regions (Figure 1A). The “piRNA-dependent” category represents the genes whose DNA methylation level was high in the control, but significantly lower in the PIWIL2-null spermatocytes. This category is designated as piRNA dependent because there are few piRNAs in the PIWIL2-null gonocytes. Almost all of the genes in the piRNA-dependent category were LTR retrotransposons, as expected. Next, we compared the enrichment of histone modifications among low-MeC, high-MeC, and piRNA-dependent regions of embryonic day 15.5 (E15.5) gonocytes. H3K4me2, H3K4me3, and H3K9Ac were enriched in low-MeC, but not in high-MeC regions among active histone modifications (Figure 1B). H3K4me2/me3, but no H3K9Ac enrichment, was detected in the piRNA-dependent regions. Meanwhile, the other active histone modifications, such as H3K4me1 and H3K79me2, did not differ significantly between low-MeC and high-MeC regions (Figure S1A). H3K9me2/me3 did not show different enrichment patterns between low-MeC and high-MeC regions and was relatively abundant in the piRNA-dependent regions (Figures 1C and S1B). H3K4me2 enrichment showed a similar tendency at E16.5 and the enrichment of the piRNA-dependent region became more prominent (Figure S1C). Since the ChIP-on-chip probe did not contain LINE1 retrotransposon genes, we carried out ChIP-qPCR analysis of LINE1 genes using an anti-H3K4me2 antibody. As shown in Figure 1D, H3K4me2 enrichment was observed in the L1Md_A and L1Md_Tf genes, and the enrichment was more than that of intracisternal A particles (IAPs) (Figure 1D). Next, we performed H3K4me2 ChIP-sequencing (ChIP-seq) analysis of mouse gonocytes to examine the relationship between piRNA-dependent DNA methylation and histone lysine methylation. We identified 119,519 embryonic H3K4me2 peaks by peak calling using the model-based analysis for ChIP-seq (MACS) algorithm (Table S1) (Zhang et al., 2008Zhang Y. Liu T. Meyer C.A. Eeckhoute J. Johnson D.S. Bernstein B.E. Nusbaum C. Myers R.M. Brown M. Li W. Liu X.S. Model-based analysis of ChIP-seq (MACS).Genome Biol. 2008; 9: R137Crossref PubMed Scopus (8532) Google Scholar). We investigated the correlation between the H3K4me2 peaks and DNA methylation values using a sliding window approach. The PIWIL2-null spermatocyte DNA methylome was segmented into non-overlapping 500-bp windows in which more than 50 reads were uniquely mapped (low-coverage cutoff). The 414,711 windows that were DNA-methylation-called were divided into three groups: low MeC, high MeC, and piRNA dependent (Figure 2A). Approximately 30% of windows (130,297 windows) were located within the 500-bp region around the embryonic H3K4me2 peaks (Figures 2B and S2A; Tables S1 and S2). Eighty percent of low-MeC regions had embryonic H3K4me2 peaks, but only 12% of high-MeC regions contained them (Figure 2B). These data were consistent with previous data demonstrating the inhibitory role of H3K4me2 on DNA methylation. There were H3K4me2 peaks around 54% of the piRNA-dependent regions. The percentages of repetitive sequences around the H3K4me2 peaks in piRNA-dependent regions showed that there were significantly more LINE1s and LTR retrotransposons (54% and 37%, respectively) than in those around H3K4me2 peaks of all regions (5% and 11%, respectively) (Figure 2C). The ratios of LINE1s and LTRs around the H3K4me2 peaks in piRNA-dependent regions (Figure 2C, 54% and 37%, respectively) were almost identical to those of all piRNA-dependent regions (Figure S2B, 59% and 34%, respectively). In addition, the majority of LINE1 subfamilies near the embryonic H3K4me2 peaks were L1Md_A, L1Md_Tf, and L1Md_F, all of which were preferentially methylated in a piRNA-dependent manner (Figure 2D; Table S3). Considering that PIWIL4 is critical for piRNA-dependent DNA methylation, we assumed that PIWIL4 would recruit the enzymatic machinery for H3K4me2 demethylation. We postulated that, if this is the case, the amount of H3K4me2 should be higher in the PIWIL4-null male germ cells than in the control cells. We carried out ChIP-seq analysis of 10-day-old male germ cells and detected 95,516 and 95,894 peaks from the samples of the control and the PIWIL4-null cells, respectively (Tables S1 and S2). In both samples, about 80% of low-MeC regions contained H3K4me2 peaks, but only about 10% of high-MeC regions contained them (Figures 3A and S3A). In contrast, about 72% of the piRNA-dependent regions of the PIWIL4-null cells possessed H3K4me2 peaks. However, there were very few H3K4me2 peaks in the piRNA-dependent regions of the control (Figure 3A). H3K4me2 enrichment was higher in the PIWIL4-null cells than in the control cells at 4,730 peaks (Figure S3A, red dots; DESeq, fold change [FC] > 2, p < 0.05; Table S2). We were able to analyze 3,594 regions within 500 bp of these peaks and the majority (72.4%) of these regions corresponded to the piRNA-dependent regions (Figures 3B and S3B). Next, we analyzed repetitive sequences around the H3K4me2 peaks and regions in which H3K4me2 was significantly more abundant in the PIWIL4-null cells than in the control cells (H3K4me2-up regions). As shown in Figure 3C, the percentages of LINE1s and LTRs around H3K4me2 peaks in the piRNA-dependent regions were 43% and 40%, respectively, in the control cells. In contrast, those percentages were 67% and 26%, respectively, in the PIWIL4-null cells. Confining the analysis to the H3K4me2-up regions, this difference was more pronounced (83% and 26%, respectively). Taken together, H3K4me2-up regions were consistent with the LINE1 genes. Meanwhile, as for the subfamily of LINE1s, the vast majority of LINE1s surrounding the H3K4me2-up regions were L1Mds such as L1Md_A, L1Md_Tf, and L1Md_F, which was similar to embryonic H3K4me2 regions of piRNA-dependent LINEs shown in Figure 2D (Figure 3D; Table S3). Figure 4A shows a bean plot of the DNA methylation of E13.5 male primordial germ cells (PGCs), E16.5 gonocytes, and spermatocytes from the control and PIWIL2-null cells. Although de novo DNA methylation begins to take place in the whole genome at E16.5, it was not observed in the regions of H3K4me2-up and piRNA-dependent DNA methylation at that time (Figure 4A). Mapping of H3K4me2 ChIP-seq reads to transposable element consensus sequences showed that H3K4me2 was enriched in the 5′UTRs of piRNA-dependent retrotransposons, such as L1Md_A and L1Md_Tf, at the gonocyte stage. Although such enrichment was not observed in the control in spermatogonia, most of the enrichment remained under the PIWIL4-null condition (Figure S4A). Next, we analyzed the developmental changes of DNA methylation and H3K4me2 in piRNA-dependent regions of the mouse genome. We confirmed two important observations from this analysis. First, de novo DNA methylation was not observed in the L1Md_A and Tf regions of the E16.5 gonocytes. Second, the methylation level was high in the control, but quite low in the PIWIL2-null spermatogonia (Figure 4B and S4B, pink square). H3K4me2 was enriched in the 5′UTRs and/or upstream of L1Md_A and Tf regions (Figures 4B and S4B, pink squares). Notably, H3K4me2 was completely erased in control spermatogonia, but remained in PIWIL4-null spermatogonia. Next, we analyzed the differentially methylated regions (DMRs) and promoter regions upstream of a paternal imprinted gene, Rasgrf1 (Figure 4C). H3K4me2 was enriched in the promoter region of the gene from the gonocyte stage to the spermatogonial stage under both control and PIWIL4-null conditions, and no DNA methylation was observed in the region (Figure 4C, purple square). The level of DNA methylation in the piRNA-dependent region of the DMR was significantly lower than that in the neighboring piRNA-independent region of the DMR in the gonocytes (piRNA independent, yellow square; piRNA dependent, pink square). Reciprocally, H3K4me2 was enriched in the piRNA-dependent region of the DMR in gonocytes and the enrichment was not observed in spermatogonia (pink square). Meanwhile, H3K4me2 localization was hardly detected in the piRNA-independent regions of this DMR (yellow square). In male germ cell development, most DNA methylation is erased until ∼E13.5, and then de novo DNA methylation takes place at E16.5 (Figure 4A). It was reported that de novo piRNA-dependent DNA methylation of retrotransposons is delayed compared to other genes (Molaro et al., 2014Molaro A. Falciatori I. Hodges E. Aravin A.A. Marran K. Rafii S. McCombie W.R. Smith A.D. Hannon G.J. Two waves of de novo methylation during mouse germ cell development.Genes Dev. 2014; 28: 1544-1549Crossref PubMed Scopus (85) Google Scholar). It is likely that these retrotransposons evaded the mechanism(s) of piRNA-independent DNA methylation. Our data showing that H3K4me2 was enriched at retrotransposon genes strongly support the previous report. H3K4me2 and DNA methylation in piRNA-dependent DNA methylation regions showed a reciprocal relationship during the differentiation of male germ cells, and this relationship was PIWIL4 dependent. These data suggested that PIWIL4 would play an important role for H3K4me2 demethylation, possibly by recruiting the enzymatic machinery to erase H3K4me2. Next, we analyzed the binding of PIWIL4 to enzymes with H3K4me2 demethylation activity in 293T cells. This experiment, using Flag-tagged enzymes and podoplanin (PA)-tagged PIWIL4, showed that KDM1A and KDM5B were bound to PIWIL4 (Figure 4D). This binding with KDM1A was stronger than that with KDM5B. Although the interaction between PWIL4 with KDM1A and KDM5B was not detectable in embryonic testis by immunoprecipitation, immunostaining experiment confirmed the co-localization of PIWIL4 with KDM1A and KDM5B in E16 gonocytes (Figure 4E). Several post-translational modifications of histone proteins are associated with DNA methylation. Increasing evidence has demonstrated that di/tri-methylation at Lys4 of histone H3 (H3K4me2/3) results in a direct inhibitory effect on de novo DNA methylation (Ooi et al., 2007Ooi S.K. Qiu C. Bernstein E. Li K. Jia D. Yang Z. Erdjument-Bromage H. Tempst P. Lin S.P. Allis C.D. et al.DNMT3L connects unmethylated lysine 4 of histone H3 to de novo methylation of DNA.Nature. 2007; 448: 714-717Crossref PubMed Scopus (1127) Google Scholar;-Hu et al., 2009Hu J.L. Zhou B.O. Zhang R.R. Zhang K.L. Zhou J.Q. Xu G.L. The N-terminus of histone H3 is required for de novo DNA methylation in chromatin.Proc. Natl. Acad. Sci. USA. 2009; 106: 22187-22192Crossref PubMed Scopus (87) Google Scholar, Noh et al., 2015Noh K.M. Wang H. Kim H.R. Wenderski W. Fang F. Li C.H. Dewell S. Hughes S.H. Melnick A.M. Patel D.J. et al.Engineering of a histone-recognition domain in Dnmt3a alters the epigenetic landscape and phenotypic features of mouse ESCs.Mol. Cell. 2015; 59: 89-103Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). Consistently, genome-wide analyses have revealed a significant reciprocal relationship between H3K4me2 and DNA methylation in several kinds of cell lines and tissues, including gonocytes (Meissner et al., 2008Meissner A. Mikkelsen T.S. Gu H. Wernig M. Hanna J. Sivachenko A. Zhang X. Bernstein B.E. Nusbaum C. Jaffe D.B. et al.Genome-scale DNA methylation maps of pluripotent and differentiated cells.Nature. 2008; 454: 766-770Crossref PubMed Scopus (1957) Google Scholar, Singh et al., 2013Singh P. Li A.X. Tran D.A. Oates N. Kang E.R. Wu X. Szabó P.E. De novo DNA methylation in the male germ line occurs by default but is excluded at sites of H3K4 methylation.Cell Rep. 2013; 4: 205-219Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar, Stewart et al., 2015Stewart K.R. Veselovska L. Kim J. Huang J. Saadeh H. Tomizawa S. Smallwood S.A. Chen T. Kelsey G. Dynamic changes in histone modifications precede de novo DNA methylation in oocytes.Genes Dev. 2015; 29: 2449-2462Crossref PubMed Scopus (122) Google Scholar). Meanwhile, de novo DNA methylation at maternal imprinted regions is severely impaired in the lysine demethylase 1b (KDM1B)-deficient oocyte (Ciccone et al., 2009Ciccone D.N. Su H. Hevi S. Gay F. Lei H. Bajko J. Xu G. Li E. Chen T. KDM1B is a histone H3K4 demethylase required to establish maternal genomic imprints.Nature. 2009; 461: 415-418Crossref PubMed Scopus (395) Google Scholar, Stewart et al., 2015Stewart K.R. Veselovska L. Kim J. Huang J. Saadeh H. Tomizawa S. Smallwood S.A. Chen T. Kelsey G. Dynamic changes in histone modifications precede de novo DNA methylation in oocytes.Genes Dev. 2015; 29: 2449-2462Crossref PubMed Scopus (122) Google Scholar). Thus, the inhibitory role of H3K4me2 on DNA methylation determines the site specificity of DNA methylation. In this study, we used published ChIP-on-chip datasets to select possible candidates at piRNA-dependent regions, and then focused on H3K4me2 by ChIP-seq analysis. One concern would be whether the comparison of the data of ChIP-on-chip and ChIP-seq is reasonable or not, because of the low coverage of the former data, especially repetitive sequences. To exclude this concern, we analyzed the following ratios. The ratios of LTR neighboring regions per all regions were 10.9% (14,245/130,297) and 8.5% (4,645/54,721) by ChIP-seq and ChIP-on-chip, respectively. The ratios of LTR neighboring regions in piRNA-dependent regions per all LTR neighboring regions were 10.0% (1,429/14,245) and 8.5% (397/4,645) by ChIP-seq and ChIP-on-chip, respectively. Given that these ratios were essentially similar, it is reasonable to consider that skewing by the low coverage is quite unlikely. Biochemical analysis has shown that KDM5B facilitates H3K4me2 demethylation by KDM1A (Li et al., 2011Li Q. Shi L. Gui B. Yu W. Wang J. Zhang D. Han X. Yao Z. Shang Y. Binding of the JmjC demethylase JARID1B to LSD1/NuRD suppresses angiogenesis and metastasis in breast cancer cells by repressing chemokine CCL14.Cancer Res. 2011; 71: 6899-6908Crossref PubMed Scopus (131) Google Scholar). KDM1A alone is not sufficient to induce the demethylation of H3K4me2 in the cell because KDM1A and H3K4me2 are co-localized in a cell (Adamo et al., 2011Adamo A. Sesé B. Boue S. Castaño J. Paramonov I. Barrero M.J. Izpisua Belmonte J.C. LSD1 regulates the balance between self-renewal and differentiation in human embryonic stem cells.Nat. Cell Biol. 2011; 13: 652-659Crossref PubMed Scopus (242) Google Scholar, Whyte et al., 2012Whyte W.A. Bilodeau S. Orlando D.A. Hoke H.A. Frampton G.M. Foster C.T. Cowley S.M. Young R.A. Enhancer decommissioning by LSD1 during embryonic stem cell differentiation.Nature. 2012; 482: 221-225Crossref PubMed Scopus (422) Google Scholar, Hnisz et al., 2013Hnisz D. Abraham B.J. Lee T.I. Lau A. Saint-André V. Sigova A.A. Hoke H.A. Young R.A. Super-enhancers in the control of cell identity and disease.Cell. 2013; 155: 934-947Abstract Full Text Full Text PDF PubMed Scopus (2101) Google Scholar, Mohammad et al., 2015Mohammad H.P. Smitheman K.N. Kamat C.D. Soong D. Federowicz K.E. Van Aller G.S. Schneck J.L. Carson J.D. Liu Y. Butticello M. et al.A DNA hypomethylation signature predicts antitumor activity of LSD1 inhibitors in SCLC.Cancer Cell. 2015; 28: 57-69Abstract Full Text Full Text PDF PubMed Scopus (350) Google Scholar). In addition, experiments using gene targeting or specific inhibitors demonstrated that demethylation of H3K4 by KDM1A is important for DNA methylation in embryonic stem cells (ESCs) and oocytes (Petell et al., 2016Petell C.J. Alabdi L. He M. San Miguel P. Rose R. Gowher H. An epigenetic switch regulates de novo DNA methylation at a subset of pluripotency gene enhancers during embryonic stem cell differentiation.Nucleic Acids Res. 2016; 44: 7605-7617Crossref PubMed Scopus (44) Google Scholar). KDM1B has been reported necessary for oocyte maturation through DNA methylation (Ciccone et al., 2009Ciccone D.N. Su H. Hevi S. Gay F. Lei H. Bajko J. Xu G. Li E. Chen T. KDM1B is a histone H3K4 demethylase required to establish maternal genomic imprints.Nature. 2009; 461: 415-418Crossref PubMed Scopus (395) Google Scholar) but is dispensable for male germ cell developments. Our current data of weak binding between PIWIL4 and KDM1B are consistent with the report. Combining these observations with other data on the binding of PIWIL4 with both KDM1A and KDM5B, it is quite reasonable that the PIWIL4 complex with KDM1A and KDM5B is important for H3K4me2 demethylation of LINE1. Germ cells were isolated from 10-day-old and E16 Oct4-GFP transgenic mice using an FACSAria II flow cytometer (BD Biosciences) (Yoshimizu et al., 1999Yoshimizu T. Sugiyama N. De Felice M. Yeom Y.I. Ohbo K. Masuko K. Obinata M. Abe K. Schöler H.R. Matsui Y. Germline-specific expression of the Oct-4/green fluorescent protein (GFP) transgene in mice.Dev. Growth Differ. 1999; 41: 675-684Crossref PubMed Google Scholar). Around 200,000 E16 gonocytes and 500,000 10-day-old germ cells from control and PIWIL4-null testis were used for H3K4me2 ChIP-seq. All ChIP-seq analyses were performed as replicates and analyzed after combining them. The germ cells were fixed in 4% paraformaldehyde (PFA), followed by a glycine quench, and then stored at –80°C until ChIP-seq analyses were performed. Sorted germ cells were lysed in 100 μL of lysis buffer (50 mM Tris, pH 7.5, 10 mM EDTA, 0.5 mM EGTA, 1% SDS), followed by sonication (Bioruptor, output high, 30-s ON/30-s OFF; total of 30 min for gonocytes and 35 min for spermatogonia). Sonicated chromatin was diluted in 450 μL of radioimmunoprecipitation assay buffer (RIPA) (10 mM Tris, pH 7.5, 140 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 1% Triton X-100, 0.1% SDS, 0.1% deoxycholate [DOC]), and then the supernatant was transferred to fresh tubes after centrifuging at 12,000 × g for 10 min at 4°C. RIPA was added to the tubes a second time; they were re-centrifuged, and supernatant was collected to reduce uncollected chromatin. Chromatin was precipitated with H3K4me2 antibody (ab7766) from the supernatant. Chromatin was subjected to library preparation (NEBNext ChIP-Seq Library Prep Reagent Set for Illumina) after purification by Chelex and PheOH/ChCl3 extraction, followed by EtOH precipitation. The libraries were analyzed using an Illumina HiSeq 2500 system. The reads were mapped to mouse genomic DNA (mm9) using Bowtie2 software with local mode. Sequence analysis was done using SeqMonk software. Repeat annotation information was obtained from the University of California, Santa Cruz (UCSC) browser (https://genome.ucsc.edu/). For ChIP-qPCR, we examined relative amounts of L1Md_A, L1Md_Tf, and IAP DNA by qPCR (THUNDERBIRD qPCR mix; TOYOBO). Primer sequences are as follows: L1Md_A (forward [F]), aaaccccttccactccactc; L1Md_A (reverse [R]), tcacgtgtggaatcctgtgt; L1Md_Tf (F), gtcctgttttgggccttctt; L1Md_Tf (R), gcagacctgggagacagatt; IAP (F), aattccgggacgagaaaatc; and IAP (R), acctttatcaccgtcgttcc. The relative enrichment of ChIP-on-chip datasets that were used was previously published (Singh et al., 2013Singh P. Li A.X. Tran D.A. Oates N. Kang E.R. Wu X. Szabó P.E. De novo DNA methylation in the male germ line occurs by default but is excluded at sites of H3K4 methylation.Cell Rep. 2013; 4: 205-219Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar). DNA methylation datasets of control and PIWIL2-null cells were downloaded (Molaro et al., 2014Molaro A. Falciatori I. Hodges E. Aravin A.A. Marran K. Rafii S. McCombie W.R. Smith A.D. Hannon G.J. Two waves of de novo methylation during mouse germ cell development.Genes Dev. 2014; 28: 1544-1549Crossref PubMed Scopus (85) Google Scholar), and methylation data on mm9 were obtained using Bismark aligner and SeqMonk software. After merging two ChIP-on-chip and PIWIL2-methylome datasets, we extracted probes with more than 20 methylome reads to ensure DNA methylation fidelity. DNA methylation levels were visualized using R or Excel software. We categorized low-MeC, high-MeC, and piRNA-dependent groups from the data of Figure 2A. The group in which DNA methylation is high in the control cells but low in the PIWIL2-null cells can be easily identified as piRNA-dependent group, because piRNA is lacking in the PIWIL2-null cells. The vast majority of the bins showed the diagonal and rather continuous distribution, which is consistent with the previous report (Molaro et al., 2014Molaro A. Falciatori I. Hodges E. Aravin A.A. Marran K. Rafii S. McCombie W.R. Smith A.D. Hannon G.J. Two waves of de novo methylation during mouse germ cell development.Genes Dev. 2014; 28: 1544-1549Crossref PubMed Scopus (85) Google Scholar). However, the areas of less than 30% and more than 70% DNA methylation in both control and PIWIL2-null cells showed relatively dense distributions. For the sake of more accuracy, we categorized the regions with less than 20% and more than 80% DNA methylation levels as low-MeC and high-MeC groups, respectively. The details are described in Supplemental Experimental Procedures. Germ cell isolation has been described elsewhere (Yoshimizu et al., 1999Yoshimizu T. Sugiyama N. De Felice M. Yeom Y.I. Ohbo K. Masuko K. Obinata M. Abe K. Schöler H.R. Matsui Y. Germline-specific expression of the Oct-4/green fluorescent protein (GFP) transgene in mice.Dev. Growth Differ. 1999; 41: 675-684Crossref PubMed Google Scholar). Briefly, germ cells were isolated from Oct4-GFP transgenic mice using an FACSAria II flow cytometer (BD Bioscience). The detailed methods of germ cell isolation, western blotting, and immunofluorescence are described in Supplemental Experimental Procedures. We thank Ms. N. Asada for technical assistance and Ms. M. Imaizumi for secretarial work. This work was supported by The Center for Medical Research and Education (CentMeRE), Graduate School of Medicine, Osaka University. This work was supported by grants from the Ministry of Education, Culture, Sports, Science, and Technology-Japan (MEXT) and The Japan Agency for Medical Research and Development-Core Research for Evolutional Science and Technology (AMED-CREST Grant No. JPMJCR12J4). This work was performed partly under the Cooperative Research Program of Institute for Protein Research, Osaka University (CR-15-05). I.N. was supported by Grants-in-Aid for Scientific Research from MEXT (16K07199 and 24770167). H.K. was supported by Grant-in-Aid for Scientific Research from MEXT (15H05579) and MEXT-Supported Program for the Strategic Research Foundation at Private Universities (S0801025). I.N. and T. Nakano conceived this study. I.N., R.Y., T. Nishimura, H.K., and S.K.-M. performed the experiments. H.K. and T.K. performed ChIP-seq library preparations. I.N., H.K., J.K., and T. Nakano wrote the paper. The authors declare no competing interests. The accession number for the NGS data reported in this paper is DDBJ: DRA006400. Download .pdf (2.83 MB) Help with pdf files Document S1. Supplemental Experimental Procedures and Figures S1–S4 Download .xlsx (.01 MB) Help with xlsx files Table S1. Summary of ChIP-Seq Read Mapping from E16 and Day 10 Male Germ Cells of Control and MIWI2-Null Mice, Related to Figures 1, 2, 3, and 4 Download .xlsx (.01 MB) Help with xlsx files Table S2. Summary of Percentages of Repeat Elements in Indicated Regions, Related to Figures 2 and 3 Download .xlsx (.01 MB) Help with xlsx files Table S3. Summary of Percentages of LINE1 Subfamilies in Indicated Groups, Related to Figures 2 and 3" @default.
• W2897806257 created "2018-10-26" @default.
• W2897806257 creator A5005963678 @default.
• W2897806257 creator A5044707863 @default.
• W2897806257 creator A5055070773 @default.
• W2897806257 creator A5061723410 @default.
• W2897806257 creator A5065135026 @default.
• W2897806257 creator A5070117387 @default.
• W2897806257 creator A5083560364 @default.
• W2897806257 creator A5088207071 @default.
• W2897806257 date "2018-10-01" @default.
• W2897806257 modified "2023-10-12" @default.
• W2897806257 title "Relationship between PIWIL4-Mediated H3K4me2 Demethylation and piRNA-Dependent DNA Methylation" @default.
• W2897806257 cites W1551800042 @default.
• W2897806257 cites W1603797292 @default.
• W2897806257 cites W1964813856 @default.
• W2897806257 cites W1977733607 @default.
• W2897806257 cites W1981354816 @default.
• W2897806257 cites W1990654003 @default.
• W2897806257 cites W2004966039 @default.
• W2897806257 cites W2013785611 @default.
• W2897806257 cites W2013928795 @default.
• W2897806257 cites W2015402753 @default.
• W2897806257 cites W2018304597 @default.
• W2897806257 cites W2035930185 @default.
• W2897806257 cites W2041396419 @default.
• W2897806257 cites W2077053535 @default.
• W2897806257 cites W2081028399 @default.
• W2897806257 cites W2095639093 @default.
• W2897806257 cites W2096196036 @default.
• W2897806257 cites W2105097906 @default.
• W2897806257 cites W2111390374 @default.
• W2897806257 cites W2122968698 @default.
• W2897806257 cites W2133990340 @default.
• W2897806257 cites W2151464048 @default.
• W2897806257 cites W2155870354 @default.
• W2897806257 cites W2159323821 @default.
• W2897806257 cites W2161224111 @default.
• W2897806257 cites W2164428618 @default.
• W2897806257 cites W2171808845 @default.
• W2897806257 cites W2177694784 @default.
• W2897806257 cites W2376409125 @default.
• W2897806257 cites W2519888092 @default.
• W2897806257 cites W4212855844 @default.
• W2897806257 doi "https://doi.org/10.1016/j.celrep.2018.09.017" @default.
• W2897806257 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/30304676" @default.
• W2897806257 hasPublicationYear "2018" @default.
• W2897806257 type Work @default.
• W2897806257 sameAs 2897806257 @default.
• W2897806257 citedByCount "18" @default.
• W2897806257 countsByYear W28978062572019 @default.
• W2897806257 countsByYear W28978062572020 @default.
• W2897806257 countsByYear W28978062572021 @default.
• W2897806257 countsByYear W28978062572022 @default.
• W2897806257 countsByYear W28978062572023 @default.
• W2897806257 crossrefType "journal-article" @default.
• W2897806257 hasAuthorship W2897806257A5005963678 @default.
• W2897806257 hasAuthorship W2897806257A5044707863 @default.
• W2897806257 hasAuthorship W2897806257A5055070773 @default.
• W2897806257 hasAuthorship W2897806257A5061723410 @default.
• W2897806257 hasAuthorship W2897806257A5065135026 @default.
• W2897806257 hasAuthorship W2897806257A5070117387 @default.
• W2897806257 hasAuthorship W2897806257A5083560364 @default.
• W2897806257 hasAuthorship W2897806257A5088207071 @default.
• W2897806257 hasBestOaLocation W28978062571 @default.
• W2897806257 hasConcept C104317684 @default.
• W2897806257 hasConcept C121912465 @default.
• W2897806257 hasConcept C141231307 @default.
• W2897806257 hasConcept C147724379 @default.
• W2897806257 hasConcept C150194340 @default.
• W2897806257 hasConcept C153911025 @default.
• W2897806257 hasConcept C16824249 @default.
• W2897806257 hasConcept C190727270 @default.
• W2897806257 hasConcept C33288867 @default.
• W2897806257 hasConcept C41091548 @default.
• W2897806257 hasConcept C4918238 @default.
• W2897806257 hasConcept C54355233 @default.
• W2897806257 hasConcept C552990157 @default.
• W2897806257 hasConcept C64927066 @default.
• W2897806257 hasConcept C7029365 @default.
• W2897806257 hasConcept C86803240 @default.
• W2897806257 hasConceptScore W2897806257C104317684 @default.
• W2897806257 hasConceptScore W2897806257C121912465 @default.
• W2897806257 hasConceptScore W2897806257C141231307 @default.
• W2897806257 hasConceptScore W2897806257C147724379 @default.
• W2897806257 hasConceptScore W2897806257C150194340 @default.
• W2897806257 hasConceptScore W2897806257C153911025 @default.
• W2897806257 hasConceptScore W2897806257C16824249 @default.
• W2897806257 hasConceptScore W2897806257C190727270 @default.
• W2897806257 hasConceptScore W2897806257C33288867 @default.
• W2897806257 hasConceptScore W2897806257C41091548 @default.
• W2897806257 hasConceptScore W2897806257C4918238 @default.
• W2897806257 hasConceptScore W2897806257C54355233 @default.
• W2897806257 hasConceptScore W2897806257C552990157 @default.
• W2897806257 hasConceptScore W2897806257C64927066 @default.
• W2897806257 hasConceptScore W2897806257C7029365 @default.
• W2897806257 hasConceptScore W2897806257C86803240 @default.
• W2897806257 hasFunder F4320320912 @default.

• next