FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2906248005> ?p ?o ?g. }

• W2906248005 endingPage "2653" @default.
• W2906248005 startingPage "2641" @default.
• W2906248005 abstract "In the promoter of c-KIT proto-oncogene, whose deregulation has been implicated in many cancers, three G-rich regions (kit1, kit* and kit2) are able to fold into G-quadruplexes. While kit1 and kit2 have been studied in depth, little information is available on kit* folding behavior despite its key role in regulation of c-KIT transcription. Notably, kit* contains consensus sites for SP1 and AP2 transcription factors. Herein, a set of complementary spectroscopic and biophysical methods reveals that kit*, d[GGCGAGGAGGGGCGTGGCCGGC], adopts a chair type antiparallel G-quadruplex with two G-quartets at physiological relevant concentrations of KCl. Heterogeneous ensemble of structures is observed in the presence of Na+ and NH4+ ions, which however stabilize pre-folded structure. In the presence of K+ ions stacking interactions of adenine and thymine residues on the top G-quartet contribute to structural stability together with a G10•C18 base pair and a fold-back motif of the five residues at the 3'-terminal under the bottom G-quartet. The 3'-tail enables formation of a bimolecular pre-folded structure that drives folding of kit* into a single G-quadruplex. Intriguingly, kinetics of kit* G-quadruplex formation matches timescale of transcriptional processes and might demonstrate interplay of kinetic and thermodynamic factors for understanding regulation of c-KIT proto-oncogene expression." @default.
• W2906248005 created "2019-01-01" @default.
• W2906248005 creator A5065487450 @default.
• W2906248005 creator A5075876145 @default.
• W2906248005 creator A5083221156 @default.
• W2906248005 creator A5091661816 @default.
• W2906248005 date "2018-12-21" @default.
• W2906248005 modified "2023-10-13" @default.
• W2906248005 title "Two-quartet kit* G-quadruplex is formed via double-stranded pre-folded structure" @default.
• W2906248005 cites W1450574606 @default.
• W2906248005 cites W1488789106 @default.
• W2906248005 cites W1692775010 @default.
• W2906248005 cites W1752312133 @default.
• W2906248005 cites W1965305027 @default.
• W2906248005 cites W1971985277 @default.
• W2906248005 cites W1974663878 @default.
• W2906248005 cites W1976548990 @default.
• W2906248005 cites W1978670494 @default.
• W2906248005 cites W1980586499 @default.
• W2906248005 cites W1981888951 @default.
• W2906248005 cites W1991797965 @default.
• W2906248005 cites W1999602967 @default.
• W2906248005 cites W2000507573 @default.
• W2906248005 cites W2007634776 @default.
• W2906248005 cites W2007812774 @default.
• W2906248005 cites W2010503781 @default.
• W2906248005 cites W2012512942 @default.
• W2906248005 cites W2017470291 @default.
• W2906248005 cites W2026290591 @default.
• W2906248005 cites W2028397348 @default.
• W2906248005 cites W2034512710 @default.
• W2906248005 cites W2035978813 @default.
• W2906248005 cites W2042994965 @default.
• W2906248005 cites W2050913592 @default.
• W2906248005 cites W2056072994 @default.
• W2906248005 cites W2056201880 @default.
• W2906248005 cites W2058773467 @default.
• W2906248005 cites W2059306569 @default.
• W2906248005 cites W2063733156 @default.
• W2906248005 cites W2074615820 @default.
• W2906248005 cites W2081781483 @default.
• W2906248005 cites W2092529910 @default.
• W2906248005 cites W2097035920 @default.
• W2906248005 cites W2100683600 @default.
• W2906248005 cites W2111271543 @default.
• W2906248005 cites W2123093081 @default.
• W2906248005 cites W2124582915 @default.
• W2906248005 cites W2147993766 @default.
• W2906248005 cites W2153879694 @default.
• W2906248005 cites W2155773930 @default.
• W2906248005 cites W2157232349 @default.
• W2906248005 cites W2157544098 @default.
• W2906248005 cites W2166551858 @default.
• W2906248005 cites W2168753356 @default.
• W2906248005 cites W2171830519 @default.
• W2906248005 cites W2205176762 @default.
• W2906248005 cites W2229744938 @default.
• W2906248005 cites W2251344425 @default.
• W2906248005 cites W2289936101 @default.
• W2906248005 cites W2405112540 @default.
• W2906248005 cites W2517296131 @default.
• W2906248005 cites W2519533063 @default.
• W2906248005 cites W2537246643 @default.
• W2906248005 cites W2565047116 @default.
• W2906248005 cites W2588267243 @default.
• W2906248005 cites W2590327834 @default.
• W2906248005 cites W2612060709 @default.
• W2906248005 cites W2615709256 @default.
• W2906248005 cites W2741010565 @default.
• W2906248005 cites W2742150944 @default.
• W2906248005 cites W2767115784 @default.
• W2906248005 cites W2793413114 @default.
• W2906248005 cites W2794013714 @default.
• W2906248005 doi "https://doi.org/10.1093/nar/gky1269" @default.
• W2906248005 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/6411839" @default.
• W2906248005 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/30590801" @default.
• W2906248005 hasPublicationYear "2018" @default.
• W2906248005 type Work @default.
• W2906248005 sameAs 2906248005 @default.
• W2906248005 citedByCount "34" @default.
• W2906248005 countsByYear W29062480052019 @default.
• W2906248005 countsByYear W29062480052020 @default.
• W2906248005 countsByYear W29062480052021 @default.
• W2906248005 countsByYear W29062480052022 @default.
• W2906248005 countsByYear W29062480052023 @default.
• W2906248005 crossrefType "journal-article" @default.
• W2906248005 hasAuthorship W2906248005A5065487450 @default.
• W2906248005 hasAuthorship W2906248005A5075876145 @default.
• W2906248005 hasAuthorship W2906248005A5083221156 @default.
• W2906248005 hasAuthorship W2906248005A5091661816 @default.
• W2906248005 hasBestOaLocation W29062480051 @default.
• W2906248005 hasConcept C115260700 @default.
• W2906248005 hasConcept C121332964 @default.
• W2906248005 hasConcept C12554922 @default.
• W2906248005 hasConcept C138885662 @default.
• W2906248005 hasConcept C142089489 @default.
• W2906248005 hasConcept C178790620 @default.
• W2906248005 hasConcept C179926584 @default.

• next