Matches in SemOpenAlex for { <https://semopenalex.org/work/W2912293777> ?p ?o ?g. }
Showing items 1 to 63 of
63
with 100 items per page.
- W2912293777 abstract "Abstract This study aims to analyze the genetic character of Anguilla bicolor based on cytochrome b gene as the basis of information in the study of phylogeny and genetic engineering. The research was conducted from May to September 2013 in the Laboratory of Biotechnology Faculty of Science, University of Brawijaya. This study uses a survey with qualitative descriptive analysis in the laboratory. Samples obtained from direct arrests in Tulungagung Popo Beach , Manado , Medan and Cilacap. Study was initiated by DNA isolation using CTAB method and followed by PCR . Primers used were cytb - 1 (5' - TGCTAACGATGCCCTAGTGG - 3 ') and b CYT - 2 (5' - CTAGTCAACCTACT - AATGGG - 3 ') . PCR results were cut using restriction enzymes and Msp1 Hha1. Data analysis was performed with the aid of NTSYS software program. Genetic character of a sequence of nucleotide bases making up DNA from the cytochrome b gene were obtained on each sample has a degree of similarity around 32 - 100 %." @default.
- W2912293777 created "2019-02-21" @default.
- W2912293777 creator A5032559897 @default.
- W2912293777 creator A5035610557 @default.
- W2912293777 creator A5077068492 @default.
- W2912293777 date "2019-01-15" @default.
- W2912293777 modified "2023-09-25" @default.
- W2912293777 title "Keragaman Gen Cytochrome B pada Sidat (Anguila bicolor) Berdasarkan Restriction Fragment Length Polymorphism (RFLP) <br><i>[Genetic Diversity Cythochrome B of Sidat (Anguila bicolor) Assesed by Restriction Fragment Length Polymorhisme (RFLP) ]<i>" @default.
- W2912293777 doi "https://doi.org/10.20473/jipk.v6i2.11294" @default.
- W2912293777 hasPublicationYear "2019" @default.
- W2912293777 type Work @default.
- W2912293777 sameAs 2912293777 @default.
- W2912293777 citedByCount "0" @default.
- W2912293777 crossrefType "journal-article" @default.
- W2912293777 hasAuthorship W2912293777A5032559897 @default.
- W2912293777 hasAuthorship W2912293777A5035610557 @default.
- W2912293777 hasAuthorship W2912293777A5077068492 @default.
- W2912293777 hasBestOaLocation W29122937771 @default.
- W2912293777 hasConcept C104317684 @default.
- W2912293777 hasConcept C128319531 @default.
- W2912293777 hasConcept C148292235 @default.
- W2912293777 hasConcept C153523973 @default.
- W2912293777 hasConcept C153911025 @default.
- W2912293777 hasConcept C168007829 @default.
- W2912293777 hasConcept C24586158 @default.
- W2912293777 hasConcept C2908647359 @default.
- W2912293777 hasConcept C49105822 @default.
- W2912293777 hasConcept C54355233 @default.
- W2912293777 hasConcept C71924100 @default.
- W2912293777 hasConcept C81977670 @default.
- W2912293777 hasConcept C86803240 @default.
- W2912293777 hasConcept C99454951 @default.
- W2912293777 hasConceptScore W2912293777C104317684 @default.
- W2912293777 hasConceptScore W2912293777C128319531 @default.
- W2912293777 hasConceptScore W2912293777C148292235 @default.
- W2912293777 hasConceptScore W2912293777C153523973 @default.
- W2912293777 hasConceptScore W2912293777C153911025 @default.
- W2912293777 hasConceptScore W2912293777C168007829 @default.
- W2912293777 hasConceptScore W2912293777C24586158 @default.
- W2912293777 hasConceptScore W2912293777C2908647359 @default.
- W2912293777 hasConceptScore W2912293777C49105822 @default.
- W2912293777 hasConceptScore W2912293777C54355233 @default.
- W2912293777 hasConceptScore W2912293777C71924100 @default.
- W2912293777 hasConceptScore W2912293777C81977670 @default.
- W2912293777 hasConceptScore W2912293777C86803240 @default.
- W2912293777 hasConceptScore W2912293777C99454951 @default.
- W2912293777 hasLocation W29122937771 @default.
- W2912293777 hasOpenAccess W2912293777 @default.
- W2912293777 hasPrimaryLocation W29122937771 @default.
- W2912293777 hasRelatedWork W154497156 @default.
- W2912293777 hasRelatedWork W1578145264 @default.
- W2912293777 hasRelatedWork W2013242550 @default.
- W2912293777 hasRelatedWork W2020824452 @default.
- W2912293777 hasRelatedWork W2027879978 @default.
- W2912293777 hasRelatedWork W2072593597 @default.
- W2912293777 hasRelatedWork W2231784942 @default.
- W2912293777 hasRelatedWork W2339472337 @default.
- W2912293777 hasRelatedWork W2373393809 @default.
- W2912293777 hasRelatedWork W2048554262 @default.
- W2912293777 isParatext "false" @default.
- W2912293777 isRetracted "false" @default.
- W2912293777 magId "2912293777" @default.
- W2912293777 workType "article" @default.