FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2949203676> ?p ?o ?g. }

• W2949203676 endingPage "1156" @default.
• W2949203676 startingPage "1138" @default.
• W2949203676 abstract "Strains of Salmonella utilize two distinct type three secretion systems to deliver effector proteins directly into host cells. The Salmonella effectors SseK1 and SseK3 are arginine glycosyltransferases that modify mammalian death domain containing proteins with N-acetyl glucosamine (GlcNAc) when overexpressed ectopically or as recombinant protein fusions. Here, we combined Arg-GlcNAc glycopeptide immunoprecipitation and mass spectrometry to identify host proteins GlcNAcylated by endogenous levels of SseK1 and SseK3 during Salmonella infection. We observed that SseK1 modified the mammalian signaling protein TRADD, but not FADD as previously reported. Overexpression of SseK1 greatly broadened substrate specificity, whereas ectopic co-expression of SseK1 and TRADD increased the range of modified arginine residues within the death domain of TRADD. In contrast, endogenous levels of SseK3 resulted in modification of the death domains of receptors of the mammalian TNF superfamily, TNFR1 and TRAILR, at residues Arg376 and Arg293 respectively. Structural studies on SseK3 showed that the enzyme displays a classic GT-A glycosyltransferase fold and binds UDP-GlcNAc in a narrow and deep cleft with the GlcNAc facing the surface. Together our data suggest that salmonellae carrying sseK1 and sseK3 employ the glycosyltransferase effectors to antagonise different components of death receptor signaling. Strains of Salmonella utilize two distinct type three secretion systems to deliver effector proteins directly into host cells. The Salmonella effectors SseK1 and SseK3 are arginine glycosyltransferases that modify mammalian death domain containing proteins with N-acetyl glucosamine (GlcNAc) when overexpressed ectopically or as recombinant protein fusions. Here, we combined Arg-GlcNAc glycopeptide immunoprecipitation and mass spectrometry to identify host proteins GlcNAcylated by endogenous levels of SseK1 and SseK3 during Salmonella infection. We observed that SseK1 modified the mammalian signaling protein TRADD, but not FADD as previously reported. Overexpression of SseK1 greatly broadened substrate specificity, whereas ectopic co-expression of SseK1 and TRADD increased the range of modified arginine residues within the death domain of TRADD. In contrast, endogenous levels of SseK3 resulted in modification of the death domains of receptors of the mammalian TNF superfamily, TNFR1 and TRAILR, at residues Arg376 and Arg293 respectively. Structural studies on SseK3 showed that the enzyme displays a classic GT-A glycosyltransferase fold and binds UDP-GlcNAc in a narrow and deep cleft with the GlcNAc facing the surface. Together our data suggest that salmonellae carrying sseK1 and sseK3 employ the glycosyltransferase effectors to antagonise different components of death receptor signaling. Pathogenic serovars of Salmonella utilize two type three secretion systems (T3SS) 1The abbreviations used are: T3SStype 3 secretion systemsEPECenteropathogenic Escherichia coliGlcNAcN acetylglucosaminePRMparallel reaction monitoring. 1The abbreviations used are: T3SStype 3 secretion systemsEPECenteropathogenic Escherichia coliGlcNAcN acetylglucosaminePRMparallel reaction monitoring., encoded by Salmonella pathogenicity island-1 and -2 (SPI-1 and SPI-2) to deliver distinct cohorts of effector proteins into host cells during infection (1Galan J.E. Curtiss 3rd., R. Cloning and molecular characterization of genes whose products allow Salmonella typhimurium to penetrate tissue culture cells.Proc. Natl. Acad. Sci. U.S.A. 1989; 86: 6383-6387Crossref PubMed Scopus (759) Google Scholar, 2Shea J.E. Hensel M. Gleeson C. Holden D.W. Identification of a virulence locus encoding a second type III secretion system in Salmonella typhimurium.Proc. Natl. Acad. Sci. U.S.A. 1996; 93: 2593-2597Crossref PubMed Scopus (639) Google Scholar). These effector proteins subvert normal cellular processes and collectively enable the bacteria to invade and persist within host cells, partially through the manipulation of inflammatory cell signaling and programmed cell death (reviewed in (3Jennings E. Thurston T.L.M. Holden D.W. Salmonella SPI-2 Type III Secretion System Effectors: Molecular Mechanisms And Physiological Consequences.Cell Host Microbe. 2017; 22: 217-231Abstract Full Text Full Text PDF PubMed Scopus (195) Google Scholar, 4LaRock D.L. Chaudhary A. Miller S.I. Salmonellae interactions with host processes.Nat. Rev. Microbiol. 2015; 13: 191-205Crossref PubMed Scopus (285) Google Scholar)). Although the importance of effector translocation to pathogenesis is well established, the specific contribution of many effectors is still unclear. Many effectors translocated by the SPI-2 encoded T3SS remain poorly characterized. type 3 secretion systems enteropathogenic Escherichia coli N acetylglucosamine parallel reaction monitoring. type 3 secretion systems enteropathogenic Escherichia coli N acetylglucosamine parallel reaction monitoring. SseK1, SseK2, and SseK3 comprise a family of highly similar Salmonella effectors that are translocated by the SPI-2 T3SS during infection (5Kujat Choy S.L. Boyle E.C. Gal-Mor O. Goode D.L. Valdez Y. Vallance B.A. Finlay B.B. SseK1 and SseK2 are novel translocated proteins of Salmonella enterica serovar typhimurium.Infect. Immun. 2004; 72: 5115-5125Crossref PubMed Scopus (66) Google Scholar, 6Brown N.F. Coombes B.K. Bishop J.L. Wickham M.E. Lowden M.J. Gal-Mor O. Goode D.L. Boyle E.C. Sanderson K.L. Finlay B.B. Salmonella phage ST64B encodes a member of the SseK/NleB effector family.PLoS ONE. 2011; 6: e17824Crossref PubMed Scopus (49) Google Scholar). SseK family members show high sequence similarity to NleB1, a T3SS effector protein from enteropathogenic Escherichia coli (EPEC), which functions as an arginine glycosyltransferase and catalyzes the addition of N-acetylglucosamine (GlcNAc) to arginine residues of the mammalian signaling adaptors FADD and TRADD, a modification termed Arg-GlcNAcylation (7Pearson J.S. Giogha C. Ong S.Y. Kennedy C.L. Kelly M. Robinson K.S. Lung T.W. Mansell A. Riedmaier P. Oates C.V. Zaid A. Muhlen S. Crepin V.F. Marches O. Ang C.S. Williamson N.A. O'Reilly L.A. Bankovacki A. Nachbur U. Infusini G. Webb A.I. Silke J. Strasser A. Frankel G. Hartland E.L. A type III effector antagonizes death receptor signalling during bacterial gut infection.Nature. 2013; 501: 247-251Crossref PubMed Scopus (202) Google Scholar, 8Li S. Zhang L. Yao Q. Li L. Dong N. Rong J. Gao W. Ding X. Sun L. Chen X. Chen S. Shao F. Pathogen blocks host death receptor signalling by arginine GlcNAcylation of death domains.Nature. 2013; 501: 242-246Crossref PubMed Scopus (199) Google Scholar). A recent report provides evidence that SseK1 and SseK3, but not SseK2, also function as Arg-GlcNAc transferases (9Gunster R.A. Matthews S.A. Holden D.W. Thurston T.L. SseK1 and SseK3 type III secretion system effectors inhibit NF-kappaB signaling and necroptotic cell death in salmonella-infected macrophages.Infect. Immun. 2017; 85: e00010-17PubMed Google Scholar). Mutation of a conserved DxD catalytic motif within SseK1 and SseK3 abrogates their glycosyltransferase activity (9Gunster R.A. Matthews S.A. Holden D.W. Thurston T.L. SseK1 and SseK3 type III secretion system effectors inhibit NF-kappaB signaling and necroptotic cell death in salmonella-infected macrophages.Infect. Immun. 2017; 85: e00010-17PubMed Google Scholar), consistent with findings for NleB1 (7Pearson J.S. Giogha C. Ong S.Y. Kennedy C.L. Kelly M. Robinson K.S. Lung T.W. Mansell A. Riedmaier P. Oates C.V. Zaid A. Muhlen S. Crepin V.F. Marches O. Ang C.S. Williamson N.A. O'Reilly L.A. Bankovacki A. Nachbur U. Infusini G. Webb A.I. Silke J. Strasser A. Frankel G. Hartland E.L. A type III effector antagonizes death receptor signalling during bacterial gut infection.Nature. 2013; 501: 247-251Crossref PubMed Scopus (202) Google Scholar, 8Li S. Zhang L. Yao Q. Li L. Dong N. Rong J. Gao W. Ding X. Sun L. Chen X. Chen S. Shao F. Pathogen blocks host death receptor signalling by arginine GlcNAcylation of death domains.Nature. 2013; 501: 242-246Crossref PubMed Scopus (199) Google Scholar). These studies describing catalytically important regions of the glycosyltransferases provide opportunities to better understand the function of these novel enzymes (10Wong Fok Lung T. Giogha C. Creuzburg K. Ong S.Y. Pollock G.L. Zhang Y. Fung K.Y. Pearson J.S. Hartland E.L. Mutagenesis and functional analysis of the bacterial arginine glycosyltransferase effector NleB1 from enteropathogenic Escherichia coli.Infect. Immun. 2016; 84: 1346-1360Crossref PubMed Scopus (17) Google Scholar). Although well recognized as glycosyltransferases, there are conflicting reports regarding the host substrates of the SseK effectors. One report suggested that recombinant SseK1 modifies recombinant TRADD in vitro (8Li S. Zhang L. Yao Q. Li L. Dong N. Rong J. Gao W. Ding X. Sun L. Chen X. Chen S. Shao F. Pathogen blocks host death receptor signalling by arginine GlcNAcylation of death domains.Nature. 2013; 501: 242-246Crossref PubMed Scopus (199) Google Scholar), whereas a subsequent report suggested SseK1 modifies both TRADD and FADD when co-expressed ectopically in mammalian cell lines (9Gunster R.A. Matthews S.A. Holden D.W. Thurston T.L. SseK1 and SseK3 type III secretion system effectors inhibit NF-kappaB signaling and necroptotic cell death in salmonella-infected macrophages.Infect. Immun. 2017; 85: e00010-17PubMed Google Scholar). Yet another report using in vitro glycosylation assays suggested that recombinant SseK1 glycosylates GAPDH but not FADD (11El Qaidi S. Chen K. Halim A. Siukstaite L. Rueter C. Hurtado-Guerrero R. Clausen H. Hardwidge P.R. NleB/SseK effectors from Citrobacter rodentium, Escherichia coli,Salmonella enterica display distinct differences in host substrate specificity.J. Biol. Chem. 2017; 292: 11423-11430Abstract Full Text Full Text PDF PubMed Scopus (43) Google Scholar). SseK3 on the other hand was reported to bind but not modify the E3-ubiquitin ligase TRIM32 (12Yang Z. Soderholm A. Lung T.W. Giogha C. Hill M.M. Brown N.F. Hartland E. Teasdale R.D. SseK3 is a Salmonella effector that binds TRIM32 and modulates the host's NF-kappaB signalling activity.PLoS ONE. 2015; 10: e0138529PubMed Google Scholar), and was shown to weakly modify TRADD but not FADD (9Gunster R.A. Matthews S.A. Holden D.W. Thurston T.L. SseK1 and SseK3 type III secretion system effectors inhibit NF-kappaB signaling and necroptotic cell death in salmonella-infected macrophages.Infect. Immun. 2017; 85: e00010-17PubMed Google Scholar). Although these studies provide useful insights, the true role of these effectors is better interrogated through non-biased screens conducted under conditions that reflect endogenous levels of the effectors and host proteins (13Scott N.E. Giogha C. Pollock G.L. Kennedy C.L. Webb A.I. Williamson N.A. Pearson J.S. Hartland E.L. The bacterial arginine glycosyltransferase effector NleB preferentially modifies Fas-associated death domain protein (FADD).J. Biol. Chem. 2017; 292: 17337-17350Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar). Here, we explored the endogenous Arg-GlcNAc glycosyltransferase activity of SseK1 and SseK3 during Salmonella infection. Using a mass spectrometry-based approach to enrich arginine GlcNAcylated peptides from infected host cells (13Scott N.E. Giogha C. Pollock G.L. Kennedy C.L. Webb A.I. Williamson N.A. Pearson J.S. Hartland E.L. The bacterial arginine glycosyltransferase effector NleB preferentially modifies Fas-associated death domain protein (FADD).J. Biol. Chem. 2017; 292: 17337-17350Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar), we found that SseK1 modified the signaling adaptor TRADD, whereas SseK3 modified the signaling receptors TNFR1 and TRAILR. In addition, we performed structural studies on SseK3 and showed that the enzyme displays a classic GT-A glycosyltransferase fold and binds UDP-GlcNAc in a narrow and deep cleft with the GlcNAc facing the surface. Together these studies suggest that Salmonella has evolved multiple means to manipulate death receptor signaling through the acquisition of arginine glycosyltransferases with differing substrate specificities. Further, we have determined the crystal structure of SseK3 alone and with the UDP-GlcNAc substrate. The UDP is retained in the active site whereas GlcNAc is cleaved under crystallization conditions. However, in the structure of an SseK3 E258Q mutant, GlcNAc is retained within the binding site although cleaved of UDP. A long, negatively charged depression indicates the entry site of the arginine sidechain for glycosylation. The strains used in this study are listed in Table I. Bacteria were grown with shaking at 37 °C in Luria-Bertani (LB) broth in the presence of ampicillin (100 μg/ml), streptomycin (50 μg/ml), or kanamycin (100 μg/ml) when required.Table IStrains used in this studyStrainRelevant characteristicsReferenceSL1344Wild type S. enterica serovar Typhimurium strain SL1344Nathaniel BrownΔsseK1/2/3SL1344 ΔsseK1ΔsseK2ΔsseK3(6)ΔsseK2/3SL1344 ΔsseK2ΔsseK3(6)ΔsseK1/2SL1344 ΔsseK1ΔsseK2(5)BRD509SL1344, aroA aroD(28, 29)S. cerevisiae Y2H GoldMATa, trp1–901, leu2–3, 112, ura3–52, his3–200, gal4Δ, gal80Δ, LYS2:: GAL1UAS–Gal1TATA–His3, GAL2UAS–Gal2TATA–Ade2 URA3:: MEL1UAS–Mel1TATA AUR1-C MEL1Clontech Open table in a new tab The plasmids and primers used in this study are listed in Table II, Table III, respectively. DNA-modifying enzymes were used in accordance with the manufacturer's instructions (New England BioLabs, Ipswich, MA). Plasmids were extracted using the Qiagen QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA). PCR products and restriction digests were performed using the Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI). pTrc99A-SseK1, pTrc99A-SseK2, and pTrc99A-SseK3 were constructed by amplifying sseK1, sseK2, and sseK3 from pEGFP-C2-SseK1, pEGFP-C2-SseK2, and pEGFP-C2-SseK3 using the primer pairs SseK1F/R, SseK2F/R, and SseK3F/R, respectively. The PCR product was digested with EcoRI and BamHI and ligated into pTrc99A to produce a C-terminal 2× hemagglutinin tag fusion to SseK1, SseK2, and SseK3. Constructs were transformed into XL-1B cells, and verified by colony PCR and sequencing using the primer pair pTrc99AF/R.Table IIPlasmids used in this studyPlasmidRelevant characteristicsReferencepTrc99ALow copy bacterial expression vector with inducible lacI promoter, AmpRPharmacia BiotechpTrc99A-SseK1sseK1 from S. Typhimurium SL1344 in pTrc99A, AmpRThis studypTrc99A-SseK1DxD(229–231)AAAsseK1 from S. Typhimurium SL1344 in pTrc99A, with DxD (229–231) catalytic motif mutated to AAA, AmpRThis studypTrc99A-SseK1E255AsseK1 from S. Typhimurium SL1344 in pTrc99A, with Glu255 mutated to Ala, AmpRThis studypTrc99A-SseK2sseK2 from S. Typhimurium SL1344 in pTrc99A, AmpRThis studypTrc99A-SseK2DxD(239–241)AAAsseK2 from S. Typhimurium SL1344 in pTrc99A with DxD(239–241) catalytic motif mutated to AAA, AmpRThis studypTrc99A-SseK2E271AsseK2 from S. Typhimurium SL1344 in pTrc99A, with Glu271 mutated to Ala, AmpRThis studypTrc99A-SseK3sseK3 from S. Typhimurium SL1344 in pTrc99A, AmpRThis studypTrc99A-SseK3DxD(226–228)AAAsseK3 from S. Typhimurium SL1344 in pTrc99A with DxD(226–228) catalytic motif mutated to AAA, AmpRThis studypTrc99A-SseK3E258AsseK3 from S. Typhimurium SL1344 in pTrc99A, with Glu258 mutated to Ala, AmpRThis studyp3xFlag-Myc-CMV-24Dual tagged N-terminal Met-3xFlag and C-terminal c-myc expression vector, AmpRSigma-AldrichpFlag-TRADDHuman TRADD in p3xFlag-Myc-CMV, AmpRJürg TschopppFlag-TRADDR235AHuman TRADD with Arg235 mutated to Ala, in p3xFlag-Myc-CMV, AmpRThis studypFlag-TRADDR245AHuman TRADD with Arg245 mutated to Ala, in p3xFlag-Myc-CMV, AmpRThis studypFlag-TRADDR235A/R245AHuman TRADD with Arg235 and Arg245 mutated to Ala, in p3xFlag-Myc-CMV, AmpRThis studypFlag-hTRAILR2DDHuman TRAILR2 death domain in p3xFlag-Myc-CMV, AmpRThis studypFlag-hTNFR1DDHuman TNFR1 death domain in p3xFlag-Myc-CMV, AmpRThis studypEGFP-C2Expression vector carrying EGFP fused to the N terminus of the partner protein, KanRClontechpEGFP-C2-SseK1sseK1 from S. Typhimurium SL1344 in pEGFP-C2, KanRThis studypEGFP-C2-SseK3sseK3 from S. Typhimurium SL1344 in pEGFP-C2, KanRThis studypEGFP-C2-SseK3E258AsseK3 from S. Typhimurium SL1344 in pEGFP-C2, with Glu258 mutated to Ala, KanRThis studypET28aBacterial expression vector with T7lac promoter including N-terminal 6 x Histidine tag, KanRNovagenpET28a-hTRAILR2DDHuman TRAILR2 death domain in pET28a, KanRThis studypGBKT7High copy number yeast expression vector carrying a GAL4 DNA binding domain, KanR (bacterial selection), Trp (selectable marker in yeast)ClontechpGBKT7-NleB1nleB1 from EPEC E2348/69 in pGBKT7, KanR,TrpThis studypGBKT7-SseK3sseK3 from S. Typhimurium SL1344 inpGBKT7, KanR, TrpThis studypGADT7-ADHigh copy number yeast expression vector carrying a GAL4 activation domain, AmpR (bacterial selection), Leu (selectable marker in yeast)ClontechpGADT7-AD-FADDDDDeath domain of human FADD in pGADT7-AD, AmpR, LeuThis studypGADT7-AD-TNFR1DDDeath domain of human TNFR1 in pGADT7-AD,AmpR, LeuThis studypGADT7-AD-hTRAILR2DDHuman TRAILR2 death domain in pGADT7-AD, AmpR, LeuThis studypGEX-4T-1Low copy number N-terminal glutathione-S-transferase fusion vector, AmpRGE HealthcarepGEX-SseK3sseK3 from S. Typhimurium SL1344 in pGEX-4T-1, AmpRThis study Open table in a new tab Table IIIPrimers used in this studyPrimerPrimer sequence 5′-3′pTrc99AFCGGTTCTGGCAAATATTCpTrc99ARGCAGTTCCCTACTCTCGCp3xFlag-Myc-CMV-24FAATGTCGTAATAACCCCGCCCCGTTGACGCp3xFlag-Myc-CMV-24RTATTAGGACAAGGCTGGTGGGCACpEGFP-C2FAACACCCCCATCGGCGpEGFP-C2RGTAACCATTATAAGCTGCpGBKT7-BDFAATACGACTCACTATAGGpGBKT7-BDRCGTTTTAAAACCTAAGAGTCpGADT7-ADFAATACGACTCACTATAGGpGADT7-ADRGGTGCACGATGCACAGpGEX-4T-1FCGTATTGAAGCTATCCCACAApGEX-4T-1RGGGAGCTGCATGTGTCAGAGpET28aFAATACGACTCACTATAGGpET28aRGCTAGTTATTGCTCAGCGGSseK1FCGGAATTCATGGAGCATTTAATTGTTATGATCCCSseK1RCGGGATCCCTACGCATAATCCGGCACATCATACGGATACGCATAATCCGGCACATCATACGGATACTGCACATGCCTCGCCCSseK2FCGGAATTCATGGCACGTTTTAATGCCGSseK2RCGGGATCCTTACGCATAATCCGGCACATCATACGGATACGCATAATCCGGCACATCATACGGATACCTCCAAGAACTGGCAGSseK3FCGGAATTCATGTTTTCTCGAGTCAGAGGSseK3RCGGGATCCTTACGCATAATCCGGCACATCATACGGATACGCATAATCCGGCACATCATACGGATATCTCCAGGAGCTGATAGTCGST-SseK3FCGCGAATTCATGTTTTCTCGAGTCAGAGGTTTTCGST- SseK3RCGCGTCGACTTATCTCCAGGAGCTGATAGTCAAACTGCFADDFCGCGAATTCATGCTGTGTGCAGCATTTAACGTCATATGFADDRCGCGGATCCTTACTGCTGAACCTCTTGTACCAGGhTNFR1DD-FCGCCATATGATGACGCTGTACGCCGTGGTGGhTNFR1DD-RCGCGGATCCTCACTCGATGTCCTCCAGGCAGChTRAILR2DD-FCGCGAATTCATGGATCCCACTGAGACTCTGAGAChTRAILR2DD-RCGCGGATCCTTAGAACTTTCCAGAGCTCAACAAGTGSseK1DXD-FGGTGTATATATCTTGCTGCTGCTATGATTATCACGGAAAAACTGGSseK1DXD-RCCAGTTTTTCCGTGATAATCATAGCAGCAGCAAGATATATACACCSseK2DXD-FGTGGGTGCATATATCTTGCTGCAGCTATGTTACTTACTGATAAACSseK2DXD-RGTTTATCAGTAAGTAACATAGCTGCAGCAAGATATATGCACCCACSseK3DXD-FCTGGAGGTGGCTGCATATATCTTGCTGCTGCTATGTTACTTACAGSseK3DXD-RCTGTAAGTAACATAGCAGCAGCAAGATATATGCAGCCACCTCCAGSseK1E255A-FCGTGCTTCTATGGCAAACGGGATAATAGCTSseK1E255A-RAGCTATTATCCCGTTTGCCATAGAAGCACGSseK2E271A-FTGTTAGCCTTGCAAATGGGATTATTGCTGTSseK2E271A-RACAGCAATAATCCCATTTGCAAGGCTAACASseK3E258A-FGCATGAGTCTTGCAAATGGGATTATCGCCGSseK3E258A-RCGGCGATAATCCCATTTGCAAGACTCATGChTRADDR235A-FCGCAAGGTGGGGGCCTCACTGCAGCGAGhTRADDR235A-RCTCGCTGCAGTGAGGCCCCCACCTTGCGhTRADDR245A-FCGCCGGGTCCGCCAGCGCCCGGhTRADDR245A-RCCGGGCGCTGGCGGACCCGGCGGFPS1FAAAGAATTCATGGAGCATTTAATTGTTATGGFPS1RAAAGGATCCCTACTGCACATGCCTCGhTRAILR2DD-F2CGCGAATTCATGGATCCCACTGAGACTCTGAGAChTRAILR2DD-R2CCAAGCTTTTAGAACTTTCCAGAGCTCAACAAGTGG Open table in a new tab pEGFP-C2-SseK2 and pEGFP-C2-SseK3 were constructed by amplifying sseK2 and sseK3 from S. typhimurium SL1344 genomic DNA using the primer pairs GFPS2F/R and GFPS3F/R respectively and AmpliTaq Gold DNA polymerase. The resultant PCR products were purified and ligated into pGEM-T-Easy vector at an insert:vector molar ratio of 3:1. The ligation reactions were transformed into XL-1 Blue cells and plated onto LA plates containing ampicillin and X-gal. Plasmids were extracted and digested with EcoRI and SalI to release the bacterial genes, which were gel purified and ligated into predigested pEGFP-C2. The ligation reactions were then transformed into XL-1 Blue cells and colony PCR was performed using primers pEGFP-C2F/R to select positive clones. The correct insert was confirmed by sequencing using the same primer pair. The primer pair hTRAILR2DD-F/R was used to amplify the region encoding the death domain of TRAILR2 from HeLa cDNA (Sigma Aldrich). The resulting amplicon was gel purified and digested with EcoRI and BamHI and ligated into predigested pGADT7. The ligation reactions were transformed into XL-1 Blue cells and plated on LA containing ampicillin. The correct insert was verified by colony PCR and sequencing with the primer pair pGADT7-ADF/R. pFlag-hTRAILR2DD was constructed by amplifying the death domain of human TNFRSF10B from pGADT7- hTRAILR2DD using the primer pair hTRAILR2DD-F/hTRAILR2DD-R. The PCR product was digested with EcoRI and BamHI and ligated into p3xFlag-Myc-CMV-24 to produce an N-terminal 3xFlag fusion to hTRAILR2DD. pFlag-hTRAILR2DD was transformed into XL-1B cells, and verified by colony PCR and sequencing using the primer pair p3xFlag-Myc-CMV-24F/R. pGEX-4T-1-SseK3 was constructed by amplifying sseK3 from pEGFP-C2-SseK3 using the primer pair GST-SseK3F/R. The PCR product was digested with EcoRI and SalI and ligated into predigested pGEX-4T-1 to produce an N-terminal GST fusion to SseK3. pGEX-4T-1-SseK3 was transformed into XL-1B cells, and verified by colony PCR and sequencing using the primer pair pGEX-4T-1F/R. The region encoding the death domain of TNFR1 was amplified using the primer pair FLAGTNFR1DDF/R and pGADT7-TNFR1DD as template. The resulting amplicon was gel purified and digested with BglII and SalI and ligated into predigested p3xFLAG-Myc-CMV-24 before transforming the reactions into XL-1 Blue cells. Colony PCR and sequencing were performed with the primer pair p3xFlag-Myc-CMV-24F/R to ensure the correct insert has been ligated. pGBKT7-NleB1 was constructed by digesting pGBT9-NleB1 (7Pearson J.S. Giogha C. Ong S.Y. Kennedy C.L. Kelly M. Robinson K.S. Lung T.W. Mansell A. Riedmaier P. Oates C.V. Zaid A. Muhlen S. Crepin V.F. Marches O. Ang C.S. Williamson N.A. O'Reilly L.A. Bankovacki A. Nachbur U. Infusini G. Webb A.I. Silke J. Strasser A. Frankel G. Hartland E.L. A type III effector antagonizes death receptor signalling during bacterial gut infection.Nature. 2013; 501: 247-251Crossref PubMed Scopus (202) Google Scholar), which carries nleB1 flanked in between the restriction sites EcoRI and BamHI and ligating into pGBKT7 digested with EcoRI and BamHI. pGBKT7-SseK3 was constructed by amplifying sseK3 from pEGFP-C2-SseK3 using the primer pair SseK3F/R. The PCR product was ligated into the cloning vector pGEM-T-Easy and the ligation reaction was transformed into XL-1 Blue cells. Transformants were then selected on LA containing ampicillin and X-gal. Plasmids were extracted and digested with EcoRI and SalI to release the bacterial gene, which was then ligated into predigested pGBKT7 to create pGBKT7-SseK3. This plasmid was sequenced using the primer pair pGBKT7F/R. pGADT7-FADDDD, pGADT7-TNFR1DD, and pGADT7-hTRAILR2DD were constructed by amplifying the death domain regions of human FADD, TNFR1, and TRAILR2 from HeLa cDNA using the primer pairs FADDDD-F/R, TNFR1DD-F/R, and hTRAILR2DD-F/R, respectively. Amplified FADDDD was digested with EcoRI and BamHI, TNFR1DD was digested with NdeI and BamHI, and hTRAILR2DD was digested with EcoRI and BamHI. Digested PCR products were ligated into predigested pGADT7 and transformed into XL-1 Blue cells. Constructs were verified by colony PCR and sequencing using the primer pair pGADT7F/R. For structural investigations, the segment corresponding to residues 25–335 of sseK3 from Salmonella Typhimurium (strain SL1344) (Uniprot: A0A0H3NMP8) was cloned into vector pRL652, a derivative of vector pGEX-4T-1 (GE Healthcare) adapted for ligation-independent cloning. The construct contained a TEV-cleavable GST tag at the N terminus. Site-directed mutagenesis of plasmid constructs was performed using the QuikChange II Site-Directed Mutagenesis kit (Stratagene, La Jolla, CA), according to the manufacturer's instructions. pTrc99A-SseK1DxD(229–231)AAA, pTrc99A-SseK2DxD(239–241)AAA, and pTrc99A-SseK3DxD(226–228)AAA were generated using pTrc99A-SseK1, pTrc99A-SseK2, or pTrc99A-SseK3 as template DNA and amplified by PCR using the primer pairs SseK1DxD-F/R, SseK2DxD-F/R, or SseK3DxD-F/R, respectively. pTrc99A-SseK1E255A, pTrc99A-SseK2E271A, and pTrc99A-SseK3E258A were generated using pTrc99A-SseK1, pTrc99A-SseK2, or pTrc99A-SseK3 as template DNA and amplified by PCR using the primer pairs SseK1E255A-F/R, SseK2E271A-F/R, or SseK3E258A-F/R, respectively. pFlag-hTRADDR235A and pFlag-hTRADDR245A were generated using pFlag-hTRADD as template DNA and amplified by PCR using the primer pairs hTRADDR235A-F/R and hTRADDR245A-F/R, respectively. pFlag-hTRADDR235A/R245A was generated using pFlag-hTRADDR235A as template DNA and amplified by PCR using the primer pair hTRADDR245A-F/R. All PCR products were digested with DpnI at 37 °C overnight before subsequent transformation into XL1-B cells. Plasmids were extracted and sequenced using the primer pairs pTrc99AF/R, p3xFlag-Myc-CMV-24F/R, or pEFGP-C2F/R, as required. HEK293T cells (human embryonic kidney 293 cells expressing the SV40 large T-antigen, source: ATCC® CRL-3216), RAW264.7 cells (murine leukemic monocyte-macrophage cells, source: Richard Strugnell, University of Melbourne) and HeLa 229 cells (human cervical carcinoma cells, source: Hayley J. Newton, University of Melbourne) were maintained in DMEM, low glucose with GlutaMAX™ supplement and pyruvate (DMEM (1X) + GlutaMAX(TM)-I) (Gibco, Life Technologies Grand Island, NY). THP-1 cells (human leukemic monocytes, source: Ashley Mansell, Hudson Institute) were maintained in RPMI medium 1640, with GlutaMAX™ supplement (RPMI (1X) + GlutaMAX(TM)-I) (Gibco, Life Technologies). Tissue culture media was further supplemented with 10% (v/v) heat-inactivated fetal bovine serum (FBS) (Thermo Fisher Scientific, Carlsbad, CA). Cells were maintained in a 37 °C, 5% CO2 incubator, and passaged to a maximum of 30 times. HEK293T cells and HeLa 229 cells were split when cells reached 80 to 90% confluency with 1 ml 0.05% Trypsin-EDTA (1X) (Gibco, Life Technologies) per 75 cm2 of tissue culture, then resuspended with 10 volumes of DMEM supplemented with FBS. RAW264.7 cells were physically detached with a cell scraper and further diluted in fresh DMEM supplemented with FBS. THP-1 cells were split when the cell density reached 5 × 105 to 8 × 105 cells/ml per 75 cm2 of tissue culture, then seeded at 1.5 × 105 cells/ml with RPMI supplemented with FBS in 75 cm2 of tissue culture flasks. RAW264.7 cells were seeded to 24 well plates at a concentration of 3 × 105 cells per well 1 day before infection. HeLa 229 cells were seeded to 6 well plates at a concentration of 2.5 × 106 per well the day before infection. THP-1 cells were seeded to 6 well plates at a concentration of 2.5 × 106 per well 3 days before infection, 60 ng/ml of phorbol 12-myristate 13-acetate (Enzo Life Sciences, Farmingdale, NY) was supplemented in the RPMI medium. 10 ml LB broths containing appropriate antibiotic were inoculated with Salmonella strains and incubated at 37 °C overnight with shaking at 180 rpm. On the day of infection, the OD600 readings of the overnight culture were read and used to estimate bacterial counts. Cells were then infected at a multiplicity of infection (MOI) of 10. 24 well plates were centrifuged at 1500 rpm for 5 min at room temperature to promote and synchronize infection. Infected cells were incubated at 37 °C, 5% CO2 for 30 min. Culture media was replaced with media containing 100 μg/ml gentamicin (Pharmacia, Uppsala, Sweden), and cells were incubated at 37 °C, 5% CO2 for a further 1 h. Culture media was replaced with media containing 10 μg/ml gentamicin, and where necessary, 1 mm IPTG, and cells were incubated at 37 °C, 5% CO2 to the required time, post infection. Cells were lysed in cold 1× KalB lysis buffer (50 mm Tris-HCl pH 7.4, 150 mm NaCl, 1 mm EDTA, 1% (v/v) Triton X-100) supplemented with 2 mm Na3VO4, 10 mm NaF, 1 mm PMSF, and 1 x EDTA-free Complete protease inhibitor mixture (Roche). Cell lysate was incubated for at least 30 min on ice, then cell debris was pelleted at 13,000 rpm at 4 °C for 12 min. The soluble protein fraction was mixed with 4× Bolt® LDS sample buffer (Life Technologies) and DTT (Astral Scientific) to a final concentration of 50 mm. Proteins were boiled at 80 to 90 °C for 10 min, then loaded to Bolt® 4–12% Bis-Tris Plus gels (Life Technologies) alongside SeeBlue® prestained protein ladder (Life Technologies). Proteins were separated by electrophoresis using an XCell SureLock™ Mini-Cell system (Life Technologies) with 1 x Bolt® MES SDS or 1× Bolt® MOPS SDS running buffer (Life Technologies), according to the manufacturer's instructions. Following electrophoresis, proteins were transferred onto nitrocellulose membranes using the iBlot2® gel transfer device (Life Technologies) and iBlot2® nitrocellulose transfer stacks (Life Technologies), according to the manufacturer's instructions. Membranes were blocked in 5% (w/v) skim milk in TBS (20 mm Tris, 50 mm NaCl, pH 8.0) with 0.1% (v/v) Tween 20 at room temperature for at least 1 h with shaking at 60 rpm. Membranes were rinsed and washed in TBS Tween, then probed one of the following primary antibodies as required at 4 °C overnight with shaking at 60 rpm: rabbit monoclonal anti-ArgGlcNAc (Abcam, Cambridge, UK), mouse monoclonal anti-HA (BioLegend, San Diego CA), mouse monoclonal anti-GFP (R" @default.
• W2949203676 created "2019-06-27" @default.
• W2949203676 creator A5005759921 @default.
• W2949203676 creator A5012563060 @default.
• W2949203676 creator A5027644421 @default.
• W2949203676 creator A5033216655 @default.
• W2949203676 creator A5041609811 @default.
• W2949203676 creator A5049173678 @default.
• W2949203676 creator A5059420190 @default.
• W2949203676 creator A5061399026 @default.
• W2949203676 creator A5062475816 @default.
• W2949203676 creator A5077521144 @default.
• W2949203676 creator A5078115460 @default.
• W2949203676 creator A5090259731 @default.
• W2949203676 date "2019-06-01" @default.
• W2949203676 modified "2023-10-15" @default.
• W2949203676 title "Salmonella Effectors SseK1 and SseK3 Target Death Domain Proteins in the TNF and TRAIL Signaling Pathways*" @default.
• W2949203676 cites W1504378572 @default.
• W2949203676 cites W1912870130 @default.
• W2949203676 cites W1919759039 @default.
• W2949203676 cites W1982090038 @default.
• W2949203676 cites W1986656413 @default.
• W2949203676 cites W1994098589 @default.
• W2949203676 cites W2002788678 @default.
• W2949203676 cites W2004324618 @default.
• W2949203676 cites W2004457956 @default.
• W2949203676 cites W2009085926 @default.
• W2949203676 cites W2010927211 @default.
• W2949203676 cites W2021024902 @default.
• W2949203676 cites W2032575813 @default.
• W2949203676 cites W2035806681 @default.
• W2949203676 cites W2042048278 @default.
• W2949203676 cites W2043268333 @default.
• W2949203676 cites W2047439787 @default.
• W2949203676 cites W2062270875 @default.
• W2949203676 cites W2068521408 @default.
• W2949203676 cites W2080752012 @default.
• W2949203676 cites W2081226705 @default.
• W2949203676 cites W2086665516 @default.
• W2949203676 cites W2092196409 @default.
• W2949203676 cites W2092508425 @default.
• W2949203676 cites W2095013915 @default.
• W2949203676 cites W2097813770 @default.
• W2949203676 cites W2105167594 @default.
• W2949203676 cites W2105186639 @default.
• W2949203676 cites W2113505777 @default.
• W2949203676 cites W2118453371 @default.
• W2949203676 cites W2121103946 @default.
• W2949203676 cites W2124026197 @default.
• W2949203676 cites W2135168209 @default.
• W2949203676 cites W2139552156 @default.
• W2949203676 cites W2146520052 @default.
• W2949203676 cites W2150497215 @default.
• W2949203676 cites W2152997840 @default.
• W2949203676 cites W2162608046 @default.
• W2949203676 cites W2165660929 @default.
• W2949203676 cites W2169499352 @default.
• W2949203676 cites W2170776626 @default.
• W2949203676 cites W2176052250 @default.
• W2949203676 cites W2180229411 @default.
• W2949203676 cites W2283896737 @default.
• W2949203676 cites W2463195069 @default.
• W2949203676 cites W2571548261 @default.
• W2949203676 cites W2616359747 @default.
• W2949203676 cites W2620490360 @default.
• W2949203676 cites W2742891955 @default.
• W2949203676 cites W2750786467 @default.
• W2949203676 cites W2771020040 @default.
• W2949203676 cites W2785777923 @default.
• W2949203676 cites W2897597765 @default.
• W2949203676 cites W4235493536 @default.
• W2949203676 cites W4248872320 @default.
• W2949203676 doi "https://doi.org/10.1074/mcp.ra118.001093" @default.
• W2949203676 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/6553940" @default.
• W2949203676 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/33526192" @default.
• W2949203676 hasPublicationYear "2019" @default.
• W2949203676 type Work @default.
• W2949203676 sameAs 2949203676 @default.
• W2949203676 citedByCount "47" @default.
• W2949203676 countsByYear W29492036762019 @default.
• W2949203676 countsByYear W29492036762020 @default.
• W2949203676 countsByYear W29492036762021 @default.
• W2949203676 countsByYear W29492036762022 @default.
• W2949203676 countsByYear W29492036762023 @default.
• W2949203676 crossrefType "journal-article" @default.
• W2949203676 hasAuthorship W2949203676A5005759921 @default.
• W2949203676 hasAuthorship W2949203676A5012563060 @default.
• W2949203676 hasAuthorship W2949203676A5027644421 @default.
• W2949203676 hasAuthorship W2949203676A5033216655 @default.
• W2949203676 hasAuthorship W2949203676A5041609811 @default.
• W2949203676 hasAuthorship W2949203676A5049173678 @default.
• W2949203676 hasAuthorship W2949203676A5059420190 @default.
• W2949203676 hasAuthorship W2949203676A5061399026 @default.
• W2949203676 hasAuthorship W2949203676A5062475816 @default.
• W2949203676 hasAuthorship W2949203676A5077521144 @default.
• W2949203676 hasAuthorship W2949203676A5078115460 @default.
• W2949203676 hasAuthorship W2949203676A5090259731 @default.
• W2949203676 hasBestOaLocation W29492036761 @default.

• next