FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2976179467> ?p ?o ?g. }

• W2976179467 endingPage "204" @default.
• W2976179467 startingPage "192" @default.
• W2976179467 abstract "Primitive sterol evolution plays an important role in fossil record interpretation and offers potential therapeutic avenues for human disease resulting from nematode infections. Recognizing that C4-methyl stenol products [8(14)-lophenol] can be synthesized in bacteria while C4-methyl stanol products (dinosterol) can be synthesized in dinoflagellates and preserved as sterane biomarkers in ancient sedimentary rock is key to eukaryotic sterol evolution. In this regard, nematodes have been proposed to convert dietary cholesterol to 8(14)-lophenol by a secondary metabolism pathway that could involve sterol C4 methylation analogous to the C2 methylation of hopanoids (radicle-type mechanism) or C24 methylation of sterols (carbocation-type mechanism). Here, we characterized dichotomous cholesterol metabolic pathways in Caenorhabditis elegans that generate 3-oxo sterol intermediates in separate paths to lophanol (4-methyl stanol) and 8(14)-lophenol (4-methyl stenol). We uncovered alternate C3-sterol oxidation and Δ7 desaturation steps that regulate sterol flux from which branching metabolite networks arise, while lophanol/8(14)-lophenol formation is shown to be dependent on a sterol C4α-methyltransferse (4-SMT) that requires 3-oxo sterol substrates and catalyzes a newly discovered 3-keto-enol tautomerism mechanism linked to S-adenosyl-l-methionine-dependent methylation. Alignment-specific substrate-binding domains similarly conserved in 4-SMT and 24-SMT enzymes, despite minimal amino acid sequence identity, suggests divergence from a common, primordial ancestor in the evolution of methyl sterols. The combination of these results provides evolutionary leads to sterol diversity and points to cryptic C4-methyl steroidogenic pathways of targeted convergence that mediate lineage-specific adaptations.­­ Primitive sterol evolution plays an important role in fossil record interpretation and offers potential therapeutic avenues for human disease resulting from nematode infections. Recognizing that C4-methyl stenol products [8(14)-lophenol] can be synthesized in bacteria while C4-methyl stanol products (dinosterol) can be synthesized in dinoflagellates and preserved as sterane biomarkers in ancient sedimentary rock is key to eukaryotic sterol evolution. In this regard, nematodes have been proposed to convert dietary cholesterol to 8(14)-lophenol by a secondary metabolism pathway that could involve sterol C4 methylation analogous to the C2 methylation of hopanoids (radicle-type mechanism) or C24 methylation of sterols (carbocation-type mechanism). Here, we characterized dichotomous cholesterol metabolic pathways in Caenorhabditis elegans that generate 3-oxo sterol intermediates in separate paths to lophanol (4-methyl stanol) and 8(14)-lophenol (4-methyl stenol). We uncovered alternate C3-sterol oxidation and Δ7 desaturation steps that regulate sterol flux from which branching metabolite networks arise, while lophanol/8(14)-lophenol formation is shown to be dependent on a sterol C4α-methyltransferse (4-SMT) that requires 3-oxo sterol substrates and catalyzes a newly discovered 3-keto-enol tautomerism mechanism linked to S-adenosyl-l-methionine-dependent methylation. Alignment-specific substrate-binding domains similarly conserved in 4-SMT and 24-SMT enzymes, despite minimal amino acid sequence identity, suggests divergence from a common, primordial ancestor in the evolution of methyl sterols. The combination of these results provides evolutionary leads to sterol diversity and points to cryptic C4-methyl steroidogenic pathways of targeted convergence that mediate lineage-specific adaptations.­­ Biosterols when converted to their geosterane counterparts provide the fossil record with a timeline for the origin and divergence of eukaryotic life. Equally significant, the emergence of C27-C29-Δ5 sterols in protists and in the geological record as C27-C29 steranes reflect the central importance of specific C4-desalkyl-24-desalkyl/24-alkyl sterols in cell vitality as architectural components of membranes (1Nes W.D. Nes W.R. Lipids in Evolution. Plenum Press, New York1980Crossref Google Scholar, 2Brassell S.C. Isopentenoids and geochemistry.in: Nes W.D. Isopentenoids and Other Natural Products: Evolution and Function. American Chemical Society, Washington, DC1994: 2-30Crossref Google Scholar, 3Hoshino Y. Poshibaeva A. Meredith W. Snape C. Poshibaev V. Versteegh G.J. Kuznetsov N. Leider A. van Maldegem L. Neumann M. et al.Cryogenian evolution of stigmasteroid biosynthesis.Sci. Adv. 2017; 3: e1700887Crossref PubMed Scopus (36) Google Scholar). The structural and stereochemical diversity of these membrane inserts are largely derived from the action of sterol C24-methyl transferases (SMTs), which catalyze the carbocation-mediated methylation of Δ24-sterol substrates to generate an enormous variety of sterol side-chain-modified products (4Giner J.L. Biosynthesis of marine sterol side chains.Chem. Rev. 1993; 93: 1735-1752Crossref Scopus (75) Google Scholar, 5Nes W.D. Enzyme mechanisms for sterol C-methylations.Phytochemistry. 2003; 64: 75-95Crossref PubMed Scopus (43) Google Scholar). 24-SMTs, considered to have arisen in the last eukaryotic common ancestor (6Desmond E. Gribaldo S. Phylogenomics of sterol synthesis: insights into the origin, evolution, and diversity of a key eukaryotic feature.Genome Biol. Evol. 2009; 1: 364-381Crossref PubMed Google Scholar, 7Haubrich B.A. Collins E.K. Howard A.L. Wang Q. Snell W.J. Miller M.B. Thomas C.D. Pleasant S.K. Nes W.D. Characterization, mutagenesis and mechanistic analysis of an ancient algal sterol C24-methyltransferase: implications for understanding sterol evolution in the green lineage.Phytochemistry. 2015; 113: 64-72Crossref PubMed Scopus (18) Google Scholar) following the rise of oxygen perhaps as early as 1,600 million years ago (MYA) (8Gold D.A. Caron A. Fournier G.P. Summons R.E. Paleoproterozoic sterol biosynthesis and the rise of oxygen.Nature. 2017; 543: 420-423Crossref PubMed Scopus (47) Google Scholar, 9Brocks J.J. Love G.D. Summons R.E. Knoll A.H. Logan G.A. Bowden S.A. Biomarker evidence for green and purple sulphur bacteria in a stratified Palaeoproterozoic sea.Nature. 2005; 437: 866-870Crossref PubMed Scopus (398) Google Scholar), presumably have undergone diversification through single-product formation of C28 and C29 sterols or, as is more often the case in the Precambrian era, by a substrate-promiscuous or partitioning-explicit SMT yielding phyla-specific mixtures of C26 to C31 sterols that as steranes appear in the mid-Proterzoic to Phanerzoic eons, 550 to 1,200 MYA (10Gold D.A. Grabenstatter J. de Mendoza A. Riesgo A. Ruiz-Trillo I. Summons R.E. Sterol and genomic analyses validate the sponge biomarker hypothesis.Proc. Natl. Acad. Sci. USA. 2016; 113: 2684-2689Crossref PubMed Scopus (77) Google Scholar, 11Bobrovskiy I. Hope J.M. Ivantsov A. Nettersheim B.J. Hallmann C. Brocks J.J. Ancient steroids establish the Ediacaran fossil Dickinsonia as one of the earliest animals.Science. 2018; 361: 1246-1249Crossref PubMed Scopus (77) Google Scholar, 12Nettersheim B.J. Brocks J.J. Schwelm A. Hope J.M. Not F. Lomas M. Schmidt C. Schiebel R. Nowack E.C. De Deckker P. et al.Putative sponge biomarkers in unicellular Rhizaria question an early rise of animals.Nat. Ecol. Evol. 2019; 3: 577-581Crossref PubMed Scopus (30) Google Scholar, 13Brocks J.J. Jarrett A.J.M. Sirantoine E. Kenig F. Moczydłowska M. Porter S. Hope J. Early sponges and toxic protists: possible sources of cryostane, an age diagnostic biomarker antedating Sturtian Snowball Earth.Geobiology. 2016; 14: 129-149Crossref PubMed Scopus (60) Google Scholar, 14Aboglila S. Grice K. Trinajstic K. Snape C. Williford K.H. The significance of 24- norcholestanes, 4-methylsteranes and dinosteranes in oils and source-rocks from East Sirte Basin (Libya).Appl. Geochem. 2011; 26: 1694-1705Crossref Scopus (9) Google Scholar). Despite the predominance of C24-alkyl sterols in eukaryotes and their absence in bacteria, we still do not know when and how rarely C4-methyl stanols and stenols can accumulate in a wide range of prokaryotic and eukaryotic organisms (Fig. 1) (15Patterson G.W. Phylogenetic distribution of sterols.in: Nes W.D. Isopentenoids and Other Natural Products: Evolution and Function. American Chemical Society, Washington, DC1994: 90-108Crossref Google Scholar, 16Volkman J.K. Sterols and other triterpenoids: source specificity and evolution of biosynthetic pathways.Org. Geochem. 2005; 36: 139-159Crossref Scopus (226) Google Scholar, 17Goad L. The sterols of marine invertebrates: composition, biosynthesis, and metabolites.in: Scheuer P.J. Marine Natural Products. Academic Press, New York1978: 76-172Crossref Google Scholar). As is sometimes possible, fossil steranes with the unprecedented 4-methylation in ring-A have been identified as molecular biomarkers in dinoflagellate evolution (14Aboglila S. Grice K. Trinajstic K. Snape C. Williford K.H. The significance of 24- norcholestanes, 4-methylsteranes and dinosteranes in oils and source-rocks from East Sirte Basin (Libya).Appl. Geochem. 2011; 26: 1694-1705Crossref Scopus (9) Google Scholar). C-4 methylated sterols are most frequently found to accumulate in nature as ring-C unsaturated compounds such as Δ8(14)-lophenol [4α-methyl cholest-8(14)-enol] synthesized in bacteria and its 24-methyl analogue in dinoflagellate algae, respectively (15Patterson G.W. Phylogenetic distribution of sterols.in: Nes W.D. Isopentenoids and Other Natural Products: Evolution and Function. American Chemical Society, Washington, DC1994: 90-108Crossref Google Scholar, 16Volkman J.K. Sterols and other triterpenoids: source specificity and evolution of biosynthetic pathways.Org. Geochem. 2005; 36: 139-159Crossref Scopus (226) Google Scholar), or nuclear-saturated, as in dinosterol (C4α-methyl, 23,24-dimethyl ergost-22-enol), dicytosterol (C4α-methyl C24-ethyl poriferast-22-enol), and C24-methyl lophanol (C4,24-dimethyl cholestanol) synthesized in dinoflagellate algae and amoebae, respectively (17Goad L. The sterols of marine invertebrates: composition, biosynthesis, and metabolites.in: Scheuer P.J. Marine Natural Products. Academic Press, New York1978: 76-172Crossref Google Scholar, 18Nes W.D. Norton R.A. Crumley F.G. Madigan S.J. Katz E.R. Sterol phylogenesis and algal evolution.Proc. Natl. Acad. Sci. USA. 1990; 87: 7565-7569Crossref PubMed Scopus (74) Google Scholar). Biosynthetic reasoning suggests C4α-methyl sterols of eukaryotes are produced in similar fashion from protosterol (lanosterol in animals or cycloartenol in plants) (19Nes W.D. Biosynthesis of cholesterol and other sterols.Chem. Rev. 2011; 111 (</jrn>): 6423-6451Crossref PubMed Scopus (296) Google Scholar). Typically, a single C4α-demethylase in eukaryotes removes the methyl group from a C4α/β-dimethyl- and C4α-methyl-sterol substrate, generating the 3-oxo sterol product, while bacteria utilize a catalytically distinct demethylase in the removal of the C4β-methyl group from lanosterol, yielding the equivalent C4α-methylated product (20Lee A.K. Banta A.B. Wei J-H. Kiemle D.J. Feng J. Giner L-J. Welander P.V. C-4 sterol demethylation enzymes distinguish bacterial and eukaryotic sterol synthesis.Proc. Natl. Acad. Sci. USA. 2018; 115 (</jrn>): 5884-5889Crossref PubMed Scopus (15) Google Scholar). From an evolutionary perspective, there have been few biochemical insights into the molecular and enzymic determinants responsible for the uncommon product profiles typified by the C4-methyl sterol Δ8(14)-lophenol. The most comprehensive evidence for invertebrate cholesterol metabolism yielding Δ8(14)-lophenol is based on the sterol auxotroph Caenorhabditis elegans (21Chitwood D.J. Nematode sterol biochemistry.in: Patterson G.W. Nes W.D. Physiology and Biochemistry of Sterols. AOCS Press, Champaign, IL1991: 267-303Google Scholar) that can synthesize C4-methyl sterols and dafachronic acid hormones (bile acid-like structures) (supplemental Figs. 1–3) (22Chitwood D.J. Lusby W.R. Lozano R. Thompson M.J. Svoboda J.A. Novel nuclear methylation of sterols by the nematode Caenorhabditis elegans.Steroids. 1983; 42: 311-319Crossref PubMed Scopus (27) Google Scholar, 23Hannich J.T. Entchev E.V. Mende F. Boytchev H. Martin R. Zagoriy V. Theumer G. Riezman I. Riezman H. Knölker H-J. et al.Methylation of the sterol nucleus by STRM-1 regulates dauer larva formation in Caenorhabditis elegans.Dev. Cell. 2009; 16: 833-843Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar, 24Aguilaniu H. Fabrizio P. Witting M. The role of dafachronic acid signaling in development and longevity in Caenorhabditis elegans: digging deeper using cutting-edge analytical chemistry.Front. Endocrinol. (Lausanne). 2016; 7: 12Crossref PubMed Scopus (19) Google Scholar). Accordingly, a downstream split in the pathway develops such that the main trunk continues to C4-methyl Δ8(14)-sterol production while the branch route proceeds to C4-desmethyl Δ4- or Δ7-3-oxo sterols; the latter compounds convert to dafachronic acid steroid hormones. The sterolic enzymes in C. elegans capable of Δ8(14)-lophenol production appear to be organized in reverse order and to possess substrate and reaction specificities distinct from related enzymes assembled in cholesterol biosynthesis pathways (Fig. 1). In contrast to C4-methyl sterol utilization in sterol prototrophs, in which the C4-methyl group(s) is necessarily removed in conversion to cholesterol for growth support (25Darnet S. Schaller H. Metabolism and biological activities of 4-methyl sterols.Molecules. 2019; 24: 451-475Crossref PubMed Scopus (13) Google Scholar, 26Bloch K.E. Sterol, structure and membrane function.Crit. Rev. Biochem. 1983; 14: 47-92Crossref PubMed Scopus (498) Google Scholar), in C. elegans the inclusion of a C4-methyl group on the metabolite product is essential for larval growth or to effect dauer formation (27Merris M. Kraeft J. Tint G. Lenard J. Long-term effects of sterol depletion in C-elegans: sterol content of synchronized wild-type and mutant populations.J. Lipid Res. 2004; 45: 2044-2051Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar, 28Merris M. Wadsworth W.G. Khamrai U. Bittman R. Chitwood D.J. Lenard J. Sterol effects and sites of sterol accumulation in Caenorhabditis elegans: developmental requirement for 4α-methyl sterols.J. Lipid Res. 2003; 44: 172-181Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar, 29Martin R. Entchev E.V. Kurzchalia T.V. Knolker H.J. Steroid hormones controlling the life cycle of the nematode Caenorhabditis elegans: stereoselective synthesis and biology.Org. Biomol. Chem. 2010; 8: 739-750Crossref PubMed Google Scholar, 30Schmidt A.W. Doert T. Goutal S. Gruner M. Mende F. Kurzchalia T.V. Knolker H.J. Regio- and stereospecific synthesis of cholesterol derivatives and their hormonal activity in Caenorhabditis elegans.Eur. J. Org. Chem. 2006; 16: 3687-3706Crossref Scopus (25) Google Scholar). This work nevertheless leaves open questions regarding the number, properties, and evolutionary origin of sterol metabolases in nematodes, most notably the 4-SMT that controls the balance of neutral C28 to acidic C27 sterols in C. elegans (23Hannich J.T. Entchev E.V. Mende F. Boytchev H. Martin R. Zagoriy V. Theumer G. Riezman I. Riezman H. Knölker H-J. et al.Methylation of the sterol nucleus by STRM-1 regulates dauer larva formation in Caenorhabditis elegans.Dev. Cell. 2009; 16: 833-843Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar); its substrate specificity and reaction mechanism remain enigmatic. In the current study of C. elegans sterol synthetic abilities, we address these questions by integrating cell-based biochemistry, deuterium labeling, metabolite identifications, and cloned enzyme characterization. In first examining cholesterol metabolism to establish flux control, we identify a branch-point biosynthetic step Δ7 desaturation catalyzed by DAF-36p that regulates whether cholesterol converts to Δ7- and Δ8(14)-lophenols or to lophanol (Δ0-sterol) and show sterol C3-oxidase(s) generate 3-oxo sterol substrates as integral metabolites of the canonical synthetic pathway to 8(14)-lophenol. The full complement of seven distinct cholesterol metabolism enzymes in 8(14)-lophenol synthesis, including putatively two new ones, C3 and C4 reductase, predicted in flux studies of cholesterol metabolites and one from the original model, C5 desaturase, eliminated based on isotopic labeling studies, were annotated by bioinformatic analysis. As a result of the metabolite profiling that revealed the importance of 3-oxo sterols as intermediates directly and in crossover routes to 4-methyl stanol and stenol production, we cloned and characterized the nematode 4-SMT. We discovered for the first time that 4-SMT catalyzes a unique reaction mechanism and accepts 3-oxo sterols that define its product specificity and separation from 24-SMT enzymes. Intriguingly, genome screening of 4-SMT DNA show this class of catalyst can occur sporadically across eukaryotic kingdoms, suggesting sterol C4 methylation is a phylogenetic signature for sterol diversity and indicates biosynthetic convergence in C4-methyl steroidogenesis between bacteria that synthesize 8(14)-lophenol via a C4-methyl removal process as a primary metabolism and those eukaryotes that synthesize 8(14)-lophenol via a C4-methyl addition process as a secondary metabolism (Fig. 1). Moreover, the establishment of this newly described secondary steroidogenesis pathway in nematodes presents an opportunity for therapeutic applications targeting one or more sterolic enzymes in disease-causing nematodes that depend on C4-methyl sterols for growth or reproduction. C. elegans strain N2 (C. elegans var. Bristol), C. elegans daf-36 mutant, and Escherichia coli strain OP-51 were purchased from the Caenorhabditis Genetics Center. Sterol-depleted nematode growth medium (NGM) was prepared according to the published procedure except the peptone was extracted by HPLC-grade diethyl ether and the agar replaced by molecular biology-grade agarose (determined to be sterol-free) at 1.7% w/v. Synchronized N2-L1 worms (roughly 150) were distributed on 10 cm petri plates containing NGM supplemented with 5 mg/l cholesterol and then seeded with E. coli. The worms were cultured at 25°C for 6 days. The worms of mixed maturation from two petri dishes were collected and washed with M9 buffer three times and used as starting cultures to inoculate new petri dishes supplemented with a different nutrient sterol. For each test supplement, 10 petri dishes of worms were cultured at 25°C for 6 days; no statistical methods were used to predetermine sample size. At harvest, worms were washed from the petri dish and pelleted by centrifugation at 1,000 rpm for 5 min. The pooled worms were washed with PBS buffer (pH 7.5) three times and stored at −80°C until further use. Methionine labeling of sterols was performed using [2H3-methyl]methionine fed to worms at 1 mg/ml in the presence and absence of 5 mg/l sterol supplement using the culture protocol above. In the specialized feeding study of 6F-fluorocholesterol against cholesterol, worms were sterol-depleted by the extraction of N2 worms using the bleach/NaOH method and then incubated in M9 medium for 14 h. The resulting hatched L1 worms were added to NGM plates containing 5 mg/l sterol, and then the worms were incubated at 22°C for 48 h to permit predominantly L4 development. Microscopic visualization of worms was achieved using a stereomicroscope (AmScope) and photographed. The length of each worm was measured using ImageJ software (https:/imagej.nih.gov.ij) without calibration. The length of worms was expressed in number of pixels, and the stage recorded agreed with the published lengths for larval development (supplemental Fig. 2). For some incubation to follow the flux of isotopically labeled metabolite, distilled water in normal growth medium was replaced with deuterated water (20% D2O; v/v). For the latter experiments, larvae (typically about 150 per plate) were cultured at 25°C for 6 days. The worms were removed from the petri dish (usually 10) and collected by centrifugation at 1,000 rpm for 5 min. The worm pellets of mixed age (larvae and adults) were washed with PBS buffer (pH 7.5) three times and stored at −80°C until sterol analysis was performed. Deuterium enrichment in the affected sterol metabolites was determined by establishing the molecular ion cluster for the molecular ion (M+) of each labeled sterol compared with the corresponding unlabeled control sterol. The intensities of the extracted ion chromatogram from M+0 to M+9 (corresponding to D-atom incorporation from NADPD into sterol) of each sterol were manually integrated and tabulated. The isotope distribution was deconvoluted and calculated as percentage of total. In two independent experiments for each feeding study, minimal variation (less than 5%) was detected in the molecular ion clusters of targeted labeled metabolites. Nematode growth studies in response to sterol supplementation were analyzed by a Student's t-test comparing the control to treated cultures (n = 10 independent trials). The SEM was determined to be statistically significant at P > 0.01. Most sterols fed to C. elegans were obtained from our earlier works (supplemental Tables 1 and 2) and were <95% pure by GC. For some feedings, new sterols were prepared or obtained commercially as described in the supplemental data. [2H3-methyl]methionine (98% atom enrichment) and cholesterol-2,2,3,4,4,6-d6 (97% atom enrichment) were purchased from Sigma-Aldrich. Tetraosylate [2H3-methyl]S-adenosyl-l-methionine (SAM) (99% atom enrichment) was purchased from C/D/N Isotopes. Deuterated water (2H2O; D2O) was purchased from Cambridge Isotope Laboratories (99% atom enrichment). The Bradford protein assay kit was purchased from Bio-Rad, and isopropyl-1-thio-β-d-galactoside was from Research Products International Corp. All other reagents and chemicals were from Sigma-Aldrich or Thermo Fisher Scientific unless otherwise noted. Instrumental methods for HPLC, TLC, GC/MS, and 1H/13C-NMR analysis have been described previously and are reported in detail for relevant chemical identifications in the supplemental data. The phage plasmid containing the yk401g2 cDNA clone from C. elegans was provided by Yuji Kohara (The National Institute of Genetics). The 1005 bp coding region of the SMTR-1 (H14E04.1) gene was amplified from the yk401g2 cDNA clone using Pfu polymerase (Stratagene) with a forward primer cgggatcccgatgtccatcaatatgaatgccaac and a reverse primer cggaattccgtcagattttcttcttctcaaacagca (restriction sites underlined) and then inserted into the Gateway entry vector pENTR1A between BamH I and EcoR I sites to generate the pENTR1A-SMTR-1 vector. The bacterial expression construct with the SMTR-1 gene was generated through the recombination between the pENTR1A-SMTR-1 vector and the bacterial expression vector pDEST17 using the Gateway LR Clonase II Enzyme Mix (Invitrogen). The resultant pDEST17-SMTR-1 construct was then transferred into E. coli BL21(DE3) pLysS competent cells (Stratagene), and the 4-SMT was functionally expressed after a 4 h incubation of 400 µM isopropyl-1-thio-β-d-galactoside. Recombinant 4-SMT expressed from E. coli was prepared as for 24-SMT (7Haubrich B.A. Collins E.K. Howard A.L. Wang Q. Snell W.J. Miller M.B. Thomas C.D. Pleasant S.K. Nes W.D. Characterization, mutagenesis and mechanistic analysis of an ancient algal sterol C24-methyltransferase: implications for understanding sterol evolution in the green lineage.Phytochemistry. 2015; 113: 64-72Crossref PubMed Scopus (18) Google Scholar) except the activity assay contained 1.5 mg total lysate protein (Bradford estimation), 100 µM sterol (solubilized in Tween 80), and 200 µM SAM, and the reaction mixture was incubated overnight at 35°C (7Haubrich B.A. Collins E.K. Howard A.L. Wang Q. Snell W.J. Miller M.B. Thomas C.D. Pleasant S.K. Nes W.D. Characterization, mutagenesis and mechanistic analysis of an ancient algal sterol C24-methyltransferase: implications for understanding sterol evolution in the green lineage.Phytochemistry. 2015; 113: 64-72Crossref PubMed Scopus (18) Google Scholar) and then quenched by the addition of 10% methanolic KOH. The sample was extracted with hexane, and the enzyme-generated sterol was analyzed by GC/MS. The sterol 4- and 24-SMT sequences and related methyltransferases discussed in the supplemental data were retrieved from the NCBI (https://www.ncbi.nlm.nih.gov) using STRM (C. elegans sterol 4-methyltansferase) as an inquiry. The sequences were input into Geneious version R9.1.8 (Biomatters Ltd.) and aligned using the embedded MUSCLE program with the default setting. The phylogenetic tree was constructed using the Neighbor-Joining method with MEGA software version 7.0.26. For sterol analysis, the neutral lipids extracted from worm pellets following saponification were analyzed by GC/MS as previously described with cholestane as an internal standard (7Haubrich B.A. Collins E.K. Howard A.L. Wang Q. Snell W.J. Miller M.B. Thomas C.D. Pleasant S.K. Nes W.D. Characterization, mutagenesis and mechanistic analysis of an ancient algal sterol C24-methyltransferase: implications for understanding sterol evolution in the green lineage.Phytochemistry. 2015; 113: 64-72Crossref PubMed Scopus (18) Google Scholar). The GC/MS data were processed with Chemstation software (Agilent) and AMDIS (National Institute of Standards and Technology). The sterol peaks were deconvoluted using AMDIS after baseline correction and unequivocally identified by their coincidental retention time (observed in their retention time relative to the retention time of cholesterol) and identical EI-MS spectra at 70 eV like reference standards in our sterol collection or reference mass spectra from a commercial database (NIST08 mass spectral library). The GC peaks representing sterol amount generated from a total ion current chromatogram were integrated using the software default parameters. Isotope pattern deconvolution of deuterium-labeled cholesterols was calculated from established GC/MS-based methods in the literature. Briefly, for sterols metabolized from the 2,2,3,4,4,6-d6 cholesterol supplement, the intensities of extracted ion chromatograms from molecular ion (M+) to maximum possible deuterium-labeled molecular ion [M+6]+ were integrated after baseline correction. The intensities of each ion were input in an Excel spreadsheet, and the isotope pattern deconvolution for each sterol was calculated after the correction to remove natural 13C isotope contribution. Synthetic routes and GC/MS, TLC, and 1H NMR characterizations of relevant sterols as reference material or substrate for incubations with cloned 4-SMT or cell-based C. elegans feeding is shown in supplemental Figs. 4–9. Although there is much research in C. elegans sterol metabolism, the rationale for how the reported sterol complement generated in nematodes from cholesterol metabolism specifies the metabolite order, what enzyme(s) controls the flux to Δ8(14)-lophenol, and where stanols originate in an otherwise stenol metabolic pathway is poorly defined. In a preliminary study, to confirm previous sterol metabolism results (21Chitwood D.J. Nematode sterol biochemistry.in: Patterson G.W. Nes W.D. Physiology and Biochemistry of Sterols. AOCS Press, Champaign, IL1991: 267-303Google Scholar), we characterized the sterol content of C. elegans fed with cholesterol and D6-cholesterol (Fig. 2A). Consistent with previous reports (21Chitwood D.J. Nematode sterol biochemistry.in: Patterson G.W. Nes W.D. Physiology and Biochemistry of Sterols. AOCS Press, Champaign, IL1991: 267-303Google Scholar), cholesterol fed to the nematode generated cholesterol (cholest-5-enol) [1], 7-dehydrocholesterol (cholesta-5,7-dienol) [2], lathosterol (cholest-7-enol) [12], lophenol [17], and Δ8(14)-lophenol [4α-methyl cholest-8(14)-enol] [18]. However, quite surprisingly, the D6-cholesterol supplement generated a disrupted sterol composition that was presumably due to a kinetic isotope effect on an intermediate enzyme that led to marked depletion in lathosterol and C4-methyl sterol metabolites (Fig. 2A). An examination of the nature and extent of labeling in the deuterium-labeled precursor-product pair of 7-dehydrocholesterol and lathosterol indicated the former compound possessed 6-deuterium atoms (M+ 384 to M+ 390 amu), while the latter compound possessed 4-deuretium atoms (M+ 386 to M+ 390 amu) (Fig. 3A). If this metabolism was to proceed by direct reduction of the Δ5 bond, then the product should retain the original six deuterium atoms and therefore no kinetic isotope effect. To account for the 4-deuterium atom enrichment in lathosterol, we considered an alternative metabolism in which the previously characterized C3 oxidase (31Wollam J. Magner D.B. Magomedova L. Rass E. Shen Y. Rottiers V. Habermann B. Cummins C.L. Antebi A. A novel 3-hydroxysteroid dehydrogenase that regulates reproductive development and longevity.PLoS Biol. 2012; 10: e1001305Crossref PubMed Scopus (50) Google Scholar, 32Patel D.S. Fang L.L. Svy D.K. Ruvkun G. Li W.Q. Genetic identification of HSD-1, a conserved steroidogenic enzyme that directs larval development in Caenorhabditis elegans.Development. 2008; 135: 2239-2249Crossref PubMed Scopus (40) Google Scholar) is responsible for the 2-deuterium atom elimination from D6-cholesterol. For this reaction, the nematode enzyme is anticipated to incorporate two catalytic activities that according to the accepted cholesterol oxidase mechanism (33Yamashita M. Toyama M. Ono H. Fujii I. Hirayama N. Murooka Y. Separation of the two reactions, oxidation and isomerization, catalyzed by Streptomyces cholesterol oxidase.Protein Eng. 199" @default.
• W2976179467 created "2019-10-03" @default.
• W2976179467 creator A5012887233 @default.
• W2976179467 creator A5016736672 @default.
• W2976179467 creator A5033765967 @default.
• W2976179467 creator A5040894182 @default.
• W2976179467 creator A5064294448 @default.
• W2976179467 creator A5066659589 @default.
• W2976179467 creator A5079354727 @default.
• W2976179467 creator A5082591330 @default.
• W2976179467 date "2020-02-01" @default.
• W2976179467 modified "2023-10-11" @default.
• W2976179467 title "A nematode sterol C4α-methyltransferase catalyzes a new methylation reaction responsible for sterol diversity" @default.
• W2976179467 cites W1965585392 @default.
• W2976179467 cites W1967711052 @default.
• W2976179467 cites W1972667687 @default.
• W2976179467 cites W1975156645 @default.
• W2976179467 cites W1982694875 @default.
• W2976179467 cites W1989971869 @default.
• W2976179467 cites W2000106396 @default.
• W2976179467 cites W2002543761 @default.
• W2976179467 cites W2005527182 @default.
• W2976179467 cites W2015458884 @default.
• W2976179467 cites W2023959899 @default.
• W2976179467 cites W2031797010 @default.
• W2976179467 cites W2033352947 @default.
• W2976179467 cites W2034673901 @default.
• W2976179467 cites W2035702937 @default.
• W2976179467 cites W2038095201 @default.
• W2976179467 cites W2045641954 @default.
• W2976179467 cites W2050435570 @default.
• W2976179467 cites W2051257038 @default.
• W2976179467 cites W2053640801 @default.
• W2976179467 cites W2066659033 @default.
• W2976179467 cites W2072817896 @default.
• W2976179467 cites W2075477980 @default.
• W2976179467 cites W2080223857 @default.
• W2976179467 cites W2083970662 @default.
• W2976179467 cites W2085876195 @default.
• W2976179467 cites W2089908098 @default.
• W2976179467 cites W2092689071 @default.
• W2976179467 cites W2106004163 @default.
• W2976179467 cites W2111076637 @default.
• W2976179467 cites W2115983873 @default.
• W2976179467 cites W2119263799 @default.
• W2976179467 cites W2122034659 @default.
• W2976179467 cites W2123257520 @default.
• W2976179467 cites W2128337129 @default.
• W2976179467 cites W2145084324 @default.
• W2976179467 cites W2162344545 @default.
• W2976179467 cites W2162677741 @default.
• W2976179467 cites W2166813071 @default.
• W2976179467 cites W2170590299 @default.
• W2976179467 cites W2182192765 @default.
• W2976179467 cites W2263494382 @default.
• W2976179467 cites W2274921153 @default.
• W2976179467 cites W2402894416 @default.
• W2976179467 cites W2594412381 @default.
• W2976179467 cites W2754945578 @default.
• W2976179467 cites W2804227612 @default.
• W2976179467 cites W2891173296 @default.
• W2976179467 cites W2912420923 @default.
• W2976179467 cites W2913507440 @default.
• W2976179467 cites W2919288453 @default.
• W2976179467 cites W2949257448 @default.
• W2976179467 doi "https://doi.org/10.1194/jlr.ra119000317" @default.
• W2976179467 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/6997595" @default.
• W2976179467 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/31548366" @default.
• W2976179467 hasPublicationYear "2020" @default.
• W2976179467 type Work @default.
• W2976179467 sameAs 2976179467 @default.
• W2976179467 citedByCount "5" @default.
• W2976179467 countsByYear W29761794672020 @default.
• W2976179467 countsByYear W29761794672021 @default.
• W2976179467 countsByYear W29761794672022 @default.
• W2976179467 crossrefType "journal-article" @default.
• W2976179467 hasAuthorship W2976179467A5012887233 @default.
• W2976179467 hasAuthorship W2976179467A5016736672 @default.
• W2976179467 hasAuthorship W2976179467A5033765967 @default.
• W2976179467 hasAuthorship W2976179467A5040894182 @default.
• W2976179467 hasAuthorship W2976179467A5064294448 @default.
• W2976179467 hasAuthorship W2976179467A5066659589 @default.
• W2976179467 hasAuthorship W2976179467A5079354727 @default.
• W2976179467 hasAuthorship W2976179467A5082591330 @default.
• W2976179467 hasBestOaLocation W29761794671 @default.
• W2976179467 hasConcept C104317684 @default.
• W2976179467 hasConcept C185592680 @default.
• W2976179467 hasConcept C18903297 @default.
• W2976179467 hasConcept C2778163477 @default.
• W2976179467 hasConcept C2778718757 @default.
• W2976179467 hasConcept C2778830712 @default.
• W2976179467 hasConcept C33288867 @default.
• W2976179467 hasConcept C55493867 @default.
• W2976179467 hasConcept C86803240 @default.
• W2976179467 hasConcept C91965660 @default.
• W2976179467 hasConceptScore W2976179467C104317684 @default.
• W2976179467 hasConceptScore W2976179467C185592680 @default.
• W2976179467 hasConceptScore W2976179467C18903297 @default.

• next