FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W2992988406> ?p ?o ?g. }

• W2992988406 endingPage "1275" @default.
• W2992988406 startingPage "1268" @default.
• W2992988406 abstract "The realization of electrochemiluminescence (ECL) detection at the single-molecule level is a longstanding goal of ECL assay that requires a novel ECL probe with significantly enhanced luminescence. Here, the synergistic effect of electrochemiluminescence (ECL) is observed unprecedentedly in a new cyclometalated dinuclear Ir(III) complex [Ir2(dfppy)4(imiphenH)]PF6 (1·PF6, PF6– = hexafluorophosphate) in which two {Ir(dfppy)2}+ units are bridged by an imiphenH– ligand. The ECL intensity from complex 1·PF6 is 4.4 and 28.7 times as high as that of its reference mononuclear complexes 2 and 3·PF6, respectively. Theoretical calculation reveals that the S0 to S1 excitation is a local excitation in 1·PF6 with two electron-coupled Ir(III) centers, which contributes to the enhanced ECL. The synergistic effect of ECL in 1·PF6 can be used to detect microRNA 21 at the single-molecule level (microRNA 21: UAGCUUAUCAGACUGAUGUUGA), with detectable ECL emission from this complex intercalated in DNA/microRNA 21 duplex as low as 90 helix molecules. The finding of the synergistic effect of ECL will not only provide a novel strategy for the modulation of ECL intensity but also enable the detection of microRNA at the single-molecule level." @default.
• W2992988406 created "2019-12-13" @default.
• W2992988406 creator A5007158194 @default.
• W2992988406 creator A5011666324 @default.
• W2992988406 creator A5012307071 @default.
• W2992988406 creator A5032122445 @default.
• W2992988406 creator A5033062026 @default.
• W2992988406 creator A5055999501 @default.
• W2992988406 creator A5062506108 @default.
• W2992988406 date "2019-12-02" @default.
• W2992988406 modified "2023-10-16" @default.
• W2992988406 title "Single-Molecule MicroRNA Electrochemiluminescence Detection Using Cyclometalated Dinuclear Ir(III) Complex with Synergistic Effect" @default.
• W2992988406 cites W1899394085 @default.
• W2992988406 cites W1989854295 @default.
• W2992988406 cites W2008262280 @default.
• W2992988406 cites W2018602620 @default.
• W2992988406 cites W2019825125 @default.
• W2992988406 cites W2023416956 @default.
• W2992988406 cites W2024363370 @default.
• W2992988406 cites W2025894745 @default.
• W2992988406 cites W2042147716 @default.
• W2992988406 cites W2060472892 @default.
• W2992988406 cites W2109338111 @default.
• W2992988406 cites W2112067680 @default.
• W2992988406 cites W2131174456 @default.
• W2992988406 cites W2131350133 @default.
• W2992988406 cites W2142438410 @default.
• W2992988406 cites W2154070963 @default.
• W2992988406 cites W2157146768 @default.
• W2992988406 cites W2339421403 @default.
• W2992988406 cites W2508268729 @default.
• W2992988406 cites W2512544230 @default.
• W2992988406 cites W2561817234 @default.
• W2992988406 cites W2589006085 @default.
• W2992988406 cites W2594341544 @default.
• W2992988406 cites W2598611607 @default.
• W2992988406 cites W2735333355 @default.
• W2992988406 cites W2775146936 @default.
• W2992988406 cites W4232565521 @default.
• W2992988406 cites W4385795638 @default.
• W2992988406 doi "https://doi.org/10.1021/acs.analchem.9b04431" @default.
• W2992988406 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/31789019" @default.
• W2992988406 hasPublicationYear "2019" @default.
• W2992988406 type Work @default.
• W2992988406 sameAs 2992988406 @default.
• W2992988406 citedByCount "19" @default.
• W2992988406 countsByYear W29929884062020 @default.
• W2992988406 countsByYear W29929884062021 @default.
• W2992988406 countsByYear W29929884062022 @default.
• W2992988406 countsByYear W29929884062023 @default.
• W2992988406 crossrefType "journal-article" @default.
• W2992988406 hasAuthorship W2992988406A5007158194 @default.
• W2992988406 hasAuthorship W2992988406A5011666324 @default.
• W2992988406 hasAuthorship W2992988406A5012307071 @default.
• W2992988406 hasAuthorship W2992988406A5032122445 @default.
• W2992988406 hasAuthorship W2992988406A5033062026 @default.
• W2992988406 hasAuthorship W2992988406A5055999501 @default.
• W2992988406 hasAuthorship W2992988406A5062506108 @default.
• W2992988406 hasConcept C121332964 @default.
• W2992988406 hasConcept C147789679 @default.
• W2992988406 hasConcept C148869448 @default.
• W2992988406 hasConcept C154881586 @default.
• W2992988406 hasConcept C161790260 @default.
• W2992988406 hasConcept C17525397 @default.
• W2992988406 hasConcept C178790620 @default.
• W2992988406 hasConcept C185592680 @default.
• W2992988406 hasConcept C2777598222 @default.
• W2992988406 hasConcept C32909587 @default.
• W2992988406 hasConcept C38965407 @default.
• W2992988406 hasConcept C49040817 @default.
• W2992988406 hasConceptScore W2992988406C121332964 @default.
• W2992988406 hasConceptScore W2992988406C147789679 @default.
• W2992988406 hasConceptScore W2992988406C148869448 @default.
• W2992988406 hasConceptScore W2992988406C154881586 @default.
• W2992988406 hasConceptScore W2992988406C161790260 @default.
• W2992988406 hasConceptScore W2992988406C17525397 @default.
• W2992988406 hasConceptScore W2992988406C178790620 @default.
• W2992988406 hasConceptScore W2992988406C185592680 @default.
• W2992988406 hasConceptScore W2992988406C2777598222 @default.
• W2992988406 hasConceptScore W2992988406C32909587 @default.
• W2992988406 hasConceptScore W2992988406C38965407 @default.
• W2992988406 hasConceptScore W2992988406C49040817 @default.
• W2992988406 hasFunder F4320321001 @default.
• W2992988406 hasIssue "1" @default.
• W2992988406 hasLocation W29929884061 @default.
• W2992988406 hasOpenAccess W2992988406 @default.
• W2992988406 hasPrimaryLocation W29929884061 @default.
• W2992988406 hasRelatedWork W2048900415 @default.
• W2992988406 hasRelatedWork W2052993417 @default.
• W2992988406 hasRelatedWork W2124851341 @default.
• W2992988406 hasRelatedWork W2550200825 @default.
• W2992988406 hasRelatedWork W2759266103 @default.
• W2992988406 hasRelatedWork W2775297332 @default.
• W2992988406 hasRelatedWork W2903031030 @default.
• W2992988406 hasRelatedWork W299502277 @default.
• W2992988406 hasRelatedWork W3001428629 @default.
• W2992988406 hasRelatedWork W3155355576 @default.
• W2992988406 hasVolume "92" @default.

• next