Matches in SemOpenAlex for { <https://semopenalex.org/work/W2999126721> ?p ?o ?g. }
- W2999126721 abstract "Abstract Diepoxybutane (DEB) is the most potent active metabolite of the environmental chemical 1,3‐butadiene (BD). BD is a human carcinogen that exhibits multiorgan systems toxicity. Our previous studies demonstrated that the X‐C motif chemokine ligand 1 (XCL1) gene expression was upregulated 3.3‐fold in a p53‐dependent manner in TK6 lymphoblasts undergoing DEB‐induced apoptosis. The tumor‐suppressor p53 protein is a transcription factor that regulates a wide variety of cellular processes, including apoptosis, through its various target genes. Thus, the objective of this study was to determine whether XCL1 is a novel direct p53 transcriptional target gene and deduce its role in DEB‐induced toxicity in human lymphoblasts. We utilized the bioinformatics tool p53scan to search for known p53 consensus sequences within the XCL1 promoter region. The XCL1 gene promoter region was found to contain the p53 consensus sequences 5′‐AGACATGCCTAGACATGCCT‐3′ at three positions relative to the transcription start site (TSS). Furthermore, the XCL1 promoter region was found, through reporter gene assays, to be transactivated at least threefold by wild‐type p53 promoter in DEB‐exposed human lymphoblasts. Inactivation of the XCL1 promoter p53‐binding motif located at −2.579 kb relative to TSS reduced the transactivation function of p53 on this promoter in DEB‐exposed cells by 97%. Finally, knockdown of XCL1 messenger RNA with specific small interfering RNA inhibited DEB‐induced apoptosis in human lymphoblasts by 50%. These observations demonstrate, for the first time, that XCL1 is a novel DEB‐induced direct p53 transcriptional target gene that mediates apoptosis in DEB‐exposed human lymphoblasts." @default.
- W2999126721 created "2020-01-23" @default.
- W2999126721 creator A5008831700 @default.
- W2999126721 creator A5009362546 @default.
- W2999126721 creator A5030188411 @default.
- W2999126721 creator A5078337143 @default.
- W2999126721 date "2020-01-18" @default.
- W2999126721 modified "2023-09-30" @default.
- W2999126721 title "Diepoxybutane induces the expression of a novel p53‐target gene XCL1 that mediates apoptosis in exposed human lymphoblasts" @default.
- W2999126721 cites W1588609678 @default.
- W2999126721 cites W1972635235 @default.
- W2999126721 cites W1973186819 @default.
- W2999126721 cites W1986021236 @default.
- W2999126721 cites W1992934215 @default.
- W2999126721 cites W1998398587 @default.
- W2999126721 cites W2004278194 @default.
- W2999126721 cites W2019035778 @default.
- W2999126721 cites W2023797592 @default.
- W2999126721 cites W2031934678 @default.
- W2999126721 cites W2037763386 @default.
- W2999126721 cites W2040291611 @default.
- W2999126721 cites W2040791879 @default.
- W2999126721 cites W2050801403 @default.
- W2999126721 cites W2055895651 @default.
- W2999126721 cites W2072390193 @default.
- W2999126721 cites W2078923181 @default.
- W2999126721 cites W2091591911 @default.
- W2999126721 cites W2103582660 @default.
- W2999126721 cites W2117556297 @default.
- W2999126721 cites W2133373613 @default.
- W2999126721 cites W2170238898 @default.
- W2999126721 cites W2492478403 @default.
- W2999126721 cites W2495185657 @default.
- W2999126721 cites W2499200619 @default.
- W2999126721 cites W2613659990 @default.
- W2999126721 cites W2616099454 @default.
- W2999126721 cites W2618167096 @default.
- W2999126721 cites W2735601916 @default.
- W2999126721 cites W2765319995 @default.
- W2999126721 cites W2767326431 @default.
- W2999126721 cites W2803926691 @default.
- W2999126721 cites W2805212181 @default.
- W2999126721 cites W2886286091 @default.
- W2999126721 cites W2900928394 @default.
- W2999126721 cites W4237137145 @default.
- W2999126721 doi "https://doi.org/10.1002/jbt.22446" @default.
- W2999126721 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/7060116" @default.
- W2999126721 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/31953984" @default.
- W2999126721 hasPublicationYear "2020" @default.
- W2999126721 type Work @default.
- W2999126721 sameAs 2999126721 @default.
- W2999126721 citedByCount "3" @default.
- W2999126721 countsByYear W29991267212020 @default.
- W2999126721 countsByYear W29991267212021 @default.
- W2999126721 countsByYear W29991267212023 @default.
- W2999126721 crossrefType "journal-article" @default.
- W2999126721 hasAuthorship W2999126721A5008831700 @default.
- W2999126721 hasAuthorship W2999126721A5009362546 @default.
- W2999126721 hasAuthorship W2999126721A5030188411 @default.
- W2999126721 hasAuthorship W2999126721A5078337143 @default.
- W2999126721 hasBestOaLocation W29991267212 @default.
- W2999126721 hasConcept C101762097 @default.
- W2999126721 hasConcept C104317684 @default.
- W2999126721 hasConcept C113842279 @default.
- W2999126721 hasConcept C1292079 @default.
- W2999126721 hasConcept C138885662 @default.
- W2999126721 hasConcept C150194340 @default.
- W2999126721 hasConcept C153911025 @default.
- W2999126721 hasConcept C166703698 @default.
- W2999126721 hasConcept C173396325 @default.
- W2999126721 hasConcept C179926584 @default.
- W2999126721 hasConcept C185592680 @default.
- W2999126721 hasConcept C27153228 @default.
- W2999126721 hasConcept C41895202 @default.
- W2999126721 hasConcept C54355233 @default.
- W2999126721 hasConcept C67705224 @default.
- W2999126721 hasConcept C81885089 @default.
- W2999126721 hasConcept C86339819 @default.
- W2999126721 hasConcept C86803240 @default.
- W2999126721 hasConcept C95444343 @default.
- W2999126721 hasConceptScore W2999126721C101762097 @default.
- W2999126721 hasConceptScore W2999126721C104317684 @default.
- W2999126721 hasConceptScore W2999126721C113842279 @default.
- W2999126721 hasConceptScore W2999126721C1292079 @default.
- W2999126721 hasConceptScore W2999126721C138885662 @default.
- W2999126721 hasConceptScore W2999126721C150194340 @default.
- W2999126721 hasConceptScore W2999126721C153911025 @default.
- W2999126721 hasConceptScore W2999126721C166703698 @default.
- W2999126721 hasConceptScore W2999126721C173396325 @default.
- W2999126721 hasConceptScore W2999126721C179926584 @default.
- W2999126721 hasConceptScore W2999126721C185592680 @default.
- W2999126721 hasConceptScore W2999126721C27153228 @default.
- W2999126721 hasConceptScore W2999126721C41895202 @default.
- W2999126721 hasConceptScore W2999126721C54355233 @default.
- W2999126721 hasConceptScore W2999126721C67705224 @default.
- W2999126721 hasConceptScore W2999126721C81885089 @default.
- W2999126721 hasConceptScore W2999126721C86339819 @default.
- W2999126721 hasConceptScore W2999126721C86803240 @default.
- W2999126721 hasConceptScore W2999126721C95444343 @default.
- W2999126721 hasFunder F4320337354 @default.