Matches in SemOpenAlex for { <https://semopenalex.org/work/W3000583872> ?p ?o ?g. }
- W3000583872 endingPage "49" @default.
- W3000583872 startingPage "49" @default.
- W3000583872 abstract "ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies." @default.
- W3000583872 created "2020-01-23" @default.
- W3000583872 creator A5006610844 @default.
- W3000583872 creator A5016770718 @default.
- W3000583872 creator A5037104288 @default.
- W3000583872 creator A5048971494 @default.
- W3000583872 creator A5055516982 @default.
- W3000583872 creator A5066694645 @default.
- W3000583872 creator A5086323219 @default.
- W3000583872 creator A5090690124 @default.
- W3000583872 date "2020-01-11" @default.
- W3000583872 modified "2023-10-18" @default.
- W3000583872 title "Evaluation of an Analogue of the Marine ε-PLL Peptide as a Ligand of G-quadruplex DNA Structures" @default.
- W3000583872 cites W1544082369 @default.
- W3000583872 cites W1832442421 @default.
- W3000583872 cites W1960310614 @default.
- W3000583872 cites W1966836102 @default.
- W3000583872 cites W1968066251 @default.
- W3000583872 cites W1980385734 @default.
- W3000583872 cites W1980513386 @default.
- W3000583872 cites W1981553228 @default.
- W3000583872 cites W1983564187 @default.
- W3000583872 cites W1989366551 @default.
- W3000583872 cites W1989382216 @default.
- W3000583872 cites W2008120871 @default.
- W3000583872 cites W2012219231 @default.
- W3000583872 cites W2015625843 @default.
- W3000583872 cites W2015867768 @default.
- W3000583872 cites W2020374412 @default.
- W3000583872 cites W2022819073 @default.
- W3000583872 cites W2050691108 @default.
- W3000583872 cites W2056072994 @default.
- W3000583872 cites W2062003454 @default.
- W3000583872 cites W2068265599 @default.
- W3000583872 cites W2076969496 @default.
- W3000583872 cites W2088281232 @default.
- W3000583872 cites W2088332375 @default.
- W3000583872 cites W2092552668 @default.
- W3000583872 cites W2116609429 @default.
- W3000583872 cites W2129090112 @default.
- W3000583872 cites W2131479127 @default.
- W3000583872 cites W2140287318 @default.
- W3000583872 cites W2140723425 @default.
- W3000583872 cites W2149169218 @default.
- W3000583872 cites W2149839082 @default.
- W3000583872 cites W2239756921 @default.
- W3000583872 cites W2395640134 @default.
- W3000583872 cites W2472339011 @default.
- W3000583872 cites W2478139731 @default.
- W3000583872 cites W2515611678 @default.
- W3000583872 cites W2558023567 @default.
- W3000583872 cites W2568331132 @default.
- W3000583872 cites W2625231832 @default.
- W3000583872 cites W2758064947 @default.
- W3000583872 cites W2789285266 @default.
- W3000583872 cites W2794033668 @default.
- W3000583872 cites W2890165403 @default.
- W3000583872 cites W2893473306 @default.
- W3000583872 cites W2894616442 @default.
- W3000583872 cites W2897496062 @default.
- W3000583872 cites W2909415609 @default.
- W3000583872 cites W2937210668 @default.
- W3000583872 doi "https://doi.org/10.3390/md18010049" @default.
- W3000583872 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/7024349" @default.
- W3000583872 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/31940851" @default.
- W3000583872 hasPublicationYear "2020" @default.
- W3000583872 type Work @default.
- W3000583872 sameAs 3000583872 @default.
- W3000583872 citedByCount "22" @default.
- W3000583872 countsByYear W30005838722020 @default.
- W3000583872 countsByYear W30005838722021 @default.
- W3000583872 countsByYear W30005838722022 @default.
- W3000583872 countsByYear W30005838722023 @default.
- W3000583872 crossrefType "journal-article" @default.
- W3000583872 hasAuthorship W3000583872A5006610844 @default.
- W3000583872 hasAuthorship W3000583872A5016770718 @default.
- W3000583872 hasAuthorship W3000583872A5037104288 @default.
- W3000583872 hasAuthorship W3000583872A5048971494 @default.
- W3000583872 hasAuthorship W3000583872A5055516982 @default.
- W3000583872 hasAuthorship W3000583872A5066694645 @default.
- W3000583872 hasAuthorship W3000583872A5086323219 @default.
- W3000583872 hasAuthorship W3000583872A5090690124 @default.
- W3000583872 hasBestOaLocation W30005838721 @default.
- W3000583872 hasConcept C106847996 @default.
- W3000583872 hasConcept C116569031 @default.
- W3000583872 hasConcept C12554922 @default.
- W3000583872 hasConcept C133571119 @default.
- W3000583872 hasConcept C151730666 @default.
- W3000583872 hasConcept C155672457 @default.
- W3000583872 hasConcept C170493617 @default.
- W3000583872 hasConcept C171250308 @default.
- W3000583872 hasConcept C185592680 @default.
- W3000583872 hasConcept C192562407 @default.
- W3000583872 hasConcept C2779343474 @default.
- W3000583872 hasConcept C552990157 @default.
- W3000583872 hasConcept C55493867 @default.
- W3000583872 hasConcept C86803240 @default.
- W3000583872 hasConceptScore W3000583872C106847996 @default.