FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W3006833410> ?p ?o ?g. }

• W3006833410 abstract "During routine scouting of corn (Zea mays L.) in 2018, corn leaves exhibiting bacteria-like symptoms were identified in Clay County, South Dakota. Symptomatic leaves showed narrow long lesions with wavy water-soaked margins, typical of bacterial leaf streak of corn caused by Xanthomonas vasicola pv. vasculorum (Korus et al. 2017). Incidence was near 100%, and the severity ranged from moderate to very severe across the field. Small sections of the symptomatic tissue were placed onto a stereomicroscope, and bacterial streaming was readily observed. The corn leaves were then surface sterilized by washing in 10% bleach for 30 s and rinsing three times in sterile water, placed on a modified King’s B medium, and incubated at 30°C for 48 h. Bacterial growth from two independent leaf samples was transferred onto fresh King’s B medium and incubated as previously stated. After 48 h, yellow, viscous mucoid bacterial colonies were observed on the medium. Surface-sterilized symptomatic leaf tissues were cut into 1-cm sections and placed in a 50-ml centrifuge tube and soaked overnight to allow for bacteria to ooze out of the leaf pieces. The leachate was used to extract DNA using the Ultra DNAeasy kit following the manufacturer’s instructions (Qiagen, Redwood, CA). PCR was run on the extracted DNA using putative membrane protein and putative exported protein primers (Xvv3_F, CAAGCAGAGCATGGCAAAC; Xvv3_R, CACGTAGAACCGGTCTTTGG; Xvv5_F, CCGTCGAAATGGTCTCAACT; Xvv5_R, CGGAAGAGTTGGAAGACAGC) (Lang et al. 2017). A negative check was DNA extracted from asymptomatic leaf tissue. The expected product size of 200 bp was obtained from the symptomatic leaves’ leachate DNA only. The PCR amplicons were sequenced at Functional Bioscience in Wisconsin. The resultant sequences were subjected to BLASTn analysis under the plant-associated environmental database and showed a 100% match to X. vasicola pv. vasculorum with 100% sequence coverage. The sequences of one isolate (based on the putative membrane protein primers) were submitted to GenBank (accession MN813968). The isolates were also subjected to biochemical tests and were positive for esculin hydrolysis and cytochrome oxidase, formed mucoid yellow colonies on yeast dextrose agar, and were negative for arabinose utilization. The morphological characteristics along with biochemical and PCR tests confirmed X. vasicola pv. vasculorum as the causal organism of the symptoms observed on corn. To complete Koch’s postulates, eight corn plants (hybrid DKC45-65RIB) were spray inoculated with a bacterial suspension of 1.48 × 10⁷ CFU at the V6 growth stage. Three corn plants were sprayed with distilled water as controls. All plants were placed in a humid chamber for 48 h and then transferred to the greenhouse with lighting set at 14/10 h of light/darkness and an average temperature of 26°C. This was repeated twice. Plants inoculated with the bacterial suspension developed long, narrow, wavy water-soaked lesions 5 to 6 days postinoculation, whereas no symptoms were observed in the control plants. Bacterial colonies were reisolated from inoculated plants only and were confirmed as X. vasicola pv. vasculorum by PCR as above. At this time, bacterial leaf streak seems to be localized but could spread to more corn fields. The impact of bacterial leaf streak on yield is not yet known. There is a need to create awareness among corn growers about the appropriate management practices for controlling this new bacterial disease." @default.
• W3006833410 created "2020-03-06" @default.
• W3006833410 creator A5015075642 @default.
• W3006833410 creator A5033819296 @default.
• W3006833410 creator A5037501763 @default.
• W3006833410 creator A5070727374 @default.
• W3006833410 creator A5071725545 @default.
• W3006833410 date "2020-06-01" @default.
• W3006833410 modified "2023-10-17" @default.
• W3006833410 title "First Report of Xanthomonas vasicola pv. vasculorum, the Causal Agent of Bacterial Leaf Streak of Corn, in South Dakota" @default.
• W3006833410 doi "https://doi.org/10.1094/pdis-12-19-2650-pdn" @default.
• W3006833410 hasPublicationYear "2020" @default.
• W3006833410 type Work @default.
• W3006833410 sameAs 3006833410 @default.
• W3006833410 citedByCount "1" @default.
• W3006833410 countsByYear W30068334102021 @default.
• W3006833410 crossrefType "journal-article" @default.
• W3006833410 hasAuthorship W3006833410A5015075642 @default.
• W3006833410 hasAuthorship W3006833410A5033819296 @default.
• W3006833410 hasAuthorship W3006833410A5037501763 @default.
• W3006833410 hasAuthorship W3006833410A5070727374 @default.
• W3006833410 hasAuthorship W3006833410A5071725545 @default.
• W3006833410 hasBestOaLocation W30068334101 @default.
• W3006833410 hasConcept C103299284 @default.
• W3006833410 hasConcept C144027150 @default.
• W3006833410 hasConcept C2780034373 @default.
• W3006833410 hasConcept C2780746887 @default.
• W3006833410 hasConcept C2993531722 @default.
• W3006833410 hasConcept C35496372 @default.
• W3006833410 hasConcept C42972112 @default.
• W3006833410 hasConcept C46757340 @default.
• W3006833410 hasConcept C523546767 @default.
• W3006833410 hasConcept C54355233 @default.
• W3006833410 hasConcept C59822182 @default.
• W3006833410 hasConcept C6557445 @default.
• W3006833410 hasConcept C71924100 @default.
• W3006833410 hasConcept C86803240 @default.
• W3006833410 hasConceptScore W3006833410C103299284 @default.
• W3006833410 hasConceptScore W3006833410C144027150 @default.
• W3006833410 hasConceptScore W3006833410C2780034373 @default.
• W3006833410 hasConceptScore W3006833410C2780746887 @default.
• W3006833410 hasConceptScore W3006833410C2993531722 @default.
• W3006833410 hasConceptScore W3006833410C35496372 @default.
• W3006833410 hasConceptScore W3006833410C42972112 @default.
• W3006833410 hasConceptScore W3006833410C46757340 @default.
• W3006833410 hasConceptScore W3006833410C523546767 @default.
• W3006833410 hasConceptScore W3006833410C54355233 @default.
• W3006833410 hasConceptScore W3006833410C59822182 @default.
• W3006833410 hasConceptScore W3006833410C6557445 @default.
• W3006833410 hasConceptScore W3006833410C71924100 @default.
• W3006833410 hasConceptScore W3006833410C86803240 @default.
• W3006833410 hasFunder F4320332299 @default.
• W3006833410 hasLocation W30068334101 @default.
• W3006833410 hasOpenAccess W3006833410 @default.
• W3006833410 hasPrimaryLocation W30068334101 @default.
• W3006833410 hasRelatedWork W12984261 @default.
• W3006833410 hasRelatedWork W18299688 @default.
• W3006833410 hasRelatedWork W25568698 @default.
• W3006833410 hasRelatedWork W25955325 @default.
• W3006833410 hasRelatedWork W30963217 @default.
• W3006833410 hasRelatedWork W33805359 @default.
• W3006833410 hasRelatedWork W4279436 @default.
• W3006833410 hasRelatedWork W5093315 @default.
• W3006833410 hasRelatedWork W5195229 @default.
• W3006833410 hasRelatedWork W6953244 @default.
• W3006833410 isParatext "false" @default.
• W3006833410 isRetracted "false" @default.
• W3006833410 magId "3006833410" @default.
• W3006833410 workType "article" @default.