FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W3021813867> ?p ?o ?g. }

• W3021813867 endingPage "651" @default.
• W3021813867 startingPage "640" @default.
• W3021813867 abstract "Loop-mediated isothermal amplification (LAMP) provides effective diagnostic technology for infectious disease pathogen identification and is compatible with inexpensive instrumentation for use in disease-prevalent developing regions. However, simultaneous multiple-target detection and single-nucleotide polymorphism (SNP) identification, essential properties of nucleic acid diagnostics, are difficult to achieve using LAMP. This study introduces loop-primer endonuclease cleavage (LEC)–LAMP, a singleplex or multiplex LAMP technology with single-base specificity for variable SNP identification. We developed a singleplex LEC-LAMP Neisseria meningitidis assay that demonstrated complete analytical specificity and a limit of detection of 3.1 genome copies per reaction. Small-scale clinical testing of this assay demonstrated 100% diagnostic specificity and sensitivity when assessed with anonymized DNA extracts from confirmed cases of bacterial meningitis infection. The single-base specificity of this assay indicated effective SNP identification properties when challenged with DNA templates containing SNPs located within a specific six-base region. This assay was modified to generate an allele-specific LEC-LAMP N. meningitidis assay that successfully demonstrated single-tube differentiation of wild-type and mutant allele templates. The singleplex assay was further modified to generate a multiplex LEC-LAMP assay that successfully demonstrated simultaneous multiple-target detection of three bacterial targets, N. meningitidis, Streptococcus pneumonia, and Hemophilus influenzae. LEC-LAMP is the first report of single-tube, real-time, singleplex or multiplex LAMP technology with single-base specificity for variable SNP identification. Loop-mediated isothermal amplification (LAMP) provides effective diagnostic technology for infectious disease pathogen identification and is compatible with inexpensive instrumentation for use in disease-prevalent developing regions. However, simultaneous multiple-target detection and single-nucleotide polymorphism (SNP) identification, essential properties of nucleic acid diagnostics, are difficult to achieve using LAMP. This study introduces loop-primer endonuclease cleavage (LEC)–LAMP, a singleplex or multiplex LAMP technology with single-base specificity for variable SNP identification. We developed a singleplex LEC-LAMP Neisseria meningitidis assay that demonstrated complete analytical specificity and a limit of detection of 3.1 genome copies per reaction. Small-scale clinical testing of this assay demonstrated 100% diagnostic specificity and sensitivity when assessed with anonymized DNA extracts from confirmed cases of bacterial meningitis infection. The single-base specificity of this assay indicated effective SNP identification properties when challenged with DNA templates containing SNPs located within a specific six-base region. This assay was modified to generate an allele-specific LEC-LAMP N. meningitidis assay that successfully demonstrated single-tube differentiation of wild-type and mutant allele templates. The singleplex assay was further modified to generate a multiplex LEC-LAMP assay that successfully demonstrated simultaneous multiple-target detection of three bacterial targets, N. meningitidis, Streptococcus pneumonia, and Hemophilus influenzae. LEC-LAMP is the first report of single-tube, real-time, singleplex or multiplex LAMP technology with single-base specificity for variable SNP identification. Nucleic acid amplification diagnostics provide improved alternatives to conventional culture-based methods for the identification of infectious disease pathogens, in terms of analytical sensitivity and specificity, time to detection, reduced contamination, and high-throughput capabilities. Real-time PCR is the benchmark nucleic acid amplification technology1Yu A.C.-H. Vatcher G. Yue X. Dong Y. Li M.H. Tam P.H. Tsang P.Y. Wong A.K. Hui M.H. Yang B. Nucleic acid-based diagnostics for infectious diseases in public health affairs.Front Med. 2012; 6: 173-186Crossref PubMed Scopus (22) Google Scholar; however, for low-resourced disease-burdened regions, it is an impractical point-of-care (POC) diagnostic option because of the requirement of expensive thermocycling equipment.2Lu Y. Ma X. Wang J. Sheng N. Dong T. Song Q. Rui J. Zou B. Zhou G. Visualized detection of single-base difference in multiplexed loop-mediated isothermal amplification amplicons by invasive reaction coupled with oligonucleotide probe-modified gold nanoparticles.Biosens Bioelectron. 2017; 90: 388-393Crossref PubMed Scopus (16) Google Scholar Isothermal nucleic acid amplification technologies do not require thermocycling and thus offer a more convenient diagnostic option. Loop-mediated isothermal amplification (LAMP) is one of the most commonly used single-temperature nucleic acid amplification methods and has been extensively applied in the area of infectious disease diagnostics.3Zhao Y. Chen F. Li Q. Wang L. Fan C. Isothermal amplification of nucleic acids.Chem Rev. 2015; 115: 12491-12545Crossref PubMed Scopus (690) Google Scholar,4Deng H. Gao Z. Bioanalytical applications of isothermal nucleic acid amplification techniques.Anal Chim Acta. 2015; 853: 30-45Crossref PubMed Scopus (89) Google Scholar LAMP incorporates strand displacing Bacillus stearothermophilus (Bst) DNA polymerase with target-specific forward and reverse outer, inner, and loop oligonucleotide primers. Typical LAMP reactions are performed at a single temperature ranging from 60°C to 65°C, enabling initial target hybridization by the inner and outer primers. Strand displacing extension from these primers, combined with the sense and antisense inner primer sequences, facilities loop structure formation in LAMP that produces a unique double-looped DNA template. This structure is targeted by the inner and loop oligonucleotide primers, leading to rapid exponential target amplification. LAMP possesses high specificity because of the six oligonucleotide primers targeting eight specific regions on the target DNA and single-digit genome copy sensitivity.5Notomi T. Okayama H. Masubuchi H. Yonekawa T. Watanabe K. Amino N. Hase T. Loop-mediated isothermal amplification of DNA.Nucleic Acids Res. 2000; 28: e63Crossref PubMed Scopus (4726) Google Scholar,6Nagamine K. Hase T. Notomi T. Accelerated reaction by loop-mediated isothermal amplification using loop primers.Mol Cell Probes. 2002; 16: 223-229Crossref PubMed Scopus (1223) Google Scholar Monitoring LAMP reactions can be performed using direct end-point visualization or real-time turbidimetric analysis of magnesium pyrophosphate precipitation, a polymerization by-product.7Mori Y. Nagamine K. Tomita N. Notomi T. Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyrophosphate formation.Biochem Biophys Res Commun. 2001; 289: 150-154Crossref PubMed Scopus (1181) Google Scholar,8Mori Y. Kitao M. Tomita N. Notomi T. Real-time turbidimetry of LAMP reaction for quantifying template DNA.J Biochem Biophys Methods. 2004; 59: 145-157Crossref PubMed Scopus (414) Google Scholar Alternatively, postamplification analysis or real-time monitoring of LAMP can be achieved using intercalating dyes,9McKenna J.P. Fairley D.J. Shields M.D. Cosby S.L. Wyatt D.E. McCaughey C. Coyle P.V. Development and clinical validation of a loop-mediated isothermal amplification method for the rapid detection of Neisseria meningitidis.Diagn Microbiol Infect Dis. 2011; 69: 137-144Crossref PubMed Scopus (41) Google Scholar colorimetric analysis,10Goto M. Honda E. Ogura A. Nomoto A. Hanaki K.-I. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue.Biotechniques. 2009; 46: 167-172Crossref PubMed Scopus (570) Google Scholar fluorescent dyes,11Tanner N.A. Zhang Y. Evans Jr., T.C. Simultaneous multiple target detection in real-time loop-mediated isothermal amplification.Biotechniques. 2012; 53: 81-89Crossref PubMed Scopus (127) Google Scholar,12Nanayakkara I. White I.M. Demonstration of a quantitative triplex LAMP assay with an improved probe-based readout for the detection of MRSA.Analyst. 2019; 144: 3878-3885Crossref PubMed Google Scholar or pH-sensitive dyes.13Tanner N.A. Zhang Y. Evans Jr., T.C. Visual detection of isothermal nucleic acid amplification using pH-sensitive dyes.Biotechniques. 2015; 58: 59-68Crossref PubMed Scopus (214) Google Scholar LAMP is user friendly, cost-effective, robust, capable of amplifying nucleic acid from samples without prior extraction, and compatible with basic POC detection technologies,14Mohon A.N. Menard D. Alam M.S. Perera K. Pillai D.R. A Novel Single-Nucleotide Polymorphism Loop Mediated Isothermal Amplification Assay for Detection of Artemisinin-Resistant Plasmodium falciparum Malaria.. Oxford University Press, New York, NY2018Crossref Scopus (13) Google Scholar, 15Higgins O. Clancy E. Cormican M. Boo T.W. Cunney R. Smith T.J. Evaluation of an internally controlled multiplex Tth endonuclease cleavage loop-mediated isothermal amplification (TEC-LAMP) assay for the detection of bacterial meningitis pathogens.Int J Mol Sci. 2018; 19: 524Crossref Scopus (10) Google Scholar, 16Liu X. Zhang C. Zhao M. Liu K. Li H. Li N. Gao L. Yang X. Ma T. Zhu J. A direct isothermal amplification system adapted for rapid SNP genotyping of multifarious sample types.Biosens Bioelectron. 2018; 115: 70-76Crossref PubMed Scopus (13) Google Scholar making LAMP an ideal near-patient diagnostic option. However, the nonexonuclease strand displacement activity of Bst DNA polymerase in LAMP is not compatible with standard nucleic acid hybridization probes, making multiplex detection difficult.17Aliotta J.M. Pelletier J.J. Ware J.L. Moran L.S. Benner J.S. Kong H. Thermostable Bst DNA polymerase I lacks a 3′→ 5′ proofreading exonuclease activity.Genet Anal. 1996; 12: 185-195Crossref PubMed Scopus (62) Google Scholar Clinical application of nucleic acid diagnostics requires multiplex detection capabilities for simultaneous pathogen detection, reduced analysis time, conservation of sample, and incorporation of assay validating internal controls.18Hoorfar J. Malorny B. Abdulmawjood A. Cook N. Wagner M. Fach P. Practical considerations in design of internal amplification controls for diagnostic PCR assays.J Clin Microbiol. 2004; 42: 1863-1868Crossref PubMed Scopus (335) Google Scholar,19Wang X. Theodore M.J. Mair R. Trujillo-Lopez E. du Plessis M. Wolter N. Baughman A.L. Hatcher C. Vuong J. Lott L. von Gottberg A. Sacchi C. McDonald J.M. Messonnier N.E. Mayer L.W. Clinical validation of multiplex real-time PCR assays for detection of bacterial meningitis pathogens.J Clin Microbiol. 2012; 50: 702-708Crossref PubMed Scopus (96) Google Scholar A recent study introduced a novel internally controlled multiplex LAMP assay, Tth endonuclease cleavage (TEC)–LAMP, for the detection of bacterial meningitis–associated pathogens.15Higgins O. Clancy E. Cormican M. Boo T.W. Cunney R. Smith T.J. Evaluation of an internally controlled multiplex Tth endonuclease cleavage loop-mediated isothermal amplification (TEC-LAMP) assay for the detection of bacterial meningitis pathogens.Int J Mol Sci. 2018; 19: 524Crossref Scopus (10) Google Scholar TEC-LAMP is an adaptation of the standard LAMP method incorporating a restriction enzyme, Tth endonuclease IV, and a TEC primer/probe, an altered inner primer containing 5′-end modifications of an abasic site flanked by a fluorophore and quencher. These modifications enabled the development of a single-tube internally controlled multiplex LAMP assay that could successfully detect multiple targets simultaneously. However, the TEC-LAMP method has limitations in terms of single-base specificity and cannot be used for single-nucleotide polymorphism (SNP) identification. SNPs are single-nucleotide sequence variations found in specific genome locations and present in at least 1% of a population.20Brookes A.J. The essence of SNPs.Gene. 1999; 234: 177-186Crossref PubMed Scopus (954) Google Scholar These are the simplest and most abundant form of genetic sequence variation occurring in approximately every 1000 bases.21Shen W. Tian Y. Ran T. Gao Z. Genotyping and quantification techniques for single-nucleotide polymorphisms.TrAC Trends Anal Chem. 2015; 69: 1-13Crossref Scopus (25) Google Scholar Typically, SNPs are biallelic, with triallelic or tetra-allelic variants presenting less frequently,22Wang D.G. Fan J.-B. Siao C.-J. Berno A. Young P. Sapolsky R. Ghandour G. Perkins N. Winchester E. Spencer J. Large-scale identification, mapping, and genotyping of single-nucleotide polymorphisms in the human genome.Science. 1998; 280: 1077-1082Crossref PubMed Scopus (1642) Google Scholar and are predominantly located in noncoding regions with minimal phenotypic impact. SNPs located in coding regions contribute to phenotypic variations, disease development, and altered responses to drugs or environmental toxins.23Kim S. Misra A. SNP genotyping: technologies and biomedical applications.Annu Rev Biomed Eng. 2007; 9: 289-320Crossref PubMed Scopus (379) Google Scholar Various SNPs are associated with cancer, cardiovascular disorders, diabetes, autoimmune diseases, gastrointestinal disorders, and infectious diseases.24Fareed M. Afzal M. Single nucleotide polymorphism in genome-wide association of human population: a tool for broad spectrum service.Egypt J Med Hum Genet. 2013; 14: 123-134Abstract Full Text Full Text PDF Scopus (50) Google Scholar As a result, SNPs are commonly used as biomarkers for disease association studies, development of personalized medicines, and molecular diagnostics.23Kim S. Misra A. SNP genotyping: technologies and biomedical applications.Annu Rev Biomed Eng. 2007; 9: 289-320Crossref PubMed Scopus (379) Google Scholar Nucleic acid infectious disease diagnostics use SNPs and pathogen point mutations associated with antimicrobial resistances for accurate disease diagnosis, facilitating improved treatment and reduced antimicrobial resistance dissemination.25Blaschitz M. Hasanacevic D. Hufnagl P. Hasenberger P. Pecavar V. Meidlinger L. Konrad M. Allerberger F. Indra A. Real-time PCR for single-nucleotide polymorphism detection in the 16S rRNA gene as an indicator for extensive drug resistance in Mycobacterium tuberculosis.J Antimicrob Chemother. 2011; 66: 1243-1246Crossref PubMed Scopus (11) Google Scholar,26Moers A. Hallett R. Burrow R. Schallig H. Sutherland C. van Amerongen A. Detection of single-nucleotide polymorphisms in Plasmodium falciparum by PCR primer extension and lateral flow immunoassay.Antimicrob Agents Chemother. 2015; 59: 365-371Crossref PubMed Scopus (9) Google Scholar Nucleic acid diagnostic methods with SNP detection capabilities also enable greater specificity for more effective differentiation of closely related pathogens. Typical nucleic acid SNP identification approaches involve differentiation of wild-type and mutant alleles using either allele-specific hybridization or allele-specific enzymatic methods.21Shen W. Tian Y. Ran T. Gao Z. Genotyping and quantification techniques for single-nucleotide polymorphisms.TrAC Trends Anal Chem. 2015; 69: 1-13Crossref Scopus (25) Google Scholar Combining SNP detection capabilities with rapid, sensitive, and specific multiplex isothermal nucleic acid techniques, such as TEC-LAMP, would provide effective and transferable diagnostic technology for POC application. The current article introduces loop-primer endonuclease cleavage (LEC)–LAMP. This technology improves on the single-base specificity limitation identified in TEC-LAMP through oligonucleotide and enzyme modifications. The TEC-LAMP 5′-end inner primer modifications, involving an abasic site flanked by a fluorophore and quencher, are incorporated into the 5′-end of the loop primer in LEC-LAMP (Figure 1). In addition, the Tth endonuclease IV enzyme used in TEC-LAMP is replaced by endonuclease IV in LEC-LAMP. To exemplify the LEC-LAMP technology in this study, leading pathogens associated with bacterial meningitis infection, Neisseria meningitidis, Streptococcus pneumoniae, and Hemophilus influenzae, were used as target pathogens. Single-target detection and SNP identification with a singleplex LEC-LAMP N. meningitidis assay was demonstrated and compared with a singleplex version of the previously reported TEC-LAMP N. meningitidis assay.15Higgins O. Clancy E. Cormican M. Boo T.W. Cunney R. Smith T.J. Evaluation of an internally controlled multiplex Tth endonuclease cleavage loop-mediated isothermal amplification (TEC-LAMP) assay for the detection of bacterial meningitis pathogens.Int J Mol Sci. 2018; 19: 524Crossref Scopus (10) Google Scholar The singleplex LEC-LAMP N. meningitidis assay was further evaluated in terms of analytical specificity, sensitivity, and clinical application. Modified versions of this assay were used to demonstrate single-reaction differentiation of wild-type and mutant allele DNA templates using an allele-specific (AS) LEC-LAMP N. meningitidis assay, as well as simultaneous multiple-target detection using a multiplex LEC-LAMP N. meningitidis, S. pneumoniae, and H. influenzae assay. The singleplex LEC-LAMP N. meningitidis assay was evaluated using a range of N. meningitidis, Neisseria, and closely related non-Neisseria reference strains (Supplemental Table S1). The multiplex LEC-LAMP N. meningitidis, S. pneumoniae, and H. influenzae assay was performed using type strains N. meningitidis NCTC 10025, S. pneumoniae DSM 20566, and H. influenzae DSM 4690. All bacterial strains, stored at −80°C, were cultured in brain heart infusion media (Oxoid, Hampshire, UK) at 37°C for 18 hours under microaerophilic conditions, excluding Haemophilus strains that were cultured using Haemophilus test media (Oxoid). DNA extractions were performed using the DNeasy Blood and Tissue kit (Qiagen, Hilden, Germany) followed by DNA quantification using the Qubit double-stranded DNA broad-range/high-sensitivity assay kits and Qubit 2.0 fluorometer (Life Technologies, Warrington, UK). Genome size standards of 2.2, 2.1, and 1.83 Mb for N. meningitidis, S. pneumoniae, and H. influenzae, respectively, were used to convert resulting DNA concentrations to genome copy values. Extracted DNA samples were stored at −80°C before use. The LEC-LAMP and TEC-LAMP oligonucleotides used in this study (Table 1) were designed with PrimerExplorer V4 (Eiken Chemical, Tokyo, Japan) using the diagnostic targets NMO_1242, SPNA45_01710, and pstA for N. meningitidis, S. pneumoniae, and H. influenzae, respectively. Standard desalted oligonucleotides were synthesized by Integrated DNA Technologies (Leuven, Belgium). The LEC primer/probes for N. meningitidis, S. pneumoniae, and H. influenzae, labeled with FAM, HEX, and Cy5 fluorophores, respectively, and the TEC primer/probe labeled with a FAM fluorophore were high-performance liquid chromatography purified and synthesized by Metabion International AG (Planegg, Germany). Each fluorophore corresponded to one of the three detection channels of the LightCycler 480 instrument II (Roche Diagnostics, Sussex, UK) used to perform the LAMP reactions.Table 1LEC-LAMP and TEC-LAMP OligonucleotidesPrimer typeSequenceNeisseria meningitidis LEC-LAMP Forward inner5′-TGTCGGTGGCTTTGTTGGTGGTGTCGC∼GTGCAAACAGATACGTCCG-3′ Reverse inner5′-CCGATGTACCAGCACCTTGTCC∼GTTTGCGCTGATTACGCCTC-3′ Forward outer5′-CCCAATTCCACATCAATACGTG-3′ Reverse outer5′-GTGGTGTCGGTGGTGTTG-3′ LEC primer/probe wild type5′-(BHQ1)TTGA(dSpacer)A(FAMdT)TGTGTTGGGCGGTTTG-3′ LEC primer/probe mutant5′-(BHQ1)TTGA(dSpacer)C(HEXdT)TGTGTTGGGCGGTTTG-3′(SNP2 specific) Reverse loop5′-CACCACTTGGAAAAACAGAGGC-3′Streptococcus pneumoniae LEC-LAMP Forward inner5′-TGGAAAATGCTCTGGCTTTTGAAGTGA∼CCTACACCAATATCCTCGCT-3′ Reverse inner5′-TCTGTCTGGTAGACAGAATGACGGA∼TCTTTGAGAATCAGATGCTGGA-3′ Forward outer5′-TCCGTCAACGAGGCACAA-3′ Reverse outer5′-AGCAAACTCACCAAGCGC-3′ Forward loop5′-TGATGAAACAGACAAGCTGATTCT-3′ LEC primer/probe5’-(BHQ1)ACTC(dSpacer)CA(HEXdT)GCGCAATGATGGTATAATCC-3′Hemophilus influenzae LEC-LAMP Forward inner5′-TGCCGCTGCTTCACGTAAATTATTTGG∼TGCTTATTCCTATCGTGGTACG-3′ Reverse inner5′-CTTGGTTGCTCTCAATGGCAAG∼GCACGCCAGTTAAAATCCCT-3′ Forward outer5′-GGCTGGAGCATTCGCATT-3′ Reverse outer5′-TTCTCCTGAAATTCGGGCAA-3′ Forward loop5′-AACATATTGTCCGTAGTGCG-3′ LEC primer/probe5’-(BHQ2)TTGT(dSpacer)A(Cy5dT)CGAGCAGCTAAATCAGGGA-3′N. meningitidis TEC-LAMP TEC primer/probe5’-(FAM)TGTC(dSpacer)G(BHQ1dT)GGCTTTGTTGGTGGTGTCGC∼GTGCAAACAGATACGTCCG-3′ Forward inner5′-TGTCGGTGGCTTTGTTGGTGGTGTCGC∼GTGCAAACAGATACGTCCG-3′ Reverse inner5′-CCGATGTACCAGCACCTTGTCC∼GTTTGCGCTGATTACGCCTC-3′ Forward outer5′-CCCAATTCCACATCAATACGTG-3′ Reverse outer5′-GTGGTGTCGGTGGTGTTG-3′ Forward loop5′-TTGAGATTGTGTTGGGCGGTTTG-3′ Reverse loop5′-CACCACTTGGAAAAACAGAGGC-3′Single-base difference between LEC primer/probe wild type and LEC primer/probe mutant shown in bold.∼, Separation between 5′ antisense and 3′ sense inner primer sequences; BHQ1, black hole quencher 1; BHQ1dT, thymine-linked black hole quencher 1; BHQ2, black hole quencher 2; Cy5dT, thymine-linked cyanine fluorophore; dSpacer, 1′,2′-dideoxyribose; FAM, 6-carboxyfluorescein fluorophore; FAMdT, thymine-linked 6-carboxyfluorescein fluorophore; HEXdT, thymine-linked 6-hexachlorofluorescein fluorophore; LAMP, loop-mediated isothermal amplification; LEC, loop-primer endonuclease cleavage; TEC, Tth endonuclease cleavage. Open table in a new tab Single-base difference between LEC primer/probe wild type and LEC primer/probe mutant shown in bold. ∼, Separation between 5′ antisense and 3′ sense inner primer sequences; BHQ1, black hole quencher 1; BHQ1dT, thymine-linked black hole quencher 1; BHQ2, black hole quencher 2; Cy5dT, thymine-linked cyanine fluorophore; dSpacer, 1′,2′-dideoxyribose; FAM, 6-carboxyfluorescein fluorophore; FAMdT, thymine-linked 6-carboxyfluorescein fluorophore; HEXdT, thymine-linked 6-hexachlorofluorescein fluorophore; LAMP, loop-mediated isothermal amplification; LEC, loop-primer endonuclease cleavage; TEC, Tth endonuclease cleavage. The singleplex LEC-LAMP N. meningitidis assay reaction contained 1× Isothermal Amplification Buffer (New England Biolabs, Hitchin, UK), 6 mmol/L MgSO4 (Roche Diagnostics), 1.4 mmol/L deoxynucleotide triphosphate set (New England Biolabs), N. meningitidis oligonucleotides (1.6 μmol/L forward and reverse inner, 0.4 μmol/L LEC primer/probe wild type and reverse loop, and 0.2 μmol/L forward and reverse outer), 8 U Bst 2.0 WarmStart DNA polymerase (New England Biolabs), 1 U endonuclease IV (New England Biolabs), 1 μL DNA template, or 1 μL molecular-grade water for no template control (NTC) reactions, and molecular-grade water to give a final reaction volume of 25 μL. The singleplex TEC-LAMP N. meningitidis assay was prepared as per the LEC-LAMP assay with minor modifications: the endonuclease IV enzyme in the LEC-LAMP assay was replaced with 15 U Tth endonuclease IV (New England Biolabs); the LEC primer/probe wild type was replaced with unmodified forward loop primer (Table 1); and 0.8 μmol/L of the forward inner primer was replaced with TEC primer/probe (Table 1). LAMP reactions were performed for 60 × 1-minute cycles at 67°C in a LightCycler 480 instrument II (Roche Diagnostics). The fluorescence detection channel used was 495 to 520 nm (FAM) with fluorescent measurements recorded every minute. Single-target detection using the singleplex LEC-LAMP and TEC-LAMP N. meningitidis assays was demonstrated by challenging both assays with 103 copies of type-strain N. meningitidis genomic DNA (Figure 2). NTC reactions using molecular-grade water in place of bacterial templates were performed in parallel. Positive results in each reaction were recorded on the LightCycler 480 as exponential signal acquisition exceeding background fluorescence and were represented as fluorescence amplification curves. Cycle threshold (CT) values denoted cycles at which fluorescent signal exceeded background levels. As reactions were performed for 60 × 1-minute cycles, resulting CT values acted as approximate time-to-positivity values in minutes. Analytical specificity of the singleplex LEC-LAMP N. meningitidis assay was evaluated using genomic DNA from a panel of bacterial reference strains (Supplemental Table S1) at 104 genome copy concentrations. The limit of detection (LOD) of the singleplex LEC-LAMP N. meningitidis assay was determined by testing six replicates of 32, 16, 8, 4, 2, and 1 genome copy concentrations of type-strain N. meningitidis NCTC 10025 genomic DNA. Probit regression analysis was performed on the resulting data using Minitab 17 (Supplemental Table S2) to establish assay LOD with 95% probability. The clinical application of the singleplex LEC-LAMP N. meningitidis assay was assessed using archived genomic DNA extracted from blood and cerebrospinal fluid samples of confirmed bacterial meningitis cases. Robert Cunney, Nicola O'Sullivan, Claire McGuinness, and Deirdre Cafferty (Irish Meningitis and Sepsis Reference Laboratory) gifted 72 anonymized clinical samples that had been previously collected and processed as part of routine diagnostic service. Genomic DNA was extracted from these samples using a QIAsymphony SP/AS instrument with QIAamp DSP DNA Blood Mini Kits (Qiagen), as per manufacturer’s instructions, followed by real-time PCR analysis for N. meningitidis, S. pneumoniae, and H. influenzae. The presence of N. meningitidis, S. pneumoniae, and H. influenzae in each respective sample was reconfirmed using singleplex real-time PCR assays targeting the N. meningitidis NMO_1242, S. pneumoniae lepA, and H. influenzae pstA genes (Table 2). PCRs were performed on a LightCycler 480 II instrument, using the LightCycler 480 Probes Master kit (Roche Diagnostics), as per manufacturer’s instructions, testing 2.5 μL of each sample (Supplemental Table S3). For comparative purposes, the diagnostic sensitivity and specificity of the singleplex LEC-LAMP N. meningitidis assay were also determined by testing 2.5 μL of each sample (Supplemental Table S3). The samples from cases of meningococcal infection were used to determine LEC-LAMP diagnostic sensitivity, and samples from cases of pneumococcal and Haemophilus infection were used to determine LEC-LAMP diagnostic specificity. Positive control reactions incorporating respective type-strain genomic DNA at 103 genome copies, and negative control reactions substituting molecular-grade water for bacterial templates, were performed in parallel to the above reactions.Table 2PCR OligonucleotidesTypeSequenceNeisseria meningitidis F5′-CGACATGTTCGAACGTAATCTCC-3′ Prb5’-(FAM)TATCGGGCAAAGCCAAATGCGAAG(BHQ1)-3′ R5′-ATTTCGGTGGCGCGTTT-3′Streptococcus pneumoniae F5′-CTCGTAAGCGTAAACTCCTTG-3′ Prb5’-(FAM)ACGCATGAAATCCATCGGATCAGTT(BHQ1)-3′ R5′-CATACTCAAGACGCTGAGGA-3′Hemophilus influenzae F5′-GGTACGCACYACGGACAATATG-3′ Prb5’-(FAM)AGCTCTTGGTTGCTCTCAATGGCA(BHQ1)-3′ R5′-CCTGATTTAGCYGCTCGATAACA-3′BHQ1, black hole quencher; F, forward; FAM, 6-carboxyfluorescein fluorophore; Prb, Probe; R, reverse. Open table in a new tab BHQ1, black hole quencher; F, forward; FAM, 6-carboxyfluorescein fluorophore; Prb, Probe; R, reverse. Templates used to demonstrate single-base specificity of the singleplex LEC-LAMP N. meningitidis assay were synthetic 500-bp DNA gBlocks Gene Fragments (Supplemental Table S4) purchased from Integrated DNA Technologies. Each template was based on a 500-bp sequence of the N. meningitidis NMO_1242 diagnostic target, with specific SNPs inserted to generate single-base mismatches between these templates and their respective probes (Table 3). Mismatches were designed to generate either guanine to adenine or cytosine to thymine interactions. The SNP0 template did not contain any SNPs and acted as a wild-type template for positive control reactions (Table 3). SNP1-6 templates contained mismatches in close proximity to the LEC primer/probe wild-type abasic site (Table 3), and acted as mutant allele templates for the LEC-LAMP assay. The SNPA template contained a single-base mismatch in close proximity to the TEC primer/probe abasic site and acted as a mutant allele template for the TEC-LAMP assay (Table 3). Single-base specificity of the singleplex LEC-LAMP N. meningitidis assay was demonstrated by challenging the assay with templates SNP1-6 at 104 copies (Figure 3A). For comparison, the TEC-LAMP assay was challenged with the SNPA template at 104 copies (Figure 3B). Positive control reactions for both assays contained N. meningitidis genomic DNA and the SNP0 template at 104 copies, with no template control reactions performed in parallel.Table 3Neisseria meningitidis LEC and TEC Primer/Probes with Complementary Regions of Each gBlocks Gene Fragment TemplateLEC Primer/Probe Wild Type:5′-TTGA=ATTGTGTTGGGCGGTTTG-3′| | | | | | | | | | | | | | | | | | | | | | |SNP0:3′-AACTCTAACACAACCCGCCAAAC-5′SNP1:3′-AACGCTAACACAACCCGCCAAAC-5′SNP2:3′-AACTCGAACACAACCCGCCAAAC-5′SNP3:3′-AACTCTCACACAACCCGCCAAAC-5′SNP4:3′-AACTCTACCACAACCCGCCAAAC-5′SNP5:3′-AACTCTAAAACAACCCGCCAAAC-5′SNP6:3′-AACTCTAACCCAACCCGCCAAAC-5′LEC Primer/Probe Mutant:5′-TTGA=CTTGTGTTGGGCGGTTTG-3′| | | | | | | | | | | | | | | | | | | | | | |SNP0:3′-AACTCTAACACAACCCGCCAAAC-5′SNP2:3′-AACTCGAACACAACCCGCCAAAC-5′TEC Primer/Probe:5′-TGTC=GTGGCTTTGTTGGTGGTGTCGCGTGCAAACAGATACGTCCG-3′| | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | |SNP0:3′-ACAGCCACCGAAACAACCACCACAGCGCACGTTTGTCTATGCAGGC-5′SNPA:3′-ACATCCACCGAAACAACCACCACAGCGCACGTTTGTCTATGCAGGC-5′Underlined base, dye labels; =, abasic site; bolded base, SNP.LEC, loop-primer endonuclease cleavage; SNP, single-nucleotide polymorphism; TEC, Tth endonuclease cleavage. Open table in a new tab Underlined base, dye labels; =, abasic site; bolded base, SNP. LEC" @default.
• W3021813867 created "2020-05-13" @default.
• W3021813867 creator A5051872394 @default.
• W3021813867 creator A5081421163 @default.
• W3021813867 date "2020-05-01" @default.
• W3021813867 modified "2023-10-17" @default.
• W3021813867 title "Loop-Primer Endonuclease Cleavage–Loop-Mediated Isothermal Amplification Technology for Multiplex Pathogen Detection and Single-Nucleotide Polymorphism Identification" @default.
• W3021813867 cites W1975801865 @default.
• W3021813867 cites W1979974453 @default.
• W3021813867 cites W1980066896 @default.
• W3021813867 cites W1981888221 @default.
• W3021813867 cites W1994865683 @default.
• W3021813867 cites W1998634450 @default.
• W3021813867 cites W2001966298 @default.
• W3021813867 cites W2004419363 @default.
• W3021813867 cites W2018143841 @default.
• W3021813867 cites W2019786863 @default.
• W3021813867 cites W2047436268 @default.
• W3021813867 cites W2066385972 @default.
• W3021813867 cites W2071512681 @default.
• W3021813867 cites W2104145784 @default.
• W3021813867 cites W2105025553 @default.
• W3021813867 cites W2105275554 @default.
• W3021813867 cites W2120399147 @default.
• W3021813867 cites W2145303234 @default.
• W3021813867 cites W2154519333 @default.
• W3021813867 cites W2159871990 @default.
• W3021813867 cites W2161481652 @default.
• W3021813867 cites W2163291676 @default.
• W3021813867 cites W2163654162 @default.
• W3021813867 cites W2164063072 @default.
• W3021813867 cites W2168067959 @default.
• W3021813867 cites W2318876254 @default.
• W3021813867 cites W2329081549 @default.
• W3021813867 cites W2465662808 @default.
• W3021813867 cites W2485828101 @default.
• W3021813867 cites W2547164084 @default.
• W3021813867 cites W2560809001 @default.
• W3021813867 cites W2589356716 @default.
• W3021813867 cites W2749815581 @default.
• W3021813867 cites W2765988264 @default.
• W3021813867 cites W2774245476 @default.
• W3021813867 cites W2789127690 @default.
• W3021813867 cites W2792302769 @default.
• W3021813867 cites W2792323960 @default.
• W3021813867 cites W2803007483 @default.
• W3021813867 cites W2803619882 @default.
• W3021813867 cites W2805634366 @default.
• W3021813867 cites W2807011878 @default.
• W3021813867 cites W2946109065 @default.
• W3021813867 cites W81757823 @default.
• W3021813867 cites W89741002 @default.
• W3021813867 doi "https://doi.org/10.1016/j.jmoldx.2020.02.002" @default.
• W3021813867 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/32409120" @default.
• W3021813867 hasPublicationYear "2020" @default.
• W3021813867 type Work @default.
• W3021813867 sameAs 3021813867 @default.
• W3021813867 citedByCount "15" @default.
• W3021813867 countsByYear W30218138672021 @default.
• W3021813867 countsByYear W30218138672022 @default.
• W3021813867 countsByYear W30218138672023 @default.
• W3021813867 crossrefType "journal-article" @default.
• W3021813867 hasAuthorship W3021813867A5051872394 @default.
• W3021813867 hasAuthorship W3021813867A5081421163 @default.
• W3021813867 hasBestOaLocation W30218138671 @default.
• W3021813867 hasConcept C104317684 @default.
• W3021813867 hasConcept C135763542 @default.
• W3021813867 hasConcept C153209595 @default.
• W3021813867 hasConcept C153911025 @default.
• W3021813867 hasConcept C178790620 @default.
• W3021813867 hasConcept C185592680 @default.
• W3021813867 hasConcept C2777028655 @default.
• W3021813867 hasConcept C2777563447 @default.
• W3021813867 hasConcept C2781188995 @default.
• W3021813867 hasConcept C49105822 @default.
• W3021813867 hasConcept C54355233 @default.
• W3021813867 hasConcept C552990157 @default.
• W3021813867 hasConcept C60635243 @default.
• W3021813867 hasConcept C86803240 @default.
• W3021813867 hasConcept C90583042 @default.
• W3021813867 hasConceptScore W3021813867C104317684 @default.
• W3021813867 hasConceptScore W3021813867C135763542 @default.
• W3021813867 hasConceptScore W3021813867C153209595 @default.
• W3021813867 hasConceptScore W3021813867C153911025 @default.
• W3021813867 hasConceptScore W3021813867C178790620 @default.
• W3021813867 hasConceptScore W3021813867C185592680 @default.
• W3021813867 hasConceptScore W3021813867C2777028655 @default.
• W3021813867 hasConceptScore W3021813867C2777563447 @default.
• W3021813867 hasConceptScore W3021813867C2781188995 @default.
• W3021813867 hasConceptScore W3021813867C49105822 @default.
• W3021813867 hasConceptScore W3021813867C54355233 @default.
• W3021813867 hasConceptScore W3021813867C552990157 @default.
• W3021813867 hasConceptScore W3021813867C60635243 @default.
• W3021813867 hasConceptScore W3021813867C86803240 @default.
• W3021813867 hasConceptScore W3021813867C90583042 @default.
• W3021813867 hasFunder F4320321056 @default.
• W3021813867 hasIssue "5" @default.
• W3021813867 hasLocation W30218138671 @default.

• next