FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W3044591597> ?p ?o ?g. }

• W3044591597 endingPage "1971.e4" @default.
• W3044591597 startingPage "1968" @default.
• W3044591597 abstract "Genome-wide association studies have linked noncoding single-nucleotide polymorphisms in the PTPN2 locus to several immuno-mediated diseases, including inflammatory bowel diseases, celiac disease, type 1 diabetes, and rheumatoid arthritis.1Pike K.A. Tremblay M.L. Front Immunol. 2018; 9: 2504Crossref PubMed Scopus (15) Google Scholar PTPN2 encodes an ubiquitous non-receptor protein tyrosine phosphatase that exerts a negative feedback on the JAK-STAT pathway.2Simoncic P.D. et al.Curr Biol. 2002; 12: 446-453Abstract Full Text Full Text PDF PubMed Scopus (247) Google Scholar A key immunoregulatory role of PTPN2 is suggested by studies in mice. Thus, ptpn2−/− mice developed severe lethal systemic inflammation and diarrhea,1Pike K.A. Tremblay M.L. Front Immunol. 2018; 9: 2504Crossref PubMed Scopus (15) Google Scholar whereas T-cell–specific loss of ptpn2 led to peripheral T-cell expansion and autoimmunity and increased susceptibility to intestinal inflammation.1Pike K.A. Tremblay M.L. Front Immunol. 2018; 9: 2504Crossref PubMed Scopus (15) Google Scholar Loss of one ptpn2 copy was sufficient to promote inflammation in a T-cell–mediated model of arthritis,3Svensson M.N.D. et al.J Clin Invest. 2019; 129: 1193-1210Crossref PubMed Scopus (35) Google Scholar overall stressing the importance of 2 functional copies of PTPN2 to prevent excessive T-cell activation. Yet, the exact role of PTPN2 in humans remains to be determined. Herein, we identify PTPN2 haploinsufficiency as a novel monogenic cause of autoimmune enteropathy and illustrate how monogenic diseases provide the opportunity to validate genes or pathways identified by genome-wide association studies, bridging the gap between polyfactorial forms of intestinal inflammation and single-gene defects. Available in the Supplementary Methods. Within our cohort of patients with very early onset inflammatory bowel disease,4Charbit-Henrion F. et al.J Crohn’s Colitis. 2018; 12: 1104-1112Crossref PubMed Scopus (0) Google Scholar a 3-year-old girl (P1) born from healthy non-consanguineous parents presented with severe chronic secretory diarrhea and eczema since the age of 3 months. Immunological work-up was normal except for high titers of serum anti-AIE75 antibody. Duodenal biopsies showed severe villous atrophy with massive lymphocyte infiltration. Diarrhea improved on parenteral nutrition and treatment with steroids, azathioprine, and tacrolimus, but clinical and histological remission was observed only after switching to sirolimus (Figure 1A). Targeted sequencing excluded a molecular defect in FOXP3, CTLA4, LRBA, STAT3, and CD25, known causes of autoimmune enteropathy.4Charbit-Henrion F. et al.J Crohn’s Colitis. 2018; 12: 1104-1112Crossref PubMed Scopus (0) Google Scholar Whole exome sequencing was performed on parents-proband-trio’s DNA and identified a de novo and rare heterozygous missense variant in exon 6 of the PTPN2 gene (NM_002828.3 c.646T>G, chr18:12,785,478-12,929,643) replacing a cysteine residue with a glycine in position 216 (Supplementary Table 1). Sanger sequencing confirmed familial segregation (Figure 1B–D). Overexpression of C216G-PTPN2 and of the wild-type (WT) allele in HEK293T cells yielded comparable amount of protein (Figure 1E). Expression of endogenous PTPN2 protein was also comparable in patient and control-derived Epstein-Barr virus–transformed B-cell lines (B-EBV) (Figure 1F), indicating that the c.646T>G mutation does not impact PTPN2 expression. The variant was indicated to be damaging by all prediction tools (Combined Annotation Dependent Depletion score: 25.2) (Supplementary Table 1). Cys216 is strongly conserved across species and part of the “PTP signature motif” (HC[X5]R) (Figure 1G), which forms the phosphate-binding loop in the core of the catalytic site in all members of the PTP family.5Tonks N.K. Nat Rev Mol Cell Biol. 2006; 7: 833-846Crossref PubMed Scopus (1253) Google Scholar Cys216 initiates catalysis, via its thiolate group, by mounting nucleophilic attack of phosphate substrates (Figure 1H). Replacement of cysteine with glycine should impair catalysis, as glycine lacks the polar side chain to interact with phospho-tyrosyl residues. WT and mutant C-terminally tagged PTPN2 were transiently expressed in HEK293T cells, immunoprecipitated, and de-phosphorylation of STAT1 peptides, which are putative substrates of PTPN2,2Simoncic P.D. et al.Curr Biol. 2002; 12: 446-453Abstract Full Text Full Text PDF PubMed Scopus (247) Google Scholar was measured. Compared with WT-PTPN2, the mutant enzyme was, as anticipated, totally deprived of catalytic activity (Figure 1I). Lentiviral constructs encoding WT- or C216G-PTPN2 were next used to transduce HEK293T cells stably expressing a luciferase reporter gene under the control of STAT3 transcriptional response elements (TRE). Following interleukin (IL)-6 stimulation, overexpression of WT-PTPN2 led to significant downregulation of STAT3-TRE activity over control, whereas the mutant form of PTPN2 failed to do so (Figure 1J). Mixes of recombinant WT and C216G-PTPN2 displayed in vitro phosphatase activity proportional to the amount of WT PTPN2 (Figure 1K) and co-transfection of C216G-PTPN2 and WT-PTPN2 repressed STAT3 transcriptional activity in IL-6–stimulated HEK293T-STAT3-TRE cells similarly as transfection by WT-PTPN2 alone (Figure 1L), overall indicating that C216G-PTPN2 does not exert a dominant negative effect. We next compared the impact of PTPN2 deficiency on either T-cell receptor (TCR) activation or JAK-STAT signaling. Although TCR ligation with anti-CD3 antibody induced comparable Ca2+ mobilization, same global pattern of tyrosine phosphorylation and comparable ERK1/2 and LCK phosphorylation in control and patient T-cell blasts, phosphorylation of STAT3 in response to IL-15 was increased in patient T-cell blasts (Supplementary Figure 1A–C). Similarly, WT and PTPN2-depleted Jurkat cells displayed comparable ERK1/2 and LCK phosphorylation after TCR activation but increased phosphorylation of STAT1 in response to interferon-gamma (Supplementary Figure 1D and E). Hyperactivation of JAK-STAT pathway was confirmed in the patient’s EBV-B cells. IL-21–induced phosphorylation of STAT3 was increased and prolonged in the patient’s EBV-B cells compared with 2 controls (Figure 1M). Furthermore, phosphorylation of STAT5 and STAT1, which were not triggered by IL-21 in control EBV-B cells, was observed in the patient’s cells, pointing to alternative reprogramming of JAK-STAT signaling. Prominent STAT3 phosphorylation was also detected in intestinal lamina propria at time of disease activity (Supplementary Figure 1F). Importantly, Food and Drug Administration–approved JAK inhibitor, ruxolitinib, inhibited STAT phosphorylation in patient-derived B-EBV cells as efficiently as in cells derived from STAT3 gain-of-function (GOF) patient (Figure 1N). Here, we identify PTPN2 haploinsufficiency as a monogenic cause of intestinal autoimmunity. In line with the lack of therapeutic efficacy of tacrolimus, a calcineurin inhibitor that blocks Ca2+-dependent signaling downstream of TCR, the defect did not affect TCR signaling. In contrast, impaired negative regulation of JAK-STAT signaling was observed in the patient’s lymphocytes. Severe autoimmune enteropathy or enterocolitis is also a hallmark of STAT3 GOF mutations,6Fabre A. et al.J Allergy Clin Immunol Pract. 2019; 7: 1958-1969Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar,7Parlato M. Charbit-Henrion F. et al.Gastroenterology. 2019; 156: 1206-1210Abstract Full Text Full Text PDF PubMed Scopus (11) Google Scholar overall highlighting the crucial need of tightly regulating JAK-STAT activation to restrict intestinal inflammation. The very recent identification of monoallelic loss-of-function PTPN2 mutation in a young man presenting with common variable immunodeficiency and arthritis and in his mother presenting with lupus, type I diabetes, thyroiditis, and cytopenia8Thaventhiran J.E.D. et al.Nature. 2020; 583: 90-95Crossref PubMed Scopus (78) Google Scholar supports the disease-causing role of PTPN2 haploinsufficiency and illustrates the known pleiotropy of mutations enhancing JAK-STAT signaling.6Fabre A. et al.J Allergy Clin Immunol Pract. 2019; 7: 1958-1969Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar We have previously shown that durable remission can be achieved by ruxolitinib in severe enterocolitis associated with STAT3 GOF mutation.7Parlato M. Charbit-Henrion F. et al.Gastroenterology. 2019; 156: 1206-1210Abstract Full Text Full Text PDF PubMed Scopus (11) Google Scholar Herein, the pharmacological rescue of JAK-STAT hyperactivation in patient’s cells by ruxolitinib suggests that JAK inhibitors may be used to treat PTPN2 deficiency and more generally inflammatory disorders associated with excessive JAK-STAT signaling. Members of the Immunobiota Study Group are as follows: Bernadette Bègue (Université de Paris, Imagine Institute, Laboratory of Intestinal Immunity, Inserm, UMR1163, Paris, France), Jeremy Berthelet (Université de Paris, Unité de Biologie Fonctionnelle et Adaptative, CNRS UMR 8251, Paris, France), Kaan Boztug (St. Anna Children’s Cancer Research Institute (CCRI), Ludwig Boltzmann Institute for Rare and Undiagnosed Diseases, CeMM Research Center for Molecular Medicine, Austrian Academy of Sciences, Department of Pediatrics and Adolescent Medicine, Medical University of Vienna, St. Anna Children’s Hospital, Department of Pediatrics and Adolescent Medicine, Medical University of Vienna, Vienna, Austria), Rémi Duclaux-Loras (Université de Paris, Imagine Institute, Laboratory of Intestinal Immunity, Inserm, UMR1163, Assistance Publique-Hôpitaux de Paris, Hôpital Necker-Enfants Malades, Service de Gastroentérologie pédiatrique, Paris, France), Sylvain Latour (Université de Paris, Imagine Institute, Laboratory of Lymphocyte Activation and Susceptibility to EBV infection, Inserm, UMR1163, Paris, France), Marco Maggioni (Fondazione IRCCS Ca’ Granda-Ospedale Maggiore Policlinico, University of Milan, Milan, Italy), Emmanuel Martin (Université de Paris, Imagine Institute, Laboratory of Lymphocyte Activation and Susceptibility to EBV infection, Inserm, UMR1163, Paris, France), Thierry-Jo Molina (Pathology Department, Necker-Enfants Malades University Hospital, AP-HP, Paris, France), Julia Pazmandi (St. Anna Children’s Cancer Research Institute, Ludwig Boltzmann Institute for Rare and Undiagnosed Diseases, CeMM Research Center for Molecular Medicine, Austrian Academy of Sciences, Vienna, Austria), and Frederic Rieux-Laucat ((Université de Paris, Imagine Institute, Laboratory of Immunogenetics of Paediatric Autoimmunity, Inserm, UMR1163, Paris, France). We thank the patients and their families. We thank the technical platform “Bioprofiler UFLC” from the BFA Unit for provision of UFLC facilities, Prof Emanuele Bosi for anti-AIE75 serum measurement, and Dr Jules Gilet for his careful and critical reading of our paper. Marianna Parlato, PhD (Conceptualization: Lead; Data curation: Lead; Formal analysis: Lead; Methodology: Lead; Supervision: Supporting; Writing – original draft: Lead; Writing – review & editing: Lead). Qing Nian, PhD (Data curation: Equal; Methodology: equal; Formal analysis: Equal). Fabienne Charbit-Henrion, MD, PhD (patient care coordination and clinical samples acquisition.: Lead). Frank Ruemmele, MD, PhD (patient care coordination and clinical samples acquisition.: Supporting). Fernando Rodrigues-Lima, PhD (Supervision: Equal; Writing – original draft: Equal). Nadine Cerf-Bensussan, MD, PhD (Conceptualization: Equal; Supervision: Lead; Writing – original draft: Equal; Writing – review & editing: Lead). The patient was included within the Immunobiota protocol.1Charbit-Henrion F. et al.J Crohn’s Colitis. 2018; 12: 1104-1112Crossref PubMed Scopus (46) Google Scholar Recruitment of patients was based on severe chronic diarrhea developed before 6 years of age and refractory to medical treatment as previously described.1Charbit-Henrion F. et al.J Crohn’s Colitis. 2018; 12: 1104-1112Crossref PubMed Scopus (46) Google Scholar Informed consent for functional and genetic studies was obtained from a parent or a legal guardian in accordance with the Declaration of Helsinki under institutional review board–approved protocol (CPP Ile-de-France II). Patient duodenal biopsies were obtained at 6, 12, and at 27 months. Control duodenal biopsies were obtained from a 4-year-old boy who underwent endoscopy for unconfirmed suspicion of eosinophilic gastroenteritis and from a previously described patient with STAT3 GOF mutation.2Parlato M. Charbit-Henrion F. et al.Gastroenterology. 2019; 156: 1206-1210Abstract Full Text Full Text PDF PubMed Scopus (20) Google Scholar Biopsies were fixed in 4% buffered formalin for 24 hours, paraffin-embedded, and stained with hematoxylin & eosin. CD3 (polyclonal; Dako, Glostrup, Denmark), CD4 (L26 clone; Dako), CD8 (C8/144B clone; Dako) immunophenotyping was performed on a Dako Omnis automated immunostainer. P-STAT3 (3E2; Cell Signaling, Danvers, MA) antibody was used according manufacturer’s instructions. Whole-exome and targeted panel sequencing were performed as previously described.1Charbit-Henrion F. et al.J Crohn’s Colitis. 2018; 12: 1104-1112Crossref PubMed Scopus (46) Google Scholar For Sanger sequencing, primer sequences and polymerase chain reaction amplification conditions are available on request. Candidate variants were ranked by filtering out common polymorphisms with Minor Allele Frequency (MAF) >1%. Potential causality of each protein-coding variant with MAF <1% was assessed using the Genome Aggregation Database (gnomAD) and the Institut Imagine database of 13,465 exomes from families affected with genetic diseases. OMIM, evolutionary conservation, and prediction tools (SIFT, PolyPhen2.2.2, Mutation Taster, combined annotation-dependent depletion [CADD]), together with mutation significance cutoff (MSC), a gene-level specific cutoff for CADD scores.3Itan Y. et al.Nat Methods. 2016; 13: 109-110Crossref PubMed Scopus (184) Google Scholar,4Zhang P. et al.Bioinformatics. 2018; 34: 4307-4309Crossref PubMed Scopus (33) Google Scholar The pCMV6 vector containing the full complementary DNA sequence of hPTPN2 (NM_080422) (Origene, Rockville, MD) was used to introduce the variant with the GENEART Site-Directed Mutagenesis System (Invitrogen, Carlsbad, CA). The mutation was confirmed by Sanger sequencing. WT and mutant constructs were subcloned into the pLVX-EF1α-IRES-mCherry Vector (Clontech, Mountain View, CA). Supernatant containing lentivirus particles was generated from Lenti-X™293T cells co-transfected with transfer plasmid, packaging pMD2.G (12259; Addgene, Cambridge, MA) and VSV-G envelope expressing psPAX2 (12260; Addgene) plasmids using Lipofectamine 2000 (Invitrogen). The virus-containing medium was 0.45-μm-filtered and used to transduce cells in the presence of polybrene (4 μg/mL). mCherry-positive cells were sorted by fluorescence-activated cell sorting (FACS) 5 days post-transduction. Lenti-X™293T cells were transfected with FLAG-WT-PTPN2, FLAG-C216G-PTPN2 or empty vector (EV) (Origene). Twenty-four hours post-transfection, cells were washed with phospate-buffered saline (PBS) and resuspended in lysis buffer (PBS, 0.5% Triton X-100, protease inhibitors cocktail). The lysate was cleared by centrifugation (15,000g for 10 minutes at 4°C) and total protein concentration measured with Bradford reagent. For PTPN2 immunoprecipitation, 1 mg of whole-cell extracts (200 μL) were incubated overnight with 1 μg of an anti-flag mouse monoclonal antibody (Origene) at 4 °C. PTPN2 catalytic activity assay toward FAM-pStat1 peptide in immunoprecipitate was performed as previously described.5Duval R. et al.Sci Rep. 2015; 5: 10750Crossref PubMed Scopus (6) Google Scholar For testing dominant negative activity, untagged recombinant WT and C216G PTPN2 were produced in Escherichia coli as described5Duval R. et al.Sci Rep. 2015; 5: 10750Crossref PubMed Scopus (6) Google Scholar,6Iversen L.F. et al.J Biol Chem. 2002; 277: 19982-19990Abstract Full Text Full Text PDF PubMed Scopus (148) Google Scholar and mixed at different ratios to reach a total concentration of 50 nM in 100 mM sodium acetate, pH6 buffer containing 10 mM p-nitrophenyl phosphate. The dephosphorylated product was measured by absorbance at 405 nm at 37°C using a thermostated microplate reader (BioTek, Saint-Jean-de-Védas, France). ClustalW27Goujon M. et al.Nucleic Acids Res. 2010; 38: W695-W699Crossref PubMed Scopus (1302) Google Scholar was used to align protein sequences obtained from the National Center for Biotechnology Information with the following RefSeq accession numbers: NP_536347.1, NP_446442.1, NP_001120649.1, NP_997819.1, NP_001030508.1, AFH27310.1, NP_001086910.1. The C216G-PTPN2 mutation was created and analyzed using Swiss-PdbViewer8Schwede T. Nucleic Acids Res. 2003; 31: 3381-3385Crossref PubMed Scopus (4480) Google Scholar with human PTPN2 structure as template (PDB entry: 1L8K). Structures were rendered using Chimera.9Pettersen E.F. et al.J Comput Chem. 2004; 25: 1605-1612Crossref PubMed Scopus (27933) Google Scholar Lenti-X™293T cells (Clontech) were cultured in Dulbecco’s modified Eagle’s Medium–Glutamax supplemented with 10% fetal calf serum (FCS) and penicillin-streptomycin (100 U/mL each; Invitrogen). Expansion of T-cell blasts from peripheral blood mononuclear cells (PBMCs) was obtained by 3-day incubation with 1 μg/mL phytohemagglutinin (PHA) (Sigma-Aldrich, St Louis, MO) in RPMI 1640 Glutamax supplemented with 1% nonessential amino acids, 1% sodium pyruvate, 1% Hepes (Invitrogen), and 10% inactivated human serum AB (PAA). PHA-stimulated PBMCs were next cultured with 50U/mL IL-2 (R&D Systems, Minneapolis, MN) for 2 to 3 weeks. Epstein-Barr–transformed B-cell lines were generated from frozen PBMCs of the patient, controls and from T716M STAT3 GOF patient, as previously described.2Simoncic P.D. et al.Curr Biol. 2002; 12: 446-453Abstract Full Text Full Text PDF PubMed Scopus (247) Google Scholar Jurkat cells were cultured in RPMI supplemented with 10% FCS, 20 mM Hepes, and penicillin-streptomycin. Lenti-X™293T cells expressing STAT3 transcriptional responsive element (STAT3-TRE) were transduced with lentiviral particles expressing WT or PTPN2 C216G or EV. Each cell line was plated at 1 × 105 cells/well (24-well plate), stimulated with 5 ng/mL or 50 ng/mL IL-6 and, after 48 hours, luciferase was assayed with the Dual-Luciferase Reporter assay system (Promega, Madison, WI) following the manufacturer’s instructions. All experiments were performed in duplicate. For testing possible C216G dominant activity, STAT3-TRE-HEK293T cells were transfected with 50 ng of WT construct and/or mutant C216G (1:1) with Lipofectamine 2000 (ThermoFisher, Waltham, MA). Twenty-four hours post-transfection, the cells were treated with 5 ng/mL IL-6 for 48 hours and luciferase was assayed with the Dual-Luciferase Reporter assay system (Promega). All transfection experiments were performed in triplicate. The following antibodies were used for immunoblotting with standard procedures: anti-PTPN2 (F8) from SantaCruz Biotechnology (Dallas, TX), anti-STAT1 (9H2), anti-pSTAT1 (58D6), anti-STAT3 (124H6), anti-pSTAT3 (3E2), anti-GAPDH-HRP (14C10), anti-ptyrosine (Tyr-100), anti-pERK1/2 (4376S), anti-ERK 1/2 (4695S), and anti-Ku70 (4103S), all from Cell Signaling; anti-pLCK Y505 (755216) and anti-pLCK Y394 (755103) from Novus Biologicals (Littleton, CO). Single-guide RNAs (sgRNAs) were designed using the CRISPR Design Tool (Massachusetts Institute of Technology) and cloned into the BsmbI site of LentiCRISPRv2 plasmid (8290; Addgene). sgRNA sequences are available on request. Following production of lentiviral particles, the lentiCRISPRv2 plasmids were transduced in Jurkat cells. Positively transduced cells were selected by puromycin (1 μg/mL). Cells were loaded with 5 μM Indo-1 a.m. (ThermoFischer Scientific), washed, incubated with anti-CD4-APC and anti-CD8-FITC monoclonal antibodies (BD Biosciences, San Jose, CA), stimulated by anti-CD3 antibody (OKT3) crosslinked with F(ab′)2 rabbit anti-mouse immunoglobulin G (5 μg/mL; ThermoFischer Scientific), and then incubated with ionomycin (1 μM). Ca2+ flux kinetic was monitored using a FACSAria flow cytometer (BD Biosciences) and analyzed with FlowJo software (Tree Star, Ashland, OR). The ratio of Ca2+-bound to Ca2+-free Indo-1 fluorescence was plotted against time. Results were analyzed by 1-way analysis of variance using Prism (GraphPad Software, Inc., La Jolla, CA) and P values <0.05 were considered significant.Supplementary Table 1Autosomal Recessive (AR) and De Novo Variants Identified by Whole Exome SequencingARGeneVariantConsequenceSiftMutation tasterPolyphenCADD (MSC)DB freq, %SRRM2rs144257955Thr2513AlaToleratedPolymorphismBenign10 (3.13)0.299LY75rs116058499Arg763GlnToleratedDisease causingProbably damaging27 (3.13)0.217rs113023766Met1308ValToleratedPolymorphismBenign23.9 (3.13)0.137TDRD6rs139660386Lys1432ArgToleratedPolymorphismBenign0 (3.13)0.236rs144889394Ala491ValDeleteriousDisease causingProbably damaging24.3 (3.13)0.020COL22A1rs766709365Asp156GluDeleteriousDisease causingProbably damaging14.7 (3.13)0.005rs770249679Arg407HisDeleteriousDisease causingProbably damaging23.7 (3.13)0.001FOXD4L69_69200873_G_APro247LToleratedNot scoredBenign8.3 (9.118)0.265rs2989709Pro416ArgToleratedNot scoredBenign0 (9.118)0.210DOCK6rs778570965Asp1804AlaDeleteriousDisease causingBenign25.1 (26.3)0.001rs183060698Val45IleToleratedDisease causingBenign19.8 (26.3)0.180de novoGeneVariantConsequenceSiftMutation tasterPolyphenCADDNBPF1aThe variant was considered unlikely causative as in our inhouse database was found in at least 15 individuals.rs753338419Asn497IleDeleteriousnot scoredProbably damaging22.7 (3.13)0.011NESaThe variant was considered unlikely causative as in our inhouse database was found in at least 15 individuals.1_156640666_A_CVal1105GlyDeleteriousnot scoredBenign11.5 (3.13)0.065HRCT1aThe variant was considered unlikely causative as in our inhouse database was found in at least 15 individuals.9_35906602_C_CCACCAframeshiftnot scorednot scorednot scored0 (3.13)not foundDNASE1LaThe variant was considered unlikely causative as in our inhouse database was found in at least 15 individuals.16_2287508_G_CArg150ProToleratednot scoredBenign0.1 (16.330)0.099CSH1rs1130686Pro3ThrToleratedPolymorphismnot scored0not foundPTPN218_12817214_A_CCys216GlyDeleteriousdisease causingProbably damaging25.2 (3.13)not foundFUT3aThe variant was considered unlikely causative as in our inhouse database was found in at least 15 individuals.19_5844663_A_GLeu63ProToleratednot scoredBenign15.1 (3.13)0.099ALPPL2aThe variant was considered unlikely causative as in our inhouse database was found in at least 15 individuals.rs139018608Pro22GlnDeleteriousDisease causingProbably damaging22.5 (3.13)0.779USP36aThe variant was considered unlikely causative as in our inhouse database was found in at least 15 individuals.rs143011665Arg1006CysToleratedPolymorphismBenign12 (3.13)0.270SKA3aThe variant was considered unlikely causative as in our inhouse database was found in at least 15 individuals.13_21729290_T_TCAGTTTTCTTTGTTGCTGACATCTCGGATGTTCTGTCCATGTTTAAGGAACCTTTTAins/ splice acceptor donorNot scoredNot scoredNot scored0 (3.13)0.043CADD, Combined Annotation Dependent Depletion; DB, Public databases (dbSnp, 1000 genomes, Evs, Exac, and gnomAD); MSC, mutation significance cutoff.a The variant was considered unlikely causative as in our inhouse database was found in at least 15 individuals. Open table in a new tab CADD, Combined Annotation Dependent Depletion; DB, Public databases (dbSnp, 1000 genomes, Evs, Exac, and gnomAD); MSC, mutation significance cutoff." @default.
• W3044591597 created "2020-07-29" @default.
• W3044591597 creator A5005685737 @default.
• W3044591597 creator A5007717863 @default.
• W3044591597 creator A5010756691 @default.
• W3044591597 creator A5014315145 @default.
• W3044591597 creator A5026913801 @default.
• W3044591597 creator A5030545339 @default.
• W3044591597 creator A5044105377 @default.
• W3044591597 creator A5045588634 @default.
• W3044591597 creator A5048616194 @default.
• W3044591597 creator A5050963640 @default.
• W3044591597 creator A5069613706 @default.
• W3044591597 creator A5077191902 @default.
• W3044591597 creator A5080495909 @default.
• W3044591597 creator A5083186666 @default.
• W3044591597 creator A5086686471 @default.
• W3044591597 creator A5089973338 @default.
• W3044591597 date "2020-11-01" @default.
• W3044591597 modified "2023-10-16" @default.
• W3044591597 title "Loss-of-Function Mutation in PTPN2 Causes Aberrant Activation of JAK Signaling Via STAT and Very Early Onset Intestinal Inflammation" @default.
• W3044591597 cites W1969918683 @default.
• W3044591597 cites W1982603741 @default.
• W3044591597 cites W2026671374 @default.
• W3044591597 cites W2060809301 @default.
• W3044591597 cites W2132629607 @default.
• W3044591597 cites W2169150541 @default.
• W3044591597 cites W2253766407 @default.
• W3044591597 cites W2255312347 @default.
• W3044591597 cites W2803889212 @default.
• W3044591597 cites W2810443103 @default.
• W3044591597 cites W2898699548 @default.
• W3044591597 cites W2904586858 @default.
• W3044591597 cites W2909352392 @default.
• W3044591597 cites W2917492917 @default.
• W3044591597 cites W3018118540 @default.
• W3044591597 doi "https://doi.org/10.1053/j.gastro.2020.07.040" @default.
• W3044591597 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/32721438" @default.
• W3044591597 hasPublicationYear "2020" @default.
• W3044591597 type Work @default.
• W3044591597 sameAs 3044591597 @default.
• W3044591597 citedByCount "19" @default.
• W3044591597 countsByYear W30445915972020 @default.
• W3044591597 countsByYear W30445915972021 @default.
• W3044591597 countsByYear W30445915972022 @default.
• W3044591597 countsByYear W30445915972023 @default.
• W3044591597 crossrefType "journal-article" @default.
• W3044591597 hasAuthorship W3044591597A5005685737 @default.
• W3044591597 hasAuthorship W3044591597A5007717863 @default.
• W3044591597 hasAuthorship W3044591597A5010756691 @default.
• W3044591597 hasAuthorship W3044591597A5014315145 @default.
• W3044591597 hasAuthorship W3044591597A5026913801 @default.
• W3044591597 hasAuthorship W3044591597A5030545339 @default.
• W3044591597 hasAuthorship W3044591597A5044105377 @default.
• W3044591597 hasAuthorship W3044591597A5045588634 @default.
• W3044591597 hasAuthorship W3044591597A5048616194 @default.
• W3044591597 hasAuthorship W3044591597A5050963640 @default.
• W3044591597 hasAuthorship W3044591597A5069613706 @default.
• W3044591597 hasAuthorship W3044591597A5077191902 @default.
• W3044591597 hasAuthorship W3044591597A5080495909 @default.
• W3044591597 hasAuthorship W3044591597A5083186666 @default.
• W3044591597 hasAuthorship W3044591597A5086686471 @default.
• W3044591597 hasAuthorship W3044591597A5089973338 @default.
• W3044591597 hasBestOaLocation W30445915971 @default.
• W3044591597 hasConcept C104317684 @default.
• W3044591597 hasConcept C105951970 @default.
• W3044591597 hasConcept C127716648 @default.
• W3044591597 hasConcept C14036430 @default.
• W3044591597 hasConcept C157333092 @default.
• W3044591597 hasConcept C203014093 @default.
• W3044591597 hasConcept C2776914184 @default.
• W3044591597 hasConcept C2778277574 @default.
• W3044591597 hasConcept C2778923194 @default.
• W3044591597 hasConcept C42362537 @default.
• W3044591597 hasConcept C501734568 @default.
• W3044591597 hasConcept C502942594 @default.
• W3044591597 hasConcept C54355233 @default.
• W3044591597 hasConcept C62478195 @default.
• W3044591597 hasConcept C71924100 @default.
• W3044591597 hasConcept C86803240 @default.
• W3044591597 hasConcept C95444343 @default.
• W3044591597 hasConceptScore W3044591597C104317684 @default.
• W3044591597 hasConceptScore W3044591597C105951970 @default.
• W3044591597 hasConceptScore W3044591597C127716648 @default.
• W3044591597 hasConceptScore W3044591597C14036430 @default.
• W3044591597 hasConceptScore W3044591597C157333092 @default.
• W3044591597 hasConceptScore W3044591597C203014093 @default.
• W3044591597 hasConceptScore W3044591597C2776914184 @default.
• W3044591597 hasConceptScore W3044591597C2778277574 @default.
• W3044591597 hasConceptScore W3044591597C2778923194 @default.
• W3044591597 hasConceptScore W3044591597C42362537 @default.
• W3044591597 hasConceptScore W3044591597C501734568 @default.
• W3044591597 hasConceptScore W3044591597C502942594 @default.
• W3044591597 hasConceptScore W3044591597C54355233 @default.
• W3044591597 hasConceptScore W3044591597C62478195 @default.
• W3044591597 hasConceptScore W3044591597C71924100 @default.
• W3044591597 hasConceptScore W3044591597C86803240 @default.
• W3044591597 hasConceptScore W3044591597C95444343 @default.

• next