Matches in SemOpenAlex for { <https://semopenalex.org/work/W3123813239> ?p ?o ?g. }
Showing items 1 to 72 of
72
with 100 items per page.
- W3123813239 abstract "Figure S5 in the online publication of our article. The corrected Figure 1 is as the following. We are sorry for the error in Figure 1 and state that this does not change the scientific conclusions of the article in any way. In the original article, there was a mistake in Supplementary Table 2 as published. Supplementary Table 2 in the online publication of our article contains an additional worksheet which has nothing to do with the article. The worksheet is in hidden state in Supplementary Table 2, so it is not caught in time. The corrected Supplementary Table 2 is as the following. We are sorry for the error in Supplementary Table 2 and state that this does not change the scientific conclusions of the article in any way. Table S2. List of primers used in this study.Forward primer (5'-3') Reverse primer (5'-3')OsCKX2-en TTCGTCCGCCTCCTTCCT CGACGCGCGCAGCAGCGCActin GGAAGTACAGTGTCTGGATTGGAG TCTTGGCTTAGCATTCTTGGGT OsPSK4 GCCGTGCTGCTGATTTTC GTGATGCTGCTGGGTGTAGA OsPUP6 TCCCTGATGCAGCTCACGTT TCGCCCTTCTTGTACCCGTC LBD11-1 CCAGAACCAAGTCTCCCAGC TCCACATGGACTCTTTCTTGAGG OsPsbR2 GACCGAACCTGAAAGACGGT CCAGCCAGCAGAATTCCAGA OsMST1 TGACGTTCTCGGTGGTCATC TAGACGCAGTACTCGTTCCC OsPME22 ACTCGCTTCGCCAGTTCTAC CTGGGGTGTATCAGGCTGTC OsPGL21 AACTTGGCAGGGAGGTTCAG CATGCAAAATGGGCAGGCTT OsAP25 CCGAACTACACGTTCGGGTG AGCGAGCCGGAGAAGTAGTA OsSub31 GCTTACAGCGCCATGGAAAG CCGGAGTAGTTCTTGCCGTT OsBGal1AGGAACCATCCGTCAACGAC AGTCACAGTTGGATCGGCAG" @default.
- W3123813239 created "2021-02-01" @default.
- W3123813239 creator A5001220614 @default.
- W3123813239 creator A5008997366 @default.
- W3123813239 creator A5020769112 @default.
- W3123813239 creator A5045506053 @default.
- W3123813239 creator A5052624285 @default.
- W3123813239 creator A5069516796 @default.
- W3123813239 date "2021-01-19" @default.
- W3123813239 modified "2023-10-02" @default.
- W3123813239 title "Corrigendum: Phenotypic, Transcriptomic, and Metabolomic Signatures of Root-Specifically Overexpressed OsCKX2 in Rice" @default.
- W3123813239 doi "https://doi.org/10.3389/fpls.2020.641990" @default.
- W3123813239 hasPubMedCentralId "https://www.ncbi.nlm.nih.gov/pmc/articles/7851706" @default.
- W3123813239 hasPubMedId "https://pubmed.ncbi.nlm.nih.gov/33542727" @default.
- W3123813239 hasPublicationYear "2021" @default.
- W3123813239 type Work @default.
- W3123813239 sameAs 3123813239 @default.
- W3123813239 citedByCount "1" @default.
- W3123813239 countsByYear W31238132392023 @default.
- W3123813239 crossrefType "journal-article" @default.
- W3123813239 hasAuthorship W3123813239A5001220614 @default.
- W3123813239 hasAuthorship W3123813239A5008997366 @default.
- W3123813239 hasAuthorship W3123813239A5020769112 @default.
- W3123813239 hasAuthorship W3123813239A5045506053 @default.
- W3123813239 hasAuthorship W3123813239A5052624285 @default.
- W3123813239 hasAuthorship W3123813239A5069516796 @default.
- W3123813239 hasBestOaLocation W31238132391 @default.
- W3123813239 hasConcept C124101348 @default.
- W3123813239 hasConcept C145420912 @default.
- W3123813239 hasConcept C176734034 @default.
- W3123813239 hasConcept C17744445 @default.
- W3123813239 hasConcept C178790620 @default.
- W3123813239 hasConcept C185592680 @default.
- W3123813239 hasConcept C199539241 @default.
- W3123813239 hasConcept C23123220 @default.
- W3123813239 hasConcept C2777179996 @default.
- W3123813239 hasConcept C2777563447 @default.
- W3123813239 hasConcept C33923547 @default.
- W3123813239 hasConcept C41008148 @default.
- W3123813239 hasConcept C45235069 @default.
- W3123813239 hasConceptScore W3123813239C124101348 @default.
- W3123813239 hasConceptScore W3123813239C145420912 @default.
- W3123813239 hasConceptScore W3123813239C176734034 @default.
- W3123813239 hasConceptScore W3123813239C17744445 @default.
- W3123813239 hasConceptScore W3123813239C178790620 @default.
- W3123813239 hasConceptScore W3123813239C185592680 @default.
- W3123813239 hasConceptScore W3123813239C199539241 @default.
- W3123813239 hasConceptScore W3123813239C23123220 @default.
- W3123813239 hasConceptScore W3123813239C2777179996 @default.
- W3123813239 hasConceptScore W3123813239C2777563447 @default.
- W3123813239 hasConceptScore W3123813239C33923547 @default.
- W3123813239 hasConceptScore W3123813239C41008148 @default.
- W3123813239 hasConceptScore W3123813239C45235069 @default.
- W3123813239 hasLocation W31238132391 @default.
- W3123813239 hasLocation W31238132392 @default.
- W3123813239 hasOpenAccess W3123813239 @default.
- W3123813239 hasPrimaryLocation W31238132391 @default.
- W3123813239 hasRelatedWork W1275028 @default.
- W3123813239 hasRelatedWork W19118645 @default.
- W3123813239 hasRelatedWork W21532190 @default.
- W3123813239 hasRelatedWork W31859097 @default.
- W3123813239 hasRelatedWork W35706479 @default.
- W3123813239 hasRelatedWork W35800290 @default.
- W3123813239 hasRelatedWork W37139368 @default.
- W3123813239 hasRelatedWork W41630896 @default.
- W3123813239 hasRelatedWork W5940357 @default.
- W3123813239 hasRelatedWork W7007256 @default.
- W3123813239 hasVolume "11" @default.
- W3123813239 isParatext "false" @default.
- W3123813239 isRetracted "false" @default.
- W3123813239 magId "3123813239" @default.
- W3123813239 workType "article" @default.