FRINK Linked Data Fragments server

Matches in SemOpenAlex for { <https://semopenalex.org/work/W3137306095> ?p ?o ?g. }

• W3137306095 endingPage "100553" @default.
• W3137306095 startingPage "100553" @default.
• W3137306095 abstract "The determination of the double helical structure of DNA in 1953 remains the landmark event in the development of modern biological and biomedical science. This structure has also been the starting point for the determination of some 2000 DNA crystal structures in the subsequent 68 years. Their structural diversity has extended to the demonstration of sequence-dependent local structure in duplex DNA, to DNA bending in short and long sequences and in the DNA wound round the nucleosome, and to left-handed duplex DNAs. Beyond the double helix itself, in circumstances where DNA sequences are or can be induced to unwind from being duplex, a wide variety of topologies and forms can exist. Quadruplex structures, based on four-stranded cores of stacked G-quartets, are prevalent though not randomly distributed in the human and other genomes and can play roles in transcription, translation, and replication. Yet more complex folds can result in DNAs with extended tertiary structures and enzymatic/catalytic activity. The Protein Data Bank is the depository of all these structures, and the resource where structures can be critically examined and validated, as well as compared one with another to facilitate analysis of conformational and base morphology features. This review will briefly survey the major structural classes of DNAs and illustrate their significance, together with some examples of how the use of the Protein Data Bank by for example, data mining, has illuminated DNA structural concepts. The determination of the double helical structure of DNA in 1953 remains the landmark event in the development of modern biological and biomedical science. This structure has also been the starting point for the determination of some 2000 DNA crystal structures in the subsequent 68 years. Their structural diversity has extended to the demonstration of sequence-dependent local structure in duplex DNA, to DNA bending in short and long sequences and in the DNA wound round the nucleosome, and to left-handed duplex DNAs. Beyond the double helix itself, in circumstances where DNA sequences are or can be induced to unwind from being duplex, a wide variety of topologies and forms can exist. Quadruplex structures, based on four-stranded cores of stacked G-quartets, are prevalent though not randomly distributed in the human and other genomes and can play roles in transcription, translation, and replication. Yet more complex folds can result in DNAs with extended tertiary structures and enzymatic/catalytic activity. The Protein Data Bank is the depository of all these structures, and the resource where structures can be critically examined and validated, as well as compared one with another to facilitate analysis of conformational and base morphology features. This review will briefly survey the major structural classes of DNAs and illustrate their significance, together with some examples of how the use of the Protein Data Bank by for example, data mining, has illuminated DNA structural concepts. A well-known protein crystallographer told me, almost exactly 50 years ago, that “DNA structure is monotonous and boring.” This assertion can be taken to mean that (i) the double helix appears to be invariant along the length of the genome, so that DNA structure is fully represented by the Watson–Crick model and thus would not be of any future interest, and consequently, (ii) the future study of DNA structure is an inherently uninteresting topic. The subsequent history of the subject has comprehensively disproved both these statements—it has also turned out that DNA structural studies continue to have a flourishing existence well beyond the double helix, with distinctive and hitherto unimagined novel structural types being discovered and having major biological significance. Highlights of these varieties of structures will be discussed in this brief review. A more comprehensive and detailed account of DNA structures can be found elsewhere (1Neidle S. Principles of Nucleic Acid Structure. Academic Press, London2008Google Scholar). It is inconceivable that any structural studies on DNAs over the past 50 years would have taken place without the involvement of the Protein Data Bank (PDB) at some point. All crystal and NMR structures are deposited in the PDB and released for open access, normally either before to or immediately after publication. For any new structure, comparative studies with existing structures are an essential part of any meaningful analysis, and the PDB has long provided the data and tools for these to be undertaken. For DNA structural studies, the PDB is, though, much more than a passive depository of structures to be uploaded or downloaded as needed. This article aims to highlight some of the major steps in our knowledge of DNA structure because the advent of the double helix concept and how the PDB has, in various ways, played a key role in actively facilitated these advances. This role, and that of the associated Nucleic Acid Database (NDB), is discussed in more detail at the end of this review. Readers are encouraged to browse through some of the structures highlighted here. To this end, Table 1 details some representative DNA crystal structures and includes their unique PDB ID numbers and hyperlinks to the PDB.Table 1Selected DNA crystal structures highlighted in this reviewSequenceStructure typePDB IDResolution, ÅRefd(CGCGAATTCGCG)B-DNA double helix1BNA1.9(15Wing R.M. Drew H.R. Takano T. Broka C. Tanaka S. Itakura K. Dickerson R.E. Crystal structure analysis of a complete turn of B-DNA.Nature. 1980; 287: 755-758Crossref PubMed Scopus (709) Google Scholar)d(CGCGAATTCGCG)B-DNA double helix436D1.1(17Tereshko V. Minasov G. Egli M. The Dickerson-Drew B-DNA dodecamer revisited at atomic resolution.J. Am. Chem. Soc. 1999; 121: 470-471Crossref Scopus (162) Google Scholar)d(CGCGAATTCGCG)B-DNA double helix4C641.32(18Lercher L. McDonough M.A. El-Sagheer A.H. Thalhammer A. Kriaucionis S. Brown T. Schofield C.J. Structural insights into how 5-hydroxymethylation influences transcription factor binding.Chem. Commun. (Camb.). 2014; 50: 1794-1796Crossref PubMed Google Scholar)d(CGAATTAATTCG)B-DNA double helix5M682.64(22Acosta-Reyes F.J. Pagan M. Fonfría-Subirós E. Saperas N. Subirana J.A. Campos J.L. The influence of Ni(2+) and other ions on the trigonal structure of DNA.Biopolymers. 2020; 8e23397Google Scholar)d(ACCGAATTCGGT)Bent B-helix A-tract1ILC2.2(33Hizver J. Rozenberg H. Frolow F. Rabinovich D. Shakked Z. DNA bending by an adenine--thymine tract and its role in gene regulation.Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 8491-8495Crossref Scopus (118) Google Scholar)d(CGCGAATTGGCG)B-DNA + G:G mismatches1D802.2(36Skelly J.V. Edwards K.J. Jenkins T.C. Neidle S. Crystal structure of an oligonucleotide duplex containing G.G base pairs: Influence of mispairing on DNA backbone conformation.Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 804-808Crossref PubMed Scopus (96) Google Scholar)d(CTACGCGCGTAG)A-DNA double helix5MVK1.5(38Hardwick J.S. Ptchelkine D. El-Sagheer A.H. Tear I. Singleton D. Phillips S.E.V. Lane A.N. Brown T. 5-Formylcytosine does not change the global structure of DNA.Nat. Struct. Mol. Biol. 2017; 24: 544-552Crossref PubMed Scopus (31) Google Scholar)d(CCGGGCCCGG)Holliday junction1ZF21.95(43Hays F.A. Teegarden A. Jones Z.J. Harms M. Raup D. Watson J. Cavaliere E. Ho P.S. How sequence defines structure: A crystallographic map of DNA structure and conformation.Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 7157-7162Crossref PubMed Scopus (105) Google Scholar)d(CGCGCGCGCGCG)Z-DNA double helix4OCB0.75(48Luo Z. Dauter M. Dauter Z. Phosphates in the Z-DNA dodecamer are flexible, but their P-SAD signal is sufficient for structure solution.Acta Crystallogr. 2014; D70: 1790-8000Google Scholar)d(GGGTTAGBrGGTTAGGGTTAGBrGG)Antiparallel chair telomeric quadruplex6JKN1.40(65Geng Y. Liu C. Zhou B. Cai Q. Miao H. Shi X. Xu N. You Y. Fung C.P. Din R.U. Zhu G. The crystal structure of an antiparallel chair-type G-quadruplex formed by bromo-substituted human telomeric DNA.Nucleic Acids Res. 2019; 47: 5395-5404Crossref PubMed Scopus (16) Google Scholar)d(GGGCGGGGAGGGGGAAGGGA)BRAF quadruplex4H291.99(77Wei D. Todd A.K. Zloh M. Gunaratnam M. Parkinson G.N. Neidle S. Crystal structure of a promoter sequence in the B-Raf gene reveals an intertwined dimer quadruplex.J. Am. Chem. Soc. 2013; 135: 19319-19329Crossref PubMed Scopus (49) Google Scholar)d(AGGGAGGGCGCTGGGAGGAGGG)c-KIT quadruplex4WO21.82(76Wei D. Parkinson G.N. Reszka A.P. Neidle S. Crystal structure of a c-kit promoter quadruplex reveals the structural role of metal ions and water molecules in maintaining loop conformation.Nucleic Acids Res. 2012; 40: 4691-4700Crossref PubMed Scopus (108) Google Scholar)d(TGAGGGTGGGTAGGGTGGGTAA)c-MYC quadruplex6AU42.35(78Stump S. Mou T.C. Sprang S.R. Natale N.R. Beall H.D. Crystal structure of the major quadruplex formed in the promoter region of the human c-MYC oncogene.PLoS One. 2018; 13e0205584Crossref PubMed Scopus (24) Google Scholar)d(AGGGCGGTGTGGGAATAGGGAA)KRAS quadruplex6N651.6(79Ou A. Schmidberger J.W. Wilson K.A. Evans C.W. Hargreaves J.A. Grigg M. O’Mara M.L. Iyer K.S. Bond C.S. Smith N.M. High resolution crystal structure of a KRAS promoter G-quadruplex reveals a dimer with extensive poly-A π-stacking interactions for small-molecule recognition.Nucleic Acids Res. 2020; 48: 5766-5776Crossref PubMed Google Scholar)d(TGGTGGTGGTGGTTGTGGTGGTGGTGTT)Left-handed quadruplex4U5M1.5(81Chung W.J. Heddi B. Schmitt E. Lim K.W. Mechulam Y. Phan A.T. Structure of a left-handed DNA G-quadruplex.Proc. Natl. Acad. Sci. U. S. A. 2015; 112: 2729-2733Crossref PubMed Scopus (85) Google Scholar)d(ATCCGATGGATCATACGGTCGGAGGGGTTTGCCGTTTAAGTGCC)Deoxy-ribozyme5CKK2.8(91Ponce-Salvatierra A. Wawrzyniak-Turek K. Steuerwald U. Höbartner C. Pena V. Crystal structure of a DNA catalyst.Nature. 2016; 529: 231-234Crossref PubMed Scopus (89) Google Scholar)23 x d(TTAGGG)Human telomeric nucleosome6KE92.22(105Soman A. Liew C.W. Teo H.L. Berezhnoy N.V. Olieric V. Korolev N. Rhodes D. Nordenskiold L. The human telomeric nucleosome displays distinct structural and dynamic properties.Nucleic Acids Res. 2020; 48: 5383-5396Crossref PubMed Google Scholar)PDB, Protein Data Bank. Open table in a new tab PDB, Protein Data Bank. This review focusses on crystal rather than NMR structures, in part in view of the ability of high-resolution crystallography to visualize the essential role of water in maintaining DNA structural integrity, as well as acknowledging the central role played by crystal structures in the historic development of our understanding of DNA structure. Structural analysis of DNA-small molecule complexes is a subject in its own right and is not covered here; as with native DNAs, the PDB continues to play a critical role in the dissemination and analysis of these structures. The determination of the structure of the genetic material, double-helical DNA, by Watson, Crick, Franklin, and Wilkins in 1953 (2Watson J.D. Crick F.H. Molecular structure of nucleic acids; a structure for deoxyribose nucleic acid.Nature. 1953; 171: 737-738Crossref PubMed Scopus (8085) Google Scholar, 3Wilkins M.H. Stokes A.R. Wilson H.R. Molecular structure of deoxypentose nucleic acids.Nature. 1953; 171: 738-740Crossref PubMed Scopus (415) Google Scholar, 4Franklin R.E. Gosling R.G. Molecular configuration in sodium thymonucleate.Nature. 1953; 171: 740-741Crossref PubMed Scopus (687) Google Scholar) is by common consent the key landmark in the development of modern biological and biomedical sciences. This was also the first macromolecular biological structure to be determined at an “atomic” level. It is worth reminding ourselves, almost 7 decades on from that momentous work, exactly what this structure determination does (and does not) tell us about DNA. It used the methodology of X-ray fiber diffraction, which relies on aligned and semicrystalline arrangements of polymeric DNA molecules to produce diffraction patterns that represent the average of all sequences in that DNA. The structure was determined, not by ab initio crystallographic methods, but by model-building, comparing a plausible molecular model for the structure with the observed fiber diffraction patterns. This resulted in 1953 in a structure with key features, notably of an antiparallel right-handed double-helix arrangement, “Watson–Crick” A:T and C:G base pairing (Fig. 1A), a 3.4 Å base pair repeat and exactly 10 base pairs per helical turn, that best fitted the (B-DNA) fiber diffraction data. Sequence-dependent structural information at the individual nucleotide and base pair level is unavailable from this approach. Inevitably, there were some (albeit a small minority) who questioned the validity of the antiparallel Watson–Crick base-paired double helix concept in view of its reliance on molecular modeling, rather than being the result of purely crystallographic analyses. A subsequent series of careful quantitative analyses and structure refinements of both A- and B-DNA fiber diffraction structures (as well as of other natural and synthetic DNA and RNA polynucleotide fibers) by Arnott, Fuller, Wilkins and their colleagues (5Arnott S. Hutchinson F. Spencer M. Wilkins M.H. Fuller W. Langridge R. X-ray diffraction studies of double helical ribonucleic acid.Nature. 1966; 211: 227-232Crossref PubMed Scopus (36) Google Scholar, 6Chandrasekaran R. Arnott S. The structure of B-DNA in oriented fibers.J. Biomol. Struct. Dyn. 1996; 13: 1015-1027Crossref PubMed Scopus (72) Google Scholar) did much to dispel doubters. The ramifications of the double helix concept for biology and genetics have been profound and are fully consistent with the model. However, a formal crystallographic “proof” of the double helix concept that does not have any inbuilt assumptions only became available in 1980, 27 years after the first announcement of the structure. Fiber diffraction is an excellent technique for studying the polymorphism of DNA (and RNA) random- and repetitive-sequence natural and synthetic polynucleotides at moderate resolution, up to ca 2.5 Å. However, it is inherently unable to examine effects at the local nucleotide or base pair level. By contrast, single-crystal studies (together with NMR) have enabled over 2000 oligonucleotide structures to be unequivocally determined, covering a wide range of DNA sequences (and diverse structures). These are increasingly at atomic-level high resolution, occasionally even at <0.7 Å, enabling the finest points of detail to be defined, not least sequence-dependent properties, base tautomerism, base-base hydrogen bonding, and water networks associated with DNA. It has been for long realized that the inherent limitations of fiber diffraction cannot provide atomic-level information and data on the effects of particular sequences on the double-helix structure of genomic DNA because as stated above, the technique averages structural information over all sequences present in a fiber. The simplest repeating unit that could possibly reveal some detail at the individual nucleotide level is a dinucleotide (or a dinucleoside monophosphate), possessing the key 3′-5′ sugar phosphate linkage. The first single-crystal determination of such a sequence was in 1971, of the ribo-dinucleoside phosphate r(UA) in 1971 (7Seeman N.C. Sussman J.L. Berman H.M. Kim S.H. Nucleic acid conformation: Crystal structure of a naturally occurring dinucleoside phosphate (UpA).Nat. New Biol. 1971; 233: 90-92Crossref PubMed Scopus (57) Google Scholar, 8Rubin J. Brennan T. Sundaralingam M. Crystal structure of a naturally occurring dinucleoside monophosphate: Uridylyl (3',5') adenosine hemihydrate.Science. 1971; 174: 1020-1022Crossref PubMed Scopus (24) Google Scholar, 9Sussman J.L. Seeman N.C. Kim S.H. Berman H.M. Crystal structure of a naturally occurring dinucleoside phosphate: Uridylyl 3',5'-adenosine phosphate model for RNA chain folding.J. Mol. Biol. 1972; 66: 403-421Crossref PubMed Scopus (169) Google Scholar), which crucially did not rely on a preconceived model for structure determination. This (RNA) fragment although not forming a conventional double helix revealed several novel features about nucleic acid conformation and paved the way for subsequent studies on other helical fragments (see below). Some (but not all) of these early dinucleoside crystal structures were deposited in the Cambridge Crystallographic Data Base—those that were not, appear to be lost to posterity. The definitive validation of the structure of the DNA double helix did not occur until oligonucleotide synthesis at the multimilligram level became feasible and ultimately widely available. This advance enabled single-crystal studies of many defined-sequence oligonucleotides, from the 1970s onward. They have revealed a richness of detail that was and still is, unavailable from fiber diffraction studies. Two seminal crystal structures (10Rosenberg J.M. Seeman N.C. Kim J.J. Suddath F.L. Nicholas H.B. Rich A. Double helix at atomic resolution.Nature. 1973; 243: 150-154Crossref PubMed Scopus (130) Google Scholar, 10Rosenberg J.M. Seeman N.C. Kim J.J. Suddath F.L. Nicholas H.B. Rich A. Double helix at atomic resolution.Nature. 1973; 243: 150-154Crossref PubMed Scopus (130) Google Scholar, 11Day R.O. Seeman N.C. Rosenberg J.M. Rich A. A crystalline fragment of the double helix: The structure of the dinucleoside phosphate guanylyl-3',5'-cytidine.Proc. Natl. Acad. Sci. U. S. A. 1973; 70: 849-853Crossref PubMed Scopus (101) Google Scholar, 12Seeman N.C. Rosenberg J.M. Suddath F.L. Kim J.J. Rich A. RNA double-helical fragments at atomic resolution. I. The crystal and molecular structure of sodium adenylyl-3',5'-uridine hexahydrate.J. Mol. Biol. 1976; 104: 109-144Crossref PubMed Scopus (291) Google Scholar, 13Rosenberg J.M. Seeman N.C. Day R.O. Rich A. RNA double-helical fragments at atomic resolution. II. The crystal structure of sodium guanylyl-3',5'-cytidine nonahydrate.J. Mol. Biol. 1976; 104: 145-167Crossref PubMed Scopus (259) Google Scholar), again of self-complementary ribo-dinucleoside phosphates, the sequence r(GC) and r(AU), were the first to demonstrate the existence of Watson–Crick base pairs (Fig. 1A) within antiparallel double helices, albeit short two-base pair ones. These are not short DNA but RNA helical fragments whose helical appearance and parameters are satisfyingly in accord with earlier fiber diffraction analyses of natural and synthetic double-stranded A-RNA type polyribonucleotides, having base pairs inclined with respect to the helix axis. The average helical twist angle of 32.5° in these two double-helical fragment structures is compatible with a standard A-type helix, having an average of 11 base pairs per complete helical turn (14Arnott S. Hukins D.W. Dover S.D. Optimised parameters for RNA double-helices.Biochem. Biophys. Res. Commun. 1972; 48: 1392-1399Crossref PubMed Scopus (220) Google Scholar). Wing et al. (15Wing R.M. Drew H.R. Takano T. Broka C. Tanaka S. Itakura K. Dickerson R.E. Crystal structure analysis of a complete turn of B-DNA.Nature. 1980; 287: 755-758Crossref PubMed Scopus (709) Google Scholar) reported in 1980 the first crystal structure of an oligonucleotide displaying a full helical turn, determined by the classic isomorphous replacement methods of protein crystallography, so that there was no bias in the structure from any preconceived structural model. This structure is of the self-complementary dodeca-deoxyribonucleotide d(CGCGAATTCGCG). Two strands associate together to form in the crystal (and in solution) a B-type DNA Watson–Crick base-paired antiparallel double helix (Fig. 2A), albeit with helicity slightly greater than the 10 base pairs per turn in the exactly repetitious fiber diffraction B-DNA model. These features of this, the so-called “Dickerson-Drew” dodecamer, constitute a formal atomic-level validation of the original Watson–Crick model for B-DNA. The B-type helix is still considered to be the most representative form for most of the DNA in the human genome. This and subsequent crystal structures have also revealed much more than the “monotonous” double helical features in the fiber diffraction model. Most significant are the sequence-dependent features of flexibility and variations in base pair morphology and backbone conformation, as highlighted in the central four base pair d(AATT) region of the Dickerson-Drew sequence, where there is a narrowing of the minor groove width. As a consequence, a highly structured water network is localized in this groove (Fig. 3), which is termed the “spine of hydration”, with hydrogen bonds to phosphate groups and O4’ sugar ring atoms at the mouth and walls of the groove and to base edges on the floor of the groove (16Drew H.R. Dickerson R.E. Structure of a B-DNA dodecamer: III. Geometry of hydration.J. Mol. Biol. 1981; 151: 535-556Crossref PubMed Scopus (799) Google Scholar). Since the original structure determination, at 1.9 Å resolution, many further analyses of this sequence at higher atomic-level resolution, and with more modern crystallographic refinement methodology, have been undertaken (see for example: refs (17Tereshko V. Minasov G. Egli M. The Dickerson-Drew B-DNA dodecamer revisited at atomic resolution.J. Am. Chem. Soc. 1999; 121: 470-471Crossref Scopus (162) Google Scholar, 18Lercher L. McDonough M.A. El-Sagheer A.H. Thalhammer A. Kriaucionis S. Brown T. Schofield C.J. Structural insights into how 5-hydroxymethylation influences transcription factor binding.Chem. Commun. (Camb.). 2014; 50: 1794-1796Crossref PubMed Google Scholar)). The structure shown in Figure 2A, at 1.3 Å resolution, is typical of these, and the fundamental sequence-dependent features are retained in them, not least the spine of hydration.Figure 3Detail of the water structure in the B-DNA dodecamer minor groove (18Lercher L. McDonough M.A. El-Sagheer A.H. Thalhammer A. Kriaucionis S. Brown T. Schofield C.J. Structural insights into how 5-hydroxymethylation influences transcription factor binding.Chem. Commun. (Camb.). 2014; 50: 1794-1796Crossref PubMed Google Scholar), showing the water molecules (in cyan) and hydrogen bonds to waters and DNA. PDB, Protein Data Bank.View Large Image Figure ViewerDownload Hi-res image Download (PPT) An A-tract is defined as a short run of adenosine residues, often within a longer sequence, for example d(AAAA) within the sequence d(CGAAAATTTTCG). It has been suggested that the structural features of the A-tracts seen in the Dickerson-Drew and other DNA crystal structures are a consequence of crystal packing forces rather than being intrinsic properties of DNA local structure. A feature of the original native dodecamer Dickerson-Drew crystal structure is that its orthorhombic crystal packing involves the ends of one molecule interlocking with another, potentially constraining the ability of the central region to deform according to sequence and crystal packing effects. Surveys of the many such dodecamer crystal structures in the PDB (for example, in refs (20Dickerson R.E. Goodsell D.S. Neidle S. “…The tyranny of the lattice…”.Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 3579-3583Crossref PubMed Scopus (190) Google Scholar, 21Marathe A. Karandur D. Bansal M. Small local variations in B-form DNA lead to a large variety of global geometries which can accommodate most DNA-binding protein motifs.BMC Struct. Biol. 2009; 24: 24Crossref Scopus (25) Google Scholar)) have revealed that the effects of intermolecular helix–helix interactions are actually small compared with the other forces involved, principally intramolecular base-base stacking and base edge–edge repulsions. This issue has also been addressed by dodecamers and other length DNA duplexes being crystallized in a variety of space groups. For example, duplex packing in the trigonal space group P32 which is sometimes observed when co-crystallized with nickel (2+) ions involves end-to-end pseudo-stacked helices running through the crystal structures, such as that of d(CGAATTAATTCG) (22Acosta-Reyes F.J. Pagan M. Fonfría-Subirós E. Saperas N. Subirana J.A. Campos J.L. The influence of Ni(2+) and other ions on the trigonal structure of DNA.Biopolymers. 2020; 8e23397Google Scholar). This arrangement releases the base pairs near to the helix termini to be free from any potential crystal packing constraints. Broader questions of the relationships between local DNA sequence, including purely AT ones, and structure have been explored in numerous subsequent structural, biophysical, and theoretical studies of other DNA sequences, often using the structures in the PDB to generate data for particular base steps and sequence variations. Sequence-dependent features require a number of morphological parameters to fully describe base and base pair flexibility and for qualitative and quantitative analyses. These parameters include base pair propeller twist, roll (Fig. 4), and helical twist between successive base pairs: a set of unambiguous definitions of these parameters, initially for duplex DNA and RNA, was agreed in 2001 at a meeting convened by the NDB (23Olson W.K. Bansal M. Burley S.K. Dickerson R.E. Gerstein M. Harvey S.C. Heinemann U. Lu X.-J. Neidle S. Shakked Z. Sklenar H. Suzuki M. Tung C.-S. Westhof E. Wolberger C. et al.A standard reference frame for the description of nucleic acid base-pair geometry.J. Mol. Biol. 2001; 313: 229-237Crossref PubMed Scopus (453) Google Scholar). Computational tools are now available for calculation of these morphological parameters (24Blanchet C. Pasi M. Zakrzewska K. Lavery R. CURVES+ web server for analyzing and visualizing the helical, backbone and groove parameters of nucleic acid structures.Nucleic Acids Res. 2011; 39: W68-W73Crossref PubMed Scopus (145) Google Scholar, 25Li S. Olson W.K. Lu X.J. Web 3DNA 2.0 for the analysis, visualization, and modeling of 3D nucleic acid structures.Nucleic Acids Res. 2019; 47: W26-W34Crossref PubMed Scopus (71) Google Scholar), which are for the most part also available directly from the NDB. As far as biological DNA in chromosomes is concerned, the overall view of duplex DNA being uniformly smoothly B-form is thus updated because of local variations in these parameters, which are dependent on sequence and sequence context. Several sets of rules have been formulated to explain these local variations in terms of responses by individual bases, base pairs, and base steps to intramolecular clashes between neighboring atoms and groups. The early Calladine-Drew rules (26Calladine C.R. Drew H.R. Principles of sequence-dependent flexure of DNA.J. Mol. Biol. 1986; 192: 907-918Crossref PubMed Scopus (138) Google Scholar) were in large part based on the data from the original Dickerson-Drew crystal structure. Subsequent extensions of these rules have taken data from other more recent DNA crystal structures in the PDB, as well as from high-quality molecular dynamics simulations (27Dans P.D. Balaceanu A. Pasi M. Patelli A.S. Petkevičiūtė D. Walther J. Hospital A. Bayarri G. Lavery R. Maddocks J.H. Orozco M. The static and dynamic structural heterogeneities of B-DNA: Extending Calladine-Dickerson rules.Nucleic Acids Res. 2019; 47: 11090-11102Crossref PubMed Scopus (21) Google Scholar). Base, base pair, and base-step local structure also play a key role in understanding DNA-protein recognition and consequent function (28Battistini F. Hospital A. Buitrago D. Gallego D. Dans P.D. Gelpí J.L. Orozco M. How B-DNA dynamics decipher sequence-selective protein recognition.J. Mol. Biol. 2019; 431: 3845-3859Crossref PubMed Scopus (16) Google Scholar). It should be borne in mind that the accuracy and precision of many (not least DNA) crystal structure determinations has improved with time, in line with improvements in (i) X-ray source intensity and detection, which have led to improved data quality and higher resolution and (ii) in refinement techniques and parameterization, so enabling improved accuracy and precision in these derived parameters. Dodecanucleotide and decanucleotide crystal structures have also been widely used as templates for numerous structure analyses probing changes in sequence in the central hexanucleotide or octanucleotide region to examine sequence-dependent properties in these central base pairs such as:(i)DNA bending (29Haran T.E. Mohanty U. The unique structure of A-tracts and intrinsic DNA bending.Q. Rev. Biophys. 2009; 42: 41-81Crossref PubMed Scopus (140) Google Scholar), which is an essential requirement for duplex DNA in many interactions with proteins, especially those involved in gene regulation (30Privalov P.L. Crane-Robinson C. Forces maintaining the DNA double helix and its complexes with transcription factors.Prog. Biophys. Mol. Biol. 2018; 135: 30-48Crossref PubMed Scopus (25) Google Scholar). Early crystal structures of dodecamers with A-tracts of sequence d(AnTn) showed significant intrinsic bending toward the minor groove direction (see for example, refs (31Dickerson R.E. Drew H.R. Structure of a B-DNA dodecamer: II. Influence of base sequence on helix structure.J. Mol. Biol. 1981; 149: 761-786Crossref PubMed Scopus (781) Google Scholar, 32DiGabriele A.D. Sanderson M.R. Steitz T.A. Crystal lattice packing is important in determining the bend of a DNA dodecamer containing an adenine tract.Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 1816-1820Crossref PubMed Scopus (231) Google Scholar)), with the A-tracts themselves being straight. Changes in base pair roll, buckle, and/or tilt at the A-tract ends result in bending at the junctions with general-sequence DNA, as shown for example by the crystal structure determination of d(ACCGAATTCGGT). This has t" @default.
• W3137306095 created "2021-03-29" @default.
• W3137306095 creator A5003587331 @default.
• W3137306095 date "2021-01-01" @default.
• W3137306095 modified "2023-10-12" @default.
• W3137306095 title "Beyond the double helix: DNA structural diversity and the PDB" @default.
• W3137306095 cites W1507208443 @default.
• W3137306095 cites W1515935592 @default.
• W3137306095 cites W1518002808 @default.
• W3137306095 cites W1581610674 @default.
• W3137306095 cites W1848841113 @default.
• W3137306095 cites W1914649288 @default.
• W3137306095 cites W1964401257 @default.
• W3137306095 cites W1978685619 @default.
• W3137306095 cites W1981888951 @default.
• W3137306095 cites W1982404448 @default.
• W3137306095 cites W1983023891 @default.
• W3137306095 cites W1987404880 @default.
• W3137306095 cites W1990384998 @default.
• W3137306095 cites W1990635146 @default.
• W3137306095 cites W1990779594 @default.
• W3137306095 cites W1994619028 @default.
• W3137306095 cites W1995767108 @default.
• W3137306095 cites W1997586605 @default.
• W3137306095 cites W1998085469 @default.
• W3137306095 cites W1999070393 @default.
• W3137306095 cites W2002298556 @default.
• W3137306095 cites W2007373812 @default.
• W3137306095 cites W2007812774 @default.
• W3137306095 cites W2011428226 @default.
• W3137306095 cites W2014359584 @default.
• W3137306095 cites W2014859154 @default.
• W3137306095 cites W2015005793 @default.
• W3137306095 cites W2015503736 @default.
• W3137306095 cites W2018559377 @default.
• W3137306095 cites W2023667758 @default.
• W3137306095 cites W2030643546 @default.
• W3137306095 cites W2035954399 @default.
• W3137306095 cites W2036400318 @default.
• W3137306095 cites W2037914687 @default.
• W3137306095 cites W2039845189 @default.
• W3137306095 cites W2042994965 @default.
• W3137306095 cites W2050913592 @default.
• W3137306095 cites W2052968074 @default.
• W3137306095 cites W2066004760 @default.
• W3137306095 cites W2066265569 @default.
• W3137306095 cites W2069688986 @default.
• W3137306095 cites W2071504229 @default.
• W3137306095 cites W2074677328 @default.
• W3137306095 cites W2076335297 @default.
• W3137306095 cites W2076424249 @default.
• W3137306095 cites W2084212424 @default.
• W3137306095 cites W2089965913 @default.
• W3137306095 cites W2090196960 @default.
• W3137306095 cites W2100380699 @default.
• W3137306095 cites W2108843451 @default.
• W3137306095 cites W2114053736 @default.
• W3137306095 cites W2117208578 @default.
• W3137306095 cites W2123093081 @default.
• W3137306095 cites W2124985974 @default.
• W3137306095 cites W2126466006 @default.
• W3137306095 cites W2128669859 @default.
• W3137306095 cites W2131711535 @default.
• W3137306095 cites W2135542964 @default.
• W3137306095 cites W2143225085 @default.
• W3137306095 cites W2147643191 @default.
• W3137306095 cites W2154609842 @default.
• W3137306095 cites W2160247403 @default.
• W3137306095 cites W2165855161 @default.
• W3137306095 cites W2169745877 @default.
• W3137306095 cites W2171830519 @default.
• W3137306095 cites W2172060739 @default.
• W3137306095 cites W2204959575 @default.
• W3137306095 cites W2238302853 @default.
• W3137306095 cites W2433523887 @default.
• W3137306095 cites W2520749639 @default.
• W3137306095 cites W2564783191 @default.
• W3137306095 cites W2613613516 @default.
• W3137306095 cites W2616798345 @default.
• W3137306095 cites W2617272526 @default.
• W3137306095 cites W2787782150 @default.
• W3137306095 cites W2794294274 @default.
• W3137306095 cites W2889403130 @default.
• W3137306095 cites W2897496062 @default.
• W3137306095 cites W2897637341 @default.
• W3137306095 cites W2935905363 @default.
• W3137306095 cites W2945411637 @default.
• W3137306095 cites W2946459547 @default.
• W3137306095 cites W2954390038 @default.
• W3137306095 cites W2959777842 @default.
• W3137306095 cites W2966334511 @default.
• W3137306095 cites W2980812100 @default.
• W3137306095 cites W2982318689 @default.
• W3137306095 cites W2992752060 @default.
• W3137306095 cites W2997227026 @default.
• W3137306095 cites W2998932481 @default.
• W3137306095 cites W3016808291 @default.
• W3137306095 cites W3021011563 @default.

• next